ID: 1150096596

View in Genome Browser
Species Human (GRCh38)
Location 17:62381601-62381623
Sequence CGATCTTGGTGGAGTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150096596 Original CRISPR CGATCTTGGTGGAGTCAGGG AGG (reversed) Intronic
901155395 1:7134047-7134069 CTACCTGGGGGGAGTCAGGGAGG - Intronic
901880196 1:12189203-12189225 AGCTCCTGGGGGAGTCAGGGAGG + Intronic
906844872 1:49181071-49181093 CAGTCATGGTGGAGGCAGGGAGG + Intronic
908806962 1:67941615-67941637 CGAGCTTCATGGAGTCAGGTGGG - Intergenic
909101697 1:71357200-71357222 GGAGCTTGGTGGAGTCCGAGTGG + Intergenic
910282458 1:85516452-85516474 AAATCTTGGTGGAAACAGGGTGG - Intronic
910884307 1:91949607-91949629 CGATGTTGATGGGGTCGGGGAGG - Exonic
913334939 1:117700741-117700763 TGATCTGGAAGGAGTCAGGGTGG - Intergenic
913360489 1:117975199-117975221 GGGTCATGGTGGAGGCAGGGGGG + Intronic
914207633 1:145547438-145547460 AAATCTTGGTGGAAACAGGGTGG + Intergenic
919910679 1:202108866-202108888 TGACCTTGGTGGAGGCAGGAAGG - Intergenic
922155790 1:223038937-223038959 TGACCATGGTGGAGTCAGGTTGG + Intergenic
1064555124 10:16540363-16540385 AGGTCTTGGTGGAGACAGAGGGG + Intergenic
1069685017 10:70312408-70312430 CCTTCTGGGTGGAGTCAGGCGGG + Intronic
1070777921 10:79120844-79120866 CCACCTTGGTGGAGGCAGGCAGG - Intronic
1075232124 10:120689516-120689538 GGCTCTTGGTGGAGTCACTGAGG + Intergenic
1076831477 10:132996528-132996550 GGGTCTTCGTGGGGTCAGGGTGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1078790502 11:14537268-14537290 CGAGGGTGGTGGGGTCAGGGAGG - Intronic
1079339041 11:19596995-19597017 GGCAGTTGGTGGAGTCAGGGGGG - Intronic
1090500315 11:127254626-127254648 GCATCTGGGTGGAGGCAGGGAGG + Intergenic
1095263680 12:40128432-40128454 CCATCTTGGTAGAGTTGGGGTGG - Intergenic
1100222960 12:92525901-92525923 TGATCAAGGTGGAGTCAGTGTGG - Intergenic
1105942725 13:25164191-25164213 CCATCTTGGTGGGTTCTGGGTGG - Intronic
1106964208 13:35039221-35039243 CCATGCTGCTGGAGTCAGGGAGG + Intronic
1111698735 13:91659746-91659768 CGATCATGGTGGAGGCGGTGGGG - Intronic
1116771469 14:49131627-49131649 CGAGCTTGGTGGGGTGGGGGGGG - Intergenic
1120682602 14:87498634-87498656 CTGTCTTCATGGAGTCAGGGTGG - Intergenic
1122199609 14:100114448-100114470 GGAGCTTGCTGGAGTCAGGTGGG + Intronic
1123087443 14:105723394-105723416 CGAGCTGGGTGGACTGAGGGGGG - Intergenic
1125587066 15:40828497-40828519 GTATCTTGGAGGAGTCCGGGTGG + Exonic
1131540228 15:93269468-93269490 CAGTCTTGGTGGAGTAGGGGTGG + Intergenic
1132760564 16:1506814-1506836 CGATCTCGGTGCAGGCAAGGCGG + Intronic
1134437353 16:14273065-14273087 CCATCTTGGTGGTTTCAGGTAGG - Intergenic
1138478165 16:57284225-57284247 CGATCTTGGGGGCGTCCGTGCGG + Intronic
1139430242 16:66907274-66907296 CCATCTCTGGGGAGTCAGGGTGG - Intergenic
1140941051 16:79722414-79722436 CTATCGTGGTGGTGTCATGGTGG + Intergenic
1140985223 16:80152396-80152418 CGAGCTTGGGGGAGGCAAGGAGG - Intergenic
1141324034 16:83038909-83038931 CGAACTTGATGAAGTCAGGTTGG + Intronic
1203139630 16_KI270728v1_random:1753053-1753075 AGATCCTGGGGGAGTCATGGGGG - Intergenic
1143335965 17:6171643-6171665 GGATCTTGATGGAGTGAAGGTGG - Intergenic
1146553380 17:33801470-33801492 TGGTTTGGGTGGAGTCAGGGAGG + Intronic
1147376699 17:40026902-40026924 CCACTTTGGTGGAGTCGGGGCGG + Exonic
1148788868 17:50161726-50161748 AGATGTGGGTGGAGTCTGGGAGG + Intergenic
1149010931 17:51855514-51855536 CTTTCTTGCTGGAGTTAGGGTGG - Intronic
1150096596 17:62381601-62381623 CGATCTTGGTGGAGTCAGGGAGG - Intronic
1151520801 17:74628006-74628028 AGGTGTCGGTGGAGTCAGGGTGG - Intergenic
1152296412 17:79469686-79469708 CCATCCTGGTGGAATGAGGGAGG - Intronic
1155883326 18:31177580-31177602 CAATCATGGTGGAGGCAAGGAGG - Intergenic
1158853386 18:61517920-61517942 GGAGCTTGGTGGAGGGAGGGGGG + Intronic
1162820968 19:13223508-13223530 TCATCTGGGTGGAGACAGGGCGG - Intronic
1162933058 19:13966716-13966738 CGAGCTCTGTGAAGTCAGGGAGG + Exonic
1163358520 19:16830113-16830135 GGATCTGGGGGGAGGCAGGGAGG + Intronic
1163561592 19:18022500-18022522 AGATCCCTGTGGAGTCAGGGTGG + Intergenic
1164672685 19:30081902-30081924 GGATCCTGGTGGAGTCAGCTGGG - Intergenic
926235465 2:11039884-11039906 TGATCATGGAGGAGGCAGGGAGG - Intergenic
927218177 2:20681827-20681849 GGGTGTTGGTGGAGGCAGGGAGG + Intergenic
927887733 2:26728798-26728820 GAAACTTGGTGGGGTCAGGGAGG + Exonic
928278533 2:29923043-29923065 CTATCTTGGTGGAGGAAGGGTGG + Intergenic
929393599 2:41497883-41497905 CCATCTTGATGGTGTTAGGGAGG - Intergenic
930838858 2:55824706-55824728 AGAGCTAGGTGGAGTCTGGGTGG + Intergenic
930902384 2:56523049-56523071 AGATATTGATGGAGTCAGGTTGG - Intergenic
934058214 2:88270145-88270167 CGGACTTGGTGGGGTCTGGGAGG + Intergenic
938125252 2:128666445-128666467 AGATCCTGGTGGAGTCAGATTGG + Intergenic
1170483736 20:16794256-16794278 TGCTATTGGTGGAGGCAGGGTGG - Intergenic
1171367174 20:24633323-24633345 CGGGCTGGGTGGTGTCAGGGAGG - Intronic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1173717049 20:45217541-45217563 TGACCTTGGTGGGGGCAGGGGGG + Intergenic
1175520701 20:59600839-59600861 GAATCTGGGTGGAGACAGGGAGG + Intronic
1178102816 21:29288449-29288471 GAATTTTGGTGGAGTCGGGGAGG - Intronic
1180101975 21:45592224-45592246 CCCTCATGGTGGAGTTAGGGCGG - Intergenic
1181466336 22:23112566-23112588 AGCTCCTGGTGGAGTCAGGGTGG + Intronic
1182066607 22:27435734-27435756 CGATGCTGGTGGAGGCAGGGAGG - Intergenic
1183778449 22:39983346-39983368 CCATATTGGAGGAGTCAGGATGG - Intergenic
1184260751 22:43314482-43314504 CCATGGTGGTGGGGTCAGGGGGG - Intronic
1184659670 22:45960091-45960113 TGATCCTGCTGGTGTCAGGGTGG - Intronic
1185182485 22:49371487-49371509 CCATCTTCGTGGTGGCAGGGAGG - Intergenic
950137004 3:10588582-10588604 GGATACTGGTGGAGTCAGGCTGG - Intronic
963242143 3:143017065-143017087 CGTTTTTGGTGGGGGCAGGGTGG + Intronic
980157626 4:129126362-129126384 CAAGCTTGGTGGAGGGAGGGGGG - Intergenic
981749866 4:148082870-148082892 CGAGCTTGGTGGGGGAAGGGGGG + Intronic
985897922 5:2760268-2760290 TGATCTGGGTGGAGCCTGGGTGG - Intergenic
986085757 5:4444063-4444085 GGTTCTTTGGGGAGTCAGGGAGG - Intergenic
986346133 5:6837126-6837148 GGAGCTGGCTGGAGTCAGGGAGG + Intergenic
995888025 5:116918020-116918042 AGGTCATGGTGGAGTCATGGTGG - Intergenic
1001336162 5:170798618-170798640 TGATCTTGGGAGAGTAAGGGTGG - Intronic
1004662213 6:17720762-17720784 ACAGCTTGGTGGGGTCAGGGTGG - Intergenic
1005440994 6:25868522-25868544 CCATCTGGTTGGAGACAGGGAGG + Intronic
1007494711 6:42251969-42251991 CAAGCATGGGGGAGTCAGGGTGG - Intronic
1015014230 6:128390986-128391008 CCATCTTGATGGAGCCAGGGTGG + Intronic
1016923705 6:149318654-149318676 CGATTGTGGTTGAGTCAGGGAGG + Intronic
1019489926 7:1307551-1307573 AGTTCATGGTGGAGCCAGGGCGG - Intergenic
1019820101 7:3236281-3236303 CAAGCTTGATGGTGTCAGGGTGG - Intergenic
1020070672 7:5224904-5224926 CGATGGGGGTGGGGTCAGGGAGG - Intronic
1024636949 7:51298979-51299001 CAATCTTCATGGAGTCAGGGAGG + Intronic
1025003530 7:55338053-55338075 CGCTCTGGGTGGAGACAGTGAGG - Intergenic
1026297093 7:69062619-69062641 CGGGCTTGGTGGAATCAGCGGGG + Intergenic
1028070509 7:86444216-86444238 CAATCATGGTGGAGGCAAGGAGG - Intergenic
1030188885 7:106791057-106791079 TGATCTTGGTGGTCTCAAGGAGG - Intergenic
1036912005 8:12765531-12765553 CTATCAGGGTGGAGTTAGGGTGG + Intergenic
1038652926 8:29422053-29422075 CAATCCTGGTGGAGTGAGGTGGG + Intergenic
1041163095 8:55064707-55064729 CGATCTAGGCTGGGTCAGGGTGG - Intergenic
1042287508 8:67130271-67130293 CCTTTTTGGGGGAGTCAGGGAGG + Intronic
1048280885 8:133104896-133104918 AGAGCTTGGTGAAGTCAGTGGGG - Intronic
1049512727 8:143037905-143037927 CCTCCTAGGTGGAGTCAGGGTGG - Intergenic
1050674412 9:8036134-8036156 AGATTTTGGAGGGGTCAGGGTGG - Intergenic
1052246786 9:26346537-26346559 GGATCTTTGTGGTGTCAGGCAGG + Intergenic
1053452113 9:38202172-38202194 TCATCCTGGTGGAGTCAGAGAGG - Intergenic
1056582168 9:87897157-87897179 GGAGCTTGCTGGAGCCAGGGTGG + Intergenic
1059420375 9:114186849-114186871 GGACCATGGTGGAGTCAGGTGGG + Intronic
1059770000 9:117415351-117415373 AGAACTGGGTTGAGTCAGGGGGG - Intergenic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1190328694 X:49222671-49222693 GGATGATGGTGGAGTCGGGGTGG - Intronic
1191045312 X:56129808-56129830 CAAACTTGGTGCTGTCAGGGTGG + Intergenic
1191818339 X:65274097-65274119 GGATCTTCCTGGAGTCAGGAGGG + Intergenic
1193394478 X:80967904-80967926 CAATCTTGGTGGGGTGAGGGGGG + Intergenic
1195344948 X:103940498-103940520 CGATCTTGGTGGGGGGAGAGGGG - Intronic
1199749595 X:150802474-150802496 GAATCTTGCTTGAGTCAGGGAGG + Intronic