ID: 1150085947

View in Genome Browser
Species Human (GRCh38)
Location 17:62273279-62273301
Sequence TGTAGCCCTAGGAGAACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 3, 1: 0, 2: 2, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150085947_1150085957 11 Left 1150085947 17:62273279-62273301 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1150085957 17:62273313-62273335 CACCATGCCTTTTCCCCTCACGG 0: 13
1: 0
2: 0
3: 15
4: 208
1150085947_1150085962 22 Left 1150085947 17:62273279-62273301 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1150085962 17:62273324-62273346 TTCCCCTCACGGGACAGTGAGGG 0: 13
1: 0
2: 0
3: 8
4: 116
1150085947_1150085961 21 Left 1150085947 17:62273279-62273301 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1150085961 17:62273323-62273345 TTTCCCCTCACGGGACAGTGAGG 0: 13
1: 0
2: 0
3: 8
4: 106
1150085947_1150085958 12 Left 1150085947 17:62273279-62273301 CCCCCCGTTCTCCTAGGGCTACA 0: 3
1: 0
2: 2
3: 10
4: 100
Right 1150085958 17:62273314-62273336 ACCATGCCTTTTCCCCTCACGGG 0: 13
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150085947 Original CRISPR TGTAGCCCTAGGAGAACGGG GGG (reversed) Intronic