ID: 1150083605

View in Genome Browser
Species Human (GRCh38)
Location 17:62262481-62262503
Sequence CAGGGGGCTCAGAGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150083597_1150083605 3 Left 1150083597 17:62262455-62262477 CCAGGCAGAGGCTGTGGCCAAGC No data
Right 1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG No data
1150083593_1150083605 21 Left 1150083593 17:62262437-62262459 CCGAGGGAGATGCTTTCTCCAGG No data
Right 1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150083605 Original CRISPR CAGGGGGCTCAGAGGGCTGC TGG Intergenic
No off target data available for this crispr