ID: 1150083399

View in Genome Browser
Species Human (GRCh38)
Location 17:62261059-62261081
Sequence TTCTCCTAAGAGGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150083399_1150083404 10 Left 1150083399 17:62261059-62261081 CCTGCACACTCCTCTTAGGAGAA No data
Right 1150083404 17:62261092-62261114 GGAGAAATTGCAGTTCAGGAAGG No data
1150083399_1150083403 6 Left 1150083399 17:62261059-62261081 CCTGCACACTCCTCTTAGGAGAA No data
Right 1150083403 17:62261088-62261110 AGATGGAGAAATTGCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150083399 Original CRISPR TTCTCCTAAGAGGAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr