ID: 1150098779

View in Genome Browser
Species Human (GRCh38)
Location 17:62403326-62403348
Sequence TACACTAGGGTGTTTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150098779_1150098784 -2 Left 1150098779 17:62403326-62403348 CCCCACAGAAACACCCTAGTGTA 0: 1
1: 0
2: 0
3: 6
4: 179
Right 1150098784 17:62403347-62403369 TAAGAAAGTCACTATCTTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150098779 Original CRISPR TACACTAGGGTGTTTCTGTG GGG (reversed) Intronic
905539184 1:38746643-38746665 TATCCTGGGGTGTTTCAGTGTGG - Intergenic
909231363 1:73094265-73094287 TACAGTTTGGTGTTCCTGTGCGG + Intergenic
912709590 1:111940853-111940875 AACACCAGGGTGTGTATGTGGGG - Intronic
912899398 1:113631338-113631360 TAAAATTTGGTGTTTCTGTGGGG + Intronic
917306099 1:173627250-173627272 TTCAATTTGGTGTTTCTGTGGGG - Intronic
917334826 1:173916262-173916284 TACACAAGGGGGTCTGTGTGTGG + Intronic
917620192 1:176787732-176787754 TCCTTTAGTGTGTTTCTGTGAGG + Intronic
918972644 1:191439693-191439715 TACAGGAGGGTTTTTGTGTGGGG + Intergenic
919241348 1:194920861-194920883 TAAACCTGGGTGTGTCTGTGTGG + Intergenic
920666583 1:207967068-207967090 TACATTAAAGTGTATCTGTGAGG - Intergenic
920667923 1:207979627-207979649 TACACTAAAGTGTATCTGTGAGG - Intergenic
921446765 1:215255741-215255763 TACTCTAGGGTGTATGTTTGGGG + Intergenic
924469487 1:244328470-244328492 TACACTTAGGTTTTTCTTTGTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065214009 10:23432382-23432404 ACCATAAGGGTGTTTCTGTGGGG - Intergenic
1067492993 10:46730928-46730950 CACACTAGGGTGTTTGGGTATGG - Intergenic
1067601671 10:47609480-47609502 CACACTAGGGTGTTTGGGTATGG + Intergenic
1070166716 10:73904429-73904451 TACTCTAGGGTTCTTCTATGGGG - Intergenic
1070697035 10:78571106-78571128 TACAGTATGGTGTGTGTGTGTGG - Intergenic
1071653197 10:87417060-87417082 CACACTAGGGTGTTTGGGTGTGG + Intergenic
1072040964 10:91606312-91606334 TCCACAAGGGCATTTCTGTGTGG - Intergenic
1072209757 10:93235674-93235696 TAATCTTGGGTGTGTCTGTGAGG - Intergenic
1072759115 10:98041331-98041353 TACACCATGGTATTGCTGTGAGG - Intergenic
1073232888 10:101987327-101987349 AACACTAGGGATTTTCTGTGTGG - Intronic
1075931863 10:126304155-126304177 TACTTTTGGGTGTTTGTGTGAGG - Intronic
1079025814 11:16946799-16946821 TCCCCTAGGTTGTCTCTGTGGGG - Intronic
1081243453 11:40734831-40734853 TATTTTAGGGTGTGTCTGTGAGG + Intronic
1081961087 11:47138013-47138035 TCCTCTAGGGTGTGTGTGTGTGG - Intronic
1084795940 11:71504143-71504165 GACACTAGGCTGTATCTGGGTGG - Intronic
1086578111 11:88363568-88363590 TTCACTAGGGTCTGTCTGTGTGG - Intergenic
1087425007 11:97974390-97974412 TACAGTTGTGTGTTTGTGTGAGG + Intergenic
1087940010 11:104085188-104085210 AACACAAGGGGGTTTCTTTGTGG - Intronic
1088713196 11:112526502-112526524 TACTTCATGGTGTTTCTGTGAGG - Intergenic
1095903374 12:47351949-47351971 TACTTTGGGGTGTGTCTGTGAGG - Intergenic
1097119395 12:56719853-56719875 TACAGTAGGGTCTTTCTTGGTGG + Exonic
1097821036 12:64129489-64129511 TACTCCTGGGTGTGTCTGTGAGG - Intronic
1098589000 12:72187697-72187719 TATTTTGGGGTGTTTCTGTGAGG - Intronic
1100018972 12:90046997-90047019 AATATTTGGGTGTTTCTGTGAGG + Intergenic
1100172861 12:91996421-91996443 TTGACTAGGGTATTTCTGTAAGG - Intronic
1100868606 12:98886144-98886166 TACAGTAGGAAGTTTGTGTGAGG - Intronic
1104585234 12:130042784-130042806 TGCACCAGTGTGTTTGTGTGTGG - Intergenic
1105982340 13:25531030-25531052 TACACTAGGATGATTGTGAGGGG - Intronic
1106350244 13:28922842-28922864 TAAAATATGGTGTTTCTGTTGGG + Intronic
1107221769 13:37989774-37989796 TACTTTTGGGTGTGTCTGTGAGG - Intergenic
1108339283 13:49481333-49481355 GACACTTGGGTTTTTGTGTGAGG + Intronic
1108451802 13:50574720-50574742 TACATTAGCGTGTCCCTGTGTGG - Intronic
1108754329 13:53481654-53481676 AACACCAGGATGTTTCAGTGTGG + Intergenic
1108875035 13:55036723-55036745 TAGCCTTGGGTGTGTCTGTGTGG + Intergenic
1108903763 13:55445634-55445656 TATTCTGGGGTGTGTCTGTGAGG - Intergenic
1108915037 13:55598000-55598022 TACACCAGTGTGTTTCAATGAGG - Intergenic
1110600122 13:77363448-77363470 TACACTCTGTTGTTTCTGTCAGG - Intergenic
1111357540 13:87128347-87128369 TAAATTAGGTTGTTTCTGTGTGG + Intergenic
1112657930 13:101473131-101473153 TTCAGTTTGGTGTTTCTGTGGGG - Intronic
1120889271 14:89477230-89477252 GACCCTAGGGAGCTTCTGTGTGG - Intronic
1124606977 15:31176763-31176785 GACAGTAGGGTGTCACTGTGGGG - Intergenic
1124860820 15:33438916-33438938 TACATTAGGATGTTTTTCTGTGG + Intronic
1125215844 15:37273500-37273522 TACATTTGGGTGTATGTGTGGGG - Intergenic
1131030815 15:89184756-89184778 CACACTAGTGTGTGGCTGTGAGG - Intronic
1136517895 16:30778811-30778833 TCCACCAGGGCGTTTCTGAGGGG + Exonic
1138977005 16:62220242-62220264 TATTCTAGGGTGTGTCTTTGAGG - Intergenic
1139229080 16:65265017-65265039 TAATCTTGGATGTTTCTGTGAGG + Intergenic
1141784521 16:86189992-86190014 TATACTAGGGTTTTCCTGTACGG + Intergenic
1144150096 17:12434923-12434945 TATATTTGGGTGTGTCTGTGAGG + Intergenic
1150098779 17:62403326-62403348 TACACTAGGGTGTTTCTGTGGGG - Intronic
1151982854 17:77524439-77524461 AACATTAGAGTGTTTCTGTGAGG - Intergenic
1153251072 18:3122351-3122373 TACACTAGGGTTTTGGGGTGGGG - Intronic
1153519260 18:5936888-5936910 TACAATAGGGTGTTTCATTTGGG + Intergenic
1155155677 18:23155659-23155681 AACACAAGGGTATTTCTGTCTGG + Intronic
1155281927 18:24249392-24249414 TACAATTTGGTGTTCCTGTGAGG - Intronic
1155411044 18:25545256-25545278 TTCAATTTGGTGTTTCTGTGGGG - Intergenic
1156990021 18:43398370-43398392 GACCCTGGGGTGTGTCTGTGAGG - Intergenic
1159292060 18:66435693-66435715 TAACCCGGGGTGTTTCTGTGAGG - Intergenic
1160423258 18:78763517-78763539 TACACTGGGGTGTTTAACTGTGG - Intergenic
1163697416 19:18771077-18771099 TACACGTGGGTATGTCTGTGTGG + Intronic
1164608449 19:29616540-29616562 TCCACTACGGTGTTTCTCTCTGG - Intronic
1165723582 19:38096880-38096902 TGCACTGAGGTGCTTCTGTGAGG + Intronic
1167153054 19:47720812-47720834 TACAGTTGTGTGCTTCTGTGTGG + Intronic
1167908709 19:52683935-52683957 TGCAGAAGGGTGTTTCTGGGCGG + Intronic
927162613 2:20282172-20282194 TACACTTGGTGTTTTCTGTGAGG - Intronic
928878921 2:36074641-36074663 TACTCTAGGGTTTTCCTGTATGG + Intergenic
930457856 2:51629617-51629639 TGCACGAGGGTAATTCTGTGTGG - Intergenic
932426715 2:71642301-71642323 TGCAGTTGTGTGTTTCTGTGGGG + Intronic
938062507 2:128264185-128264207 GTCACCAGGGTGTTTCTGGGAGG - Intronic
941169436 2:162118896-162118918 TACTCTTGGGTGTGTATGTGAGG - Intergenic
943193362 2:184709746-184709768 TACACTAGGAAGTTTATGTTTGG - Intronic
943764940 2:191650289-191650311 TACCTCAGGGTGTTGCTGTGAGG + Intergenic
943816389 2:192262574-192262596 TATTTTAGGGTGTGTCTGTGAGG - Intergenic
944508207 2:200437356-200437378 TACAGTAGGGTTTCTCTGGGTGG + Intronic
945726245 2:213474890-213474912 TAATCTGGGGTGTGTCTGTGAGG - Intronic
946125469 2:217558773-217558795 AACACTCGGGTGTTACAGTGAGG - Intronic
947481101 2:230500754-230500776 CACACAGGGGTGGTTCTGTGTGG - Intronic
947876307 2:233470290-233470312 TCCACATGAGTGTTTCTGTGTGG + Exonic
1169672664 20:8120617-8120639 TAAACTAGAATGTTTCTGTTTGG + Intergenic
1172387341 20:34543251-34543273 AACACTAGGGTTTTTGTATGTGG - Intergenic
1173656572 20:44703919-44703941 TCCTTTAGGGGGTTTCTGTGAGG + Intergenic
1174140661 20:48411219-48411241 AACACTAGGGTCTGTGTGTGTGG + Intergenic
1175845110 20:62054052-62054074 TGCACTGGGGTGGGTCTGTGTGG - Intronic
1181185694 22:21102133-21102155 TCCTCTAGTGTGTGTCTGTGGGG + Intergenic
1181910246 22:26232983-26233005 TACACAAGGGTGTGTGTGTCGGG - Intronic
1184916971 22:47575979-47576001 TCCACTTGGCTGTTTCTGGGTGG - Intergenic
1185273109 22:49937610-49937632 TACTCTAGGGTCTTGCTCTGGGG + Intergenic
949472096 3:4407012-4407034 TTTACTAGGTTGTATCTGTGAGG + Intronic
952183919 3:30947676-30947698 TACACTATGGTGCTTCTCTAAGG + Intergenic
952912861 3:38205303-38205325 TTCAGTTTGGTGTTTCTGTGGGG + Intronic
956390962 3:68772321-68772343 TACTTCTGGGTGTTTCTGTGAGG + Intronic
956525588 3:70156094-70156116 TAAACTTGGGTCTTTCTGTTTGG - Intergenic
957119688 3:76073904-76073926 TCCAATATGGTGTCTCTGTGGGG + Intronic
957531924 3:81451543-81451565 GGTACTAGGGTATTTCTGTGTGG + Intergenic
957718841 3:83968903-83968925 GAAACTAAGGGGTTTCTGTGTGG + Intergenic
958538946 3:95444364-95444386 ACTACTATGGTGTTTCTGTGGGG - Intergenic
964407034 3:156359995-156360017 TATACCATGGTGTTTGTGTGAGG + Intronic
964441442 3:156715615-156715637 TCCACTAGAGTGTTACTGTAAGG - Intergenic
964686640 3:159403267-159403289 TTCATTGTGGTGTTTCTGTGGGG - Intronic
965011811 3:163103127-163103149 TATTCCTGGGTGTTTCTGTGAGG - Intergenic
965219794 3:165914166-165914188 TATTCTTGGGTGTGTCTGTGAGG - Intergenic
967013164 3:185457989-185458011 TTCCTTAGGGAGTTTCTGTGAGG + Intronic
968237440 3:197042724-197042746 CATACTAGTGTGTTTCTATGTGG + Exonic
974168773 4:58239226-58239248 AAAACTAGGACGTTTCTGTGGGG - Intergenic
975902771 4:79172613-79172635 TACACAAGGGGGTCTCTATGTGG + Intergenic
976248987 4:83031693-83031715 TATATTAGTGTGTGTCTGTGAGG - Intergenic
976547589 4:86355383-86355405 TACACTGGGGTGTTGGGGTGAGG - Intronic
978099771 4:104823970-104823992 TTCACTAGGCTGTGTTTGTGTGG + Intergenic
978338528 4:107696545-107696567 TACACTAGGGCCTATCGGTGGGG + Intronic
980156251 4:129110579-129110601 CTCACTAGGATGTTTCTGTTAGG - Intronic
981171680 4:141632563-141632585 TACCCTTCGGTGTGTCTGTGAGG + Intergenic
985116714 4:186599161-186599183 TAAATGAGAGTGTTTCTGTGGGG + Intronic
989554233 5:42773443-42773465 TACACAAGGTTCTTTCTCTGAGG + Intronic
989585150 5:43068643-43068665 TCCAATATGGTGTTTGTGTGGGG + Intronic
991657160 5:68915651-68915673 TAGACTTGGGGGTTTCTCTGAGG - Intergenic
993542803 5:89173212-89173234 TAATCTTGGGTGTGTCTGTGTGG + Intergenic
996520426 5:124420211-124420233 TACACATGGATGTTTTTGTGGGG - Intergenic
999269443 5:150288183-150288205 GACACAATGGTGTTCCTGTGAGG - Intronic
1000648403 5:163785623-163785645 TCCAATAGGGTCTCTCTGTGGGG + Intergenic
1003413068 6:5882861-5882883 TATATTTGGGTGTGTCTGTGAGG + Intergenic
1005178205 6:23072164-23072186 TATGCCAGGGTGTGTCTGTGAGG - Intergenic
1006107702 6:31726564-31726586 TACAGAAGGCTGTTTCTATGAGG - Intronic
1010551991 6:77235038-77235060 TAATCTTGGGTGTGTCTGTGAGG + Intergenic
1011199806 6:84823372-84823394 TAATCTTGGGTGTGTCTGTGTGG + Intergenic
1015388360 6:132651981-132652003 TACAGTAGTGTGTGTATGTGAGG + Intergenic
1016381579 6:143488682-143488704 TACACTATAGTGTATATGTGTGG + Intronic
1019726004 7:2603057-2603079 TGGACAAGGGTGTGTCTGTGGGG - Intronic
1020398261 7:7742990-7743012 TGCACTAGGTTGTTTTTGTTTGG + Intronic
1021413548 7:20355373-20355395 TACTCTAGGGTCTTTCTCAGGGG + Intronic
1022810392 7:33862341-33862363 TACACTAGGGCTGGTCTGTGTGG - Intergenic
1024436374 7:49360740-49360762 TTCACTAAGGTATTTCTATGAGG - Intergenic
1027171640 7:75877105-75877127 AACACTAGGGTGGGTGTGTGGGG + Intronic
1028266729 7:88734531-88734553 TTCAATTTGGTGTTTCTGTGGGG + Intergenic
1029655574 7:101922330-101922352 GACATAAGAGTGTTTCTGTGGGG - Intronic
1033817397 7:145090896-145090918 TAAACTAAAGTGTTTCTGTATGG - Intergenic
1034871504 7:154688827-154688849 TAATCTTGGGTGTGTCTGTGTGG - Intronic
1034933184 7:155180245-155180267 TAATCTTGGGTGTGTCTGTGTGG - Intergenic
1036786008 8:11687555-11687577 TACACCAGAGAGTTGCTGTGAGG - Intronic
1043038157 8:75224926-75224948 TACACAATGATTTTTCTGTGTGG - Intergenic
1043628405 8:82293125-82293147 TAGATGATGGTGTTTCTGTGTGG + Intergenic
1043881031 8:85543089-85543111 TCCACTATGGTGGTGCTGTGTGG + Intergenic
1044435173 8:92153560-92153582 TATTCTTGGGTGTGTCTGTGAGG + Intergenic
1045767635 8:105693276-105693298 TACACAAGGTTATTTTTGTGAGG - Intronic
1047774853 8:128061407-128061429 GACACTGGGTTGTTTCTTTGGGG + Intergenic
1048560924 8:135536624-135536646 TAGACTAGGGTGGTTGTGGGAGG + Intronic
1050904498 9:10986887-10986909 TCCACTAGGCAGTGTCTGTGTGG + Intergenic
1051453733 9:17228608-17228630 TACACTACTTTGTTTCTATGAGG + Intronic
1052151899 9:25127407-25127429 TACACTGGGGTCTTTCAGAGTGG + Intergenic
1055184395 9:73433259-73433281 TAGACTACAGTGTTTCTGTATGG + Intergenic
1055515419 9:77028498-77028520 TATTTTAGGGTGTGTCTGTGAGG - Intergenic
1057043022 9:91860828-91860850 TACCTTTGGGTGTGTCTGTGAGG - Intronic
1060804758 9:126567955-126567977 TACTTCTGGGTGTTTCTGTGAGG - Intergenic
1061360554 9:130139303-130139325 TTCCCTAGGGTGTTTCTGGCAGG + Exonic
1186032471 X:5384717-5384739 TGTTCTTGGGTGTTTCTGTGAGG - Intergenic
1187950561 X:24466003-24466025 TGCTCTAAGGTGTTGCTGTGTGG + Intronic
1189571434 X:42302014-42302036 TCCACATGGGTGTGTCTGTGTGG - Intergenic
1190538302 X:51450791-51450813 TAGACCTGGGTGTTTTTGTGTGG + Intergenic
1190602785 X:52109346-52109368 TTCAATATGGTGTTCCTGTGTGG + Intergenic
1191224776 X:58031512-58031534 TCCACTAAAGTGTTTGTGTGGGG + Intergenic
1192020318 X:67384316-67384338 TTAACTTTGGTGTTTCTGTGGGG - Intergenic
1192297402 X:69865616-69865638 TAATCTTGGGTGTGTCTGTGTGG - Intronic
1192624648 X:72714650-72714672 TACCCTAGGGAGTTCCTGTTTGG - Intergenic
1192793272 X:74405514-74405536 TTCAATTTGGTGTTTCTGTGGGG - Intergenic
1193504102 X:82318698-82318720 TACAGTAAGGTATTTCTTTGAGG - Intergenic
1194475057 X:94348271-94348293 TGCATTAGGCTGTTTTTGTGTGG + Intergenic
1195331039 X:103800826-103800848 TACCCTAGGCTTTTACTGTGGGG - Intergenic
1196510239 X:116500490-116500512 TAAAATTTGGTGTTTCTGTGGGG + Intergenic
1196558271 X:117117241-117117263 TATTCTTGGGTGTGTCTGTGAGG - Intergenic
1197752230 X:129973117-129973139 TACACTGGGGTGTCTGTGGGTGG + Intergenic
1200335355 X:155345398-155345420 TAAACTAAAGAGTTTCTGTGAGG - Intergenic
1200351113 X:155495823-155495845 TAAACTAAAGAGTTTCTGTGAGG + Intronic
1201887618 Y:18902799-18902821 AACACAAGGGTGTTGCTGTAGGG + Intergenic