ID: 1150075072

View in Genome Browser
Species Human (GRCh38)
Location 17:62185286-62185308
Sequence CAATATACTCCCACTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150075063_1150075072 25 Left 1150075063 17:62185238-62185260 CCACCGTGAACTAGACCTGGGTC No data
Right 1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG No data
1150075066_1150075072 10 Left 1150075066 17:62185253-62185275 CCTGGGTCAAAGGCTCCATGTAT No data
Right 1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG No data
1150075067_1150075072 -5 Left 1150075067 17:62185268-62185290 CCATGTATTACCTAGCCCCAATA No data
Right 1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG No data
1150075062_1150075072 26 Left 1150075062 17:62185237-62185259 CCCACCGTGAACTAGACCTGGGT No data
Right 1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG No data
1150075064_1150075072 22 Left 1150075064 17:62185241-62185263 CCGTGAACTAGACCTGGGTCAAA No data
Right 1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150075072 Original CRISPR CAATATACTCCCACTTTAAC AGG Intergenic
No off target data available for this crispr