ID: 1150096569

View in Genome Browser
Species Human (GRCh38)
Location 17:62381452-62381474
Sequence AGGGCTTATGGACCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150096569_1150096575 11 Left 1150096569 17:62381452-62381474 CCAGCTTCTGGTCCATAAGCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1150096575 17:62381486-62381508 TATGCCAAGTGGAAAGGCGACGG 0: 1
1: 0
2: 1
3: 7
4: 91
1150096569_1150096573 0 Left 1150096569 17:62381452-62381474 CCAGCTTCTGGTCCATAAGCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1150096573 17:62381475-62381497 GTTTCTCAAACTATGCCAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1150096569_1150096574 5 Left 1150096569 17:62381452-62381474 CCAGCTTCTGGTCCATAAGCCCT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1150096574 17:62381480-62381502 TCAAACTATGCCAAGTGGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150096569 Original CRISPR AGGGCTTATGGACCAGAAGC TGG (reversed) Intronic
900433390 1:2613347-2613369 AGAGCCTATGGACCAGAGACTGG + Intronic
902466546 1:16622032-16622054 GGAGCTGATGGCCCAGAAGCTGG - Intergenic
902508113 1:16951014-16951036 GGAGCTGATGGCCCAGAAGCTGG + Exonic
903222109 1:21874819-21874841 AGGGCTCATGGAGAAGGAGCGGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
907267384 1:53271233-53271255 AGGTCTTCTGGTCCAGGAGCTGG + Exonic
914845463 1:151281513-151281535 AGGGCTCGCGGACCGGAAGCGGG - Intronic
915356311 1:155256962-155256984 AGGGCTAATGGTTCAGAAACTGG - Intronic
916674229 1:167053014-167053036 AGGTCTCATGGACCAGTGGCTGG - Exonic
916873356 1:168941070-168941092 AGGACTTGTGGATCAGGAGCAGG - Intergenic
919135401 1:193501468-193501490 TGGGCTTATGGTGCAGAAGCAGG - Intergenic
919333558 1:196203572-196203594 AGTGCTCATCTACCAGAAGCTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922412852 1:225392586-225392608 AGGGCATTTGGACTTGAAGCAGG - Intronic
1063161805 10:3423894-3423916 AGGGCTCATGGCCCTGAAGACGG + Intergenic
1067693722 10:48520580-48520602 AGGGCTTATGGAGCATAGACAGG + Intronic
1069810334 10:71154766-71154788 AGGGCATAGGGACCAGAAGCTGG + Intergenic
1073513613 10:104058073-104058095 ATGGCTAATGGACCAGATGATGG - Intronic
1074081347 10:110170405-110170427 AATGCTTCTGGACCAGAGGCTGG + Intergenic
1074513872 10:114146275-114146297 AGGGCTGCTGGACAAGGAGCAGG - Intronic
1077230673 11:1456992-1457014 TGGGCTTAAGGGCCAGAAGGTGG + Intronic
1077503556 11:2920001-2920023 TGGGCTTCTGGACCAGACCCTGG + Intronic
1078894524 11:15586162-15586184 AGGGCTTATCTGCCAGAACCAGG + Intergenic
1079023842 11:16930144-16930166 AGGGCTCATAGACCAGAGGAAGG + Intronic
1079165833 11:18042168-18042190 AGGATTTATGGATGAGAAGCAGG + Intronic
1081635143 11:44716141-44716163 AGGGCTTATGCCCCAGAATGTGG + Intergenic
1083770645 11:64864973-64864995 AGGGCTTCTGGACCTGGGGCAGG - Intronic
1084470381 11:69355995-69356017 AGGGCTTATGGAGCTTCAGCTGG + Intronic
1085201244 11:74703550-74703572 AGGGCCTCTGGTCCAGCAGCGGG + Intronic
1086616431 11:88826518-88826540 AGGGCCAATGGACCAGCATCTGG + Intronic
1087799663 11:102489720-102489742 AAGCCTTCTTGACCAGAAGCAGG - Intronic
1088722740 11:112608872-112608894 AGGACTTTAGGACCCGAAGCGGG - Intergenic
1089100833 11:115961258-115961280 AGGGCTGATGGAGGAGATGCAGG - Intergenic
1090412529 11:126518984-126519006 AAGGCTGATGGACAAGATGCTGG + Intronic
1091033886 11:132215902-132215924 AAGGCTTATTGACCCCAAGCCGG + Intronic
1091044840 11:132316204-132316226 ATGGCTTAAGGAGAAGAAGCCGG - Intronic
1093868816 12:24261823-24261845 AGAGGTTATGGAGTAGAAGCGGG - Intergenic
1097317476 12:58187380-58187402 AGGGCTCATGGAACAAAAGGAGG - Intergenic
1100711426 12:97261119-97261141 ATGGCTTACTGACGAGAAGCAGG - Intergenic
1101013744 12:100477766-100477788 GGGGCTTAAGGAGCAAAAGCTGG + Intronic
1101245013 12:102876847-102876869 AGGGCTAATGGACCAGAAAGAGG - Intronic
1102374363 12:112409616-112409638 ATTGCTTATAGACCGGAAGCCGG - Intronic
1104823733 12:131693841-131693863 AGGGCTCATGGACCATAGGGAGG + Intergenic
1106240117 13:27905105-27905127 AGGGCTGATGGACCAGAGCGGGG + Intergenic
1107385302 13:39901942-39901964 AGGGCTTATATATCAGAAGTAGG + Intergenic
1107629514 13:42328812-42328834 AGTGCTGATGGAACAGAAACTGG - Intergenic
1116902610 14:50376076-50376098 AGGGATTCTGGAACAGAAACAGG + Intronic
1119761655 14:77155847-77155869 AGGACTTGGGGACCAGAAGCTGG + Intronic
1121565887 14:94908772-94908794 AGGGCTTTTGGAGAAGCAGCTGG + Intergenic
1122359612 14:101151604-101151626 CGGGCTGAGGGACAAGAAGCCGG + Intergenic
1123507175 15:20954845-20954867 AGGGCATTTGGACCTGAAGTGGG - Intergenic
1123564404 15:21528595-21528617 AGGGCATTTGGACCTGAAGTGGG - Intergenic
1123600657 15:21965878-21965900 AGGGCATTTGGACCTGAAGTGGG - Intergenic
1124615097 15:31235879-31235901 GGAGCTTATGGCCCAGGAGCGGG + Intergenic
1125778550 15:42242198-42242220 TGGGCTCTTGGGCCAGAAGCAGG + Intronic
1126220258 15:46205158-46205180 AGGGCAAATGGACCAAAAGTAGG - Intergenic
1128129046 15:65213394-65213416 AGGGCTTATGAACCAAGGGCTGG - Intergenic
1202972763 15_KI270727v1_random:255697-255719 AGGGCATTTGGACCTGAAGTGGG - Intergenic
1134248698 16:12559127-12559149 AGGGGTTGGGGACCAGAAGAGGG - Intronic
1134366244 16:13581896-13581918 AGGGTCTATGGATCAGGAGCTGG - Intergenic
1134842981 16:17416301-17416323 TGTGCTTATGGAACAGAAACTGG + Intronic
1135573014 16:23563731-23563753 AGGGCAAACGGGCCAGAAGCTGG - Intronic
1137674344 16:50296937-50296959 ATGGCTTCTGAACCAGCAGCTGG + Intronic
1138597386 16:58036255-58036277 AGGGCTTGAGGACATGAAGCAGG + Intronic
1140649104 16:77067083-77067105 AGGGCTCATGGGCCAGACACTGG + Intergenic
1141609618 16:85174030-85174052 AGGGCGTAGGGAGCAGAAGCAGG - Intronic
1143529761 17:7496012-7496034 GGGGCTGATGGACCCGAGGCAGG + Exonic
1148166960 17:45490509-45490531 AGGGCTGAGGGCCCTGAAGCCGG + Intronic
1150096569 17:62381452-62381474 AGGGCTTATGGACCAGAAGCTGG - Intronic
1150657503 17:67049803-67049825 AGGGCAGCTGGACCAGAAGCTGG + Intronic
1152223626 17:79082589-79082611 AGGACTGATAGACCAGAGGCAGG - Intronic
1159160375 18:64637011-64637033 AGGTTTTGTGGACCAGGAGCTGG - Intergenic
1160573286 18:79832858-79832880 GGGGCTTAAGGAGCAGACGCAGG - Intergenic
1160950677 19:1665783-1665805 AGGCCTGATGGAGCAGGAGCTGG - Intergenic
1165641134 19:37387955-37387977 AGGGCTTAAAGACTAGAGGCAGG + Intronic
1168338728 19:55611758-55611780 AGGGATGATGGACAGGAAGCGGG + Intronic
924988224 2:289298-289320 AGGGCTTGGGGACCCGAACCTGG - Intergenic
925391448 2:3497139-3497161 AGGGATCAGGGAACAGAAGCAGG + Intergenic
925860298 2:8168893-8168915 AGTGCTTCTGCACAAGAAGCAGG + Intergenic
928759838 2:34569022-34569044 TGGGCTTATGGATCAGGAGAAGG + Intergenic
929804187 2:45130186-45130208 AGGGCTTTTGGCCTAGATGCTGG - Intergenic
929829437 2:45335101-45335123 AGGACTTGTGTCCCAGAAGCTGG + Intergenic
934638107 2:96009525-96009547 AGGGCTTCTGGAGGAGCAGCGGG - Intergenic
934795549 2:97095885-97095907 AGGGCTTCTGGAGGAGCAGCGGG + Intergenic
939099497 2:137879996-137880018 ATGGCTTAATGAGCAGAAGCCGG + Intergenic
940400192 2:153240450-153240472 AGGGCTACTGAACCACAAGCAGG - Intergenic
948220494 2:236265697-236265719 AGTGCAGATGGAACAGAAGCTGG - Intergenic
948267325 2:236644643-236644665 ATGGCTTCTGGGCGAGAAGCAGG - Intergenic
948396261 2:237647534-237647556 AGGGTTGAGGGAGCAGAAGCGGG + Intronic
948707876 2:239806430-239806452 AGGGCTCAGAGACCAGAAGCAGG - Intergenic
1168807566 20:681426-681448 AGGGCAAAGGGAGCAGAAGCAGG - Intergenic
1168955739 20:1832994-1833016 AGGGCGGAGGGCCCAGAAGCTGG + Intergenic
1169795538 20:9458965-9458987 TGGGCTTGTGGACATGAAGCTGG + Intronic
1170871752 20:20212586-20212608 CGGGCTCATGGACAAAAAGCAGG - Intronic
1171058620 20:21933575-21933597 AGGACTTGTGGCCCAGATGCAGG + Intergenic
1173927638 20:46792574-46792596 AGAGCTGAAGGACGAGAAGCAGG - Intergenic
1175200953 20:57277414-57277436 AGGGGAGATGGACGAGAAGCAGG + Intergenic
1175552149 20:59824495-59824517 AGGGCTAATGGAGCAGCACCCGG + Intronic
1175875097 20:62225758-62225780 AGGGCCTAAGGACAAGGAGCAGG + Intergenic
1175976497 20:62712878-62712900 AGGGCTGATGGCCCAGATGGTGG + Intronic
1178233485 21:30814393-30814415 AGGGCATATGGAACAGAAATAGG + Intergenic
1181115360 22:20629556-20629578 AGGGCTTAGGAACTAGAGGCAGG - Intergenic
1181319151 22:21991393-21991415 GGGGCTGATGGAGCTGAAGCAGG - Intergenic
1183207925 22:36432376-36432398 AGGGTTTATGGATCGGATGCAGG - Intergenic
950510920 3:13426056-13426078 AGGGCCTGGGGACCACAAGCAGG - Intergenic
950841996 3:15976650-15976672 AGGCCTGAGGGACCAGAGGCAGG - Intergenic
951320659 3:21240515-21240537 AGTGCTTATTTAGCAGAAGCTGG + Intergenic
953500301 3:43426582-43426604 AGGGCTGACTGCCCAGAAGCAGG + Intronic
956691072 3:71877915-71877937 ACAGCATATGGACTAGAAGCAGG + Intergenic
960290154 3:115874324-115874346 AGGGCTTAGGAAGAAGAAGCAGG - Intronic
960372053 3:116852641-116852663 AAGGCTTAAGGACCAGAACAGGG - Intronic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
966664122 3:182451342-182451364 AGGACTCATGGAGAAGAAGCTGG + Intergenic
970511161 4:16783153-16783175 AAGGCTTATGAACGAGAAGCAGG + Intronic
972538626 4:40020271-40020293 AGAGCTCAGGGACCAGTAGCTGG - Intergenic
976025747 4:80686314-80686336 AGGGCTTAGAGAGCAGAAGAAGG + Intronic
976350384 4:84053842-84053864 ATGGCTTGGGGAGCAGAAGCTGG + Intergenic
977290370 4:95159419-95159441 GGGGCTGATGGACCAGAGGAGGG + Intergenic
979260102 4:118637049-118637071 AGGTCTTTTGCACCAGAAGGTGG + Intergenic
980710818 4:136564723-136564745 AGGGCTTATGTACGAGAACCAGG - Intergenic
981164536 4:141541842-141541864 AGGGCTTAATAACCAAAAGCTGG - Intergenic
982071882 4:151702790-151702812 AGGGCTTATGTAGAAAAAGCAGG + Intronic
982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG + Intergenic
983859909 4:172693107-172693129 AGGGCAAATGGAACAGAAGAGGG + Intronic
986356813 5:6936784-6936806 AGGTCTAAGGGACCAGAAGGAGG + Intergenic
987148623 5:15017035-15017057 ATGGCATCTGGTCCAGAAGCTGG - Intergenic
987599199 5:20043460-20043482 AGAACTTGTGGACCAGAAGGGGG + Intronic
990706393 5:58534697-58534719 AGGGGTAATGGGCAAGAAGCTGG + Intergenic
992172557 5:74118716-74118738 AGGGCTTAGGGAACTGACGCAGG - Intergenic
992267702 5:75034518-75034540 AAGGCTTATGGGCAGGAAGCAGG + Intergenic
993639898 5:90389980-90390002 AAGGTTTATGGACCTCAAGCTGG - Intergenic
997969942 5:138392751-138392773 TGAGGTTATGGTCCAGAAGCGGG + Intronic
999288122 5:150406368-150406390 AGGGGGTATGGAGCAGGAGCCGG + Intronic
1001243364 5:170087013-170087035 AGGCCTTATGGACAAGCAACTGG + Intergenic
1006965676 6:37981953-37981975 AGGGCTTCTGGGTCATAAGCAGG + Intronic
1007234797 6:40382809-40382831 AGTGCTTATGGGACAGAAGTAGG - Intergenic
1008287174 6:49667988-49668010 TGGGAATATGGAGCAGAAGCAGG - Intergenic
1010500156 6:76589161-76589183 TGGACTTATGGACTAGAAACTGG + Intergenic
1012305860 6:97656364-97656386 TGGGCTTCTGCACCAGATGCAGG + Intergenic
1012941724 6:105422904-105422926 AGGTCTTGGGGACCAGAGGCTGG + Intergenic
1013044171 6:106467934-106467956 AGGGATTATGGTCCTGAAGTAGG + Intergenic
1015790049 6:136957570-136957592 TGGGATGATGGAGCAGAAGCTGG + Intergenic
1016203192 6:141438877-141438899 ATGGCTCATGGACCAGAGGATGG - Intergenic
1017524104 6:155227781-155227803 AAGGCTTATGTTCCAAAAGCAGG + Intronic
1019067220 6:169312448-169312470 GGGGCTTGTGGAAAAGAAGCCGG - Intergenic
1019625167 7:2012190-2012212 AGGACTCATTGACCAGATGCTGG - Intronic
1023633535 7:42186106-42186128 TGGGCTTATGCTGCAGAAGCTGG + Intronic
1026972937 7:74479030-74479052 AGAGCTTTGGGACCAGGAGCTGG - Intronic
1028394469 7:90352178-90352200 AGGGCTTTGGGAAAAGAAGCAGG + Intronic
1030658195 7:112191282-112191304 AGTGAGGATGGACCAGAAGCAGG - Intronic
1033133753 7:138767842-138767864 AGGGCTTATAGAGCAGATGGTGG - Intronic
1038535319 8:28349314-28349336 AGGCCTTCTGCACCAGGAGCTGG - Intronic
1039029802 8:33297062-33297084 AAGGCTTAAGCACCAGAAGTGGG + Intergenic
1040285360 8:46097956-46097978 AGGGATTCTGGACCAGAATCTGG - Intergenic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1043158895 8:76821039-76821061 AGGGCTTATCATCCTGAAGCAGG - Intronic
1047555137 8:125921074-125921096 AGCTCCTATGGCCCAGAAGCTGG - Intergenic
1048044001 8:130756273-130756295 GGGGGTTATAGCCCAGAAGCAGG - Intergenic
1051696356 9:19772049-19772071 AGGGCTTCTGGGCAAGAAGTAGG + Intronic
1052716053 9:32118679-32118701 AGGGTATCTGGACCAGAAGCTGG - Intergenic
1058541131 9:106013804-106013826 AGGGATTATGGAACAGAAAAAGG + Intergenic
1059548008 9:115198315-115198337 AGGGCTCATACACCAGCAGCCGG + Intronic
1059871230 9:118580049-118580071 AGGGAATATGGAACAGAAGCAGG + Intergenic
1060306982 9:122422245-122422267 AGGGCTTCTGGACCATGGGCAGG + Intergenic
1060557811 9:124518189-124518211 AGGGCTTCAGGCCCAGAAGACGG + Exonic
1060886809 9:127160386-127160408 AGGGCTTCTGGAGCAGAACGAGG + Intronic
1062421666 9:136485317-136485339 AGGGTCTATGGCCCAGAGGCTGG - Exonic
1187386406 X:18852556-18852578 GAGGCCTGTGGACCAGAAGCCGG + Intergenic
1188789291 X:34388358-34388380 GAGGCTTCTGGACCAGGAGCTGG - Intergenic
1190385784 X:49881020-49881042 TGGGCTCATGGGCCAGAAGGAGG - Exonic
1191217948 X:57952491-57952513 AGGACTACTGGTCCAGAAGCTGG + Intergenic
1198312432 X:135435566-135435588 GGAGCTGATGGCCCAGAAGCTGG + Intergenic