ID: 1150084137

View in Genome Browser
Species Human (GRCh38)
Location 17:62265424-62265446
Sequence CGGGAAGACACCTACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150084137_1150084154 27 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084154 17:62265474-62265496 AGAACGAGGTGCCCGTGGCGGGG No data
1150084137_1150084152 25 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084152 17:62265472-62265494 GAAGAACGAGGTGCCCGTGGCGG No data
1150084137_1150084151 22 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084151 17:62265469-62265491 GTGGAAGAACGAGGTGCCCGTGG No data
1150084137_1150084140 -8 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084140 17:62265439-62265461 TCTTCCCGGACAGCCCCACCAGG No data
1150084137_1150084153 26 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084153 17:62265473-62265495 AAGAACGAGGTGCCCGTGGCGGG No data
1150084137_1150084150 13 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084150 17:62265460-62265482 GGACAGGGTGTGGAAGAACGAGG No data
1150084137_1150084145 3 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084145 17:62265450-62265472 AGCCCCACCAGGACAGGGTGTGG No data
1150084137_1150084143 -3 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084143 17:62265444-62265466 CCGGACAGCCCCACCAGGACAGG No data
1150084137_1150084144 -2 Left 1150084137 17:62265424-62265446 CCCACAGGGTAGGTGTCTTCCCG No data
Right 1150084144 17:62265445-62265467 CGGACAGCCCCACCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150084137 Original CRISPR CGGGAAGACACCTACCCTGT GGG (reversed) Intergenic
No off target data available for this crispr