ID: 1150085207

View in Genome Browser
Species Human (GRCh38)
Location 17:62270005-62270027
Sequence GATGAAGGAGTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150085207_1150085212 -4 Left 1150085207 17:62270005-62270027 CCTCCTGGGGCGACTCCTTCATC No data
Right 1150085212 17:62270024-62270046 CATCCTCCAAGTCTCCAGGGTGG No data
1150085207_1150085211 -7 Left 1150085207 17:62270005-62270027 CCTCCTGGGGCGACTCCTTCATC No data
Right 1150085211 17:62270021-62270043 CTTCATCCTCCAAGTCTCCAGGG No data
1150085207_1150085210 -8 Left 1150085207 17:62270005-62270027 CCTCCTGGGGCGACTCCTTCATC No data
Right 1150085210 17:62270020-62270042 CCTTCATCCTCCAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150085207 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr