ID: 1150084551

View in Genome Browser
Species Human (GRCh38)
Location 17:62267022-62267044
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150084551_1150084562 30 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084562 17:62267075-62267097 GCCAGTCGGGGTCTGACCCCAGG No data
1150084551_1150084558 17 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084558 17:62267062-62267084 AAGCTGCCCTCGGGCCAGTCGGG No data
1150084551_1150084555 7 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084555 17:62267052-62267074 CAGTGTGAGGAAGCTGCCCTCGG No data
1150084551_1150084559 18 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084559 17:62267063-62267085 AGCTGCCCTCGGGCCAGTCGGGG No data
1150084551_1150084554 -6 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084554 17:62267039-62267061 AGGATCATGAGGACAGTGTGAGG No data
1150084551_1150084557 16 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084557 17:62267061-62267083 GAAGCTGCCCTCGGGCCAGTCGG No data
1150084551_1150084556 8 Left 1150084551 17:62267022-62267044 CCTCTGGGCCAGAACAGAGGATC No data
Right 1150084556 17:62267053-62267075 AGTGTGAGGAAGCTGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150084551 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intergenic