ID: 1150078569

View in Genome Browser
Species Human (GRCh38)
Location 17:62215908-62215930
Sequence ATCAATTAGAAGTCAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150078569_1150078574 14 Left 1150078569 17:62215908-62215930 CCATATCCTGACTTCTAATTGAT No data
Right 1150078574 17:62215945-62215967 TGCGGTAAACTTTATGTAAATGG No data
1150078569_1150078575 15 Left 1150078569 17:62215908-62215930 CCATATCCTGACTTCTAATTGAT No data
Right 1150078575 17:62215946-62215968 GCGGTAAACTTTATGTAAATGGG No data
1150078569_1150078576 28 Left 1150078569 17:62215908-62215930 CCATATCCTGACTTCTAATTGAT No data
Right 1150078576 17:62215959-62215981 TGTAAATGGGATAGTACATTAGG No data
1150078569_1150078572 -4 Left 1150078569 17:62215908-62215930 CCATATCCTGACTTCTAATTGAT No data
Right 1150078572 17:62215927-62215949 TGATAGGTTAGTTTTGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150078569 Original CRISPR ATCAATTAGAAGTCAGGATA TGG (reversed) Intergenic
No off target data available for this crispr