ID: 1150099095

View in Genome Browser
Species Human (GRCh38)
Location 17:62406230-62406252
Sequence TGGGAAGCCTTGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150099089_1150099095 14 Left 1150099089 17:62406193-62406215 CCTCATCTCTCTCTAAAAAAAAC 0: 1
1: 0
2: 36
3: 466
4: 3870
Right 1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG 0: 1
1: 0
2: 4
3: 47
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150099095 Original CRISPR TGGGAAGCCTTGGGGAAAAA AGG Intronic
900526936 1:3134002-3134024 TGCAAAGCACTGGGGAAAAAAGG + Intronic
901321143 1:8340651-8340673 TGGGAAGCCATGAGGAACAAGGG - Intronic
902594750 1:17501660-17501682 TGGGTAGCCTGGGTGACAAAGGG + Intergenic
902988083 1:20167755-20167777 AGAGGAGCCTTGGGGAAGAATGG - Intronic
903804982 1:25998828-25998850 TGGCCAGGCTTGGGGGAAAAGGG + Intergenic
903829270 1:26164869-26164891 AGGGAAGCCCTGGGGAAAAGAGG + Intergenic
904059077 1:27693627-27693649 AGGGAAGACTTGGGGACATATGG - Intergenic
904858214 1:33515854-33515876 TGGGAAGCACTGGGAAAGAAGGG - Exonic
904944901 1:34192155-34192177 TGGCAAAACTTGGGGGAAAAAGG + Intronic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907582279 1:55583110-55583132 TGAAAAGCCTAAGGGAAAAAGGG + Intergenic
909145517 1:71925356-71925378 TGGAAAGATTCGGGGAAAAAGGG - Intronic
910474252 1:87589899-87589921 GGAGAAGCCTTGGGGAATCAGGG + Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
912601741 1:110942221-110942243 TGGGAAGGCTGTGGGAAAATAGG - Intergenic
912812953 1:112807559-112807581 TGGCTAGCCTTGGGGAGAAAAGG + Intergenic
918034022 1:180848309-180848331 TGGGAAGCATAGGGGAGAGAAGG - Intronic
918269521 1:182883901-182883923 TGGTAAGCACTGGGCAAAAATGG + Intronic
918754352 1:188318477-188318499 CAGGAAGCCATAGGGAAAAAGGG + Intergenic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
919854151 1:201694283-201694305 TGGGAAACCTTGAGGGCAAAGGG + Intronic
920652384 1:207848393-207848415 TGGGCAGCCTTGGGTACATAAGG + Intergenic
920887805 1:209949263-209949285 TAGGAAGGATTGGGGATAAAAGG + Intronic
921064312 1:211611894-211611916 TGGGAGGGCTTTGCGAAAAAGGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
922700783 1:227759098-227759120 TGTGAACCCTTTGGGAAAGAAGG + Exonic
922897646 1:229112889-229112911 TGCTAGGCCTTGGGGATAAATGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063011656 10:2027436-2027458 TGGGAGGGCTTGGGGAAACAAGG + Intergenic
1063330365 10:5152632-5152654 TGGCTAGCCTTGGAGAAGAATGG + Intergenic
1065151694 10:22829431-22829453 TGGTAAGGCTTGGGGACACATGG - Intergenic
1067222484 10:44353927-44353949 TGGGCAGCCATGGGGACACAGGG - Intergenic
1067485094 10:46641218-46641240 TGGGTAGCCATTTGGAAAAAAGG - Intergenic
1067609662 10:47700439-47700461 TGGGTAGCCATTTGGAAAAAAGG + Intergenic
1067947201 10:50697065-50697087 TGGGAAGGCTTGGAAAAACAGGG - Intergenic
1069504374 10:68984488-68984510 TGGGAAGCCATGAGGAACAAGGG - Exonic
1069774105 10:70916902-70916924 TGGGAAGACTGGGGGAGAACTGG - Intergenic
1070129534 10:73647175-73647197 CGGGCCGCCTGGGGGAAAAAGGG + Exonic
1070324984 10:75383013-75383035 TAGGAAGCCTAGGGGAAGAAAGG - Intergenic
1070882513 10:79862053-79862075 TGGGAAGGCTTGGAAAAACAGGG - Intergenic
1071301731 10:84261300-84261322 CGGGAAGCCTTGGGGATGCAAGG - Intergenic
1071625254 10:87162051-87162073 TGGGTAGCCATTTGGAAAAAAGG + Intronic
1071649085 10:87378364-87378386 TGGGAAGGCTTGGAAAAACAGGG - Intergenic
1072236328 10:93457174-93457196 TGGGTAGCCTTGGTGAGAGAAGG - Intronic
1073420068 10:103417602-103417624 AGGGCAGCCTTTGGGATAAATGG - Intronic
1074071802 10:110078627-110078649 TGTGTAGCCTTGGGTAAAAGTGG + Intronic
1074526808 10:114269787-114269809 GGGGAGGCTTTGGGGAAAGAAGG + Intronic
1074580937 10:114718730-114718752 TGGAAGGTCTTGGGCAAAAATGG - Intergenic
1074669853 10:115777776-115777798 ATGCAACCCTTGGGGAAAAAAGG + Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1076041637 10:127254805-127254827 TGGGAAGCCATTGGGGAAATGGG + Intronic
1076045085 10:127286023-127286045 TGGGAAGCCAGCTGGAAAAAGGG - Intronic
1076333638 10:129690724-129690746 TGGGAAGGCCTGGGGGAAAAGGG + Intronic
1077342676 11:2033015-2033037 TGTGAGGCCTCGGGGAAATAGGG + Intergenic
1078700748 11:13679941-13679963 GGGGAAGTATTGGGGAAAATAGG + Intronic
1078833982 11:15008041-15008063 TGGAAAGCCTGGGGGAGACATGG + Intronic
1078884561 11:15487459-15487481 GGGGAAGCATTTGGGAACAATGG - Intergenic
1078941505 11:16011665-16011687 TGGGAAGCCTGGTGGAAGCAGGG + Intronic
1080219382 11:29882532-29882554 TGGGAAGGCCTGGGGACATATGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083989056 11:66235563-66235585 TGGGAGGCCTTGGGCAAGGAAGG - Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086631011 11:89019730-89019752 TGGGAAGTATTGGAGATAAAAGG - Intronic
1087053188 11:93906422-93906444 TGGGAAGACTTGGGGAAGACAGG + Intergenic
1087493017 11:98851896-98851918 TGGCTAGCCTTGGGAAACAATGG - Intergenic
1088080989 11:105913735-105913757 AGTAAAGCTTTGGGGAAAAAAGG - Intronic
1088113915 11:106295192-106295214 TTTGAAGGCTGGGGGAAAAAAGG + Intergenic
1088461398 11:110087113-110087135 TGGGAATCCTTGAGCAATAATGG + Intergenic
1088933864 11:114379167-114379189 TTGGAAGCCAAGGAGAAAAAAGG + Intergenic
1089056674 11:115591252-115591274 TGGGTAGCCTTGAAGAAGAAAGG - Intergenic
1089123564 11:116160256-116160278 TGGGAAGTCTTAGGGCAATAGGG - Intergenic
1090778251 11:129984070-129984092 GGGGAAGCCTAGGGGGAAAGAGG - Intronic
1202825662 11_KI270721v1_random:88204-88226 TGTGAGGCCTCGGGGAAATAGGG + Intergenic
1092416600 12:8294753-8294775 TGGGGAGCATTTGGGAAAGAAGG - Intergenic
1092947484 12:13470377-13470399 TGGGAAGACCTGGGGAGAAATGG + Intergenic
1092995349 12:13944521-13944543 TGAGATGCCTTTGAGAAAAATGG + Intronic
1093712129 12:22339576-22339598 AGGGAAGTATTGGGTAAAAAAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094384957 12:29884369-29884391 TGGGAAGCATCAGGGAAGAACGG + Intergenic
1095085774 12:38056382-38056404 TGAGAACACTTGGGGAGAAAGGG - Intergenic
1095308154 12:40662483-40662505 CCAGAGGCCTTGGGGAAAAATGG + Intergenic
1095467559 12:42503931-42503953 AGGGAATTCTTGGGGAAAAGTGG + Intronic
1095913391 12:47451537-47451559 TGGAAAGCCATGGGGAAATAGGG - Intergenic
1096675309 12:53222801-53222823 GGGGAAACTTTGGGGAAAAGAGG - Intronic
1097059877 12:56274883-56274905 GGGTAAGGTTTGGGGAAAAAGGG + Intronic
1097601374 12:61696657-61696679 TGGTAAGGCTTGGGGACATATGG + Intergenic
1097790577 12:63811394-63811416 TAGGAAGACTTGGGGGTAAAAGG - Intergenic
1097807139 12:63978361-63978383 TTGGGAGGGTTGGGGAAAAATGG - Intronic
1097955078 12:65476227-65476249 TGGCAAGGCTTGTGGCAAAATGG - Intronic
1098938369 12:76506221-76506243 TGGGAAGACTTGGGGAAGAAAGG + Intronic
1100229296 12:92591096-92591118 TGGGAAGTCTTGAGGGAAAATGG + Intergenic
1100341319 12:93682414-93682436 TGGGAGGCCTTGAGAACAAATGG + Intronic
1100361939 12:93887216-93887238 TTGGAAACCTTGGGGTAAAAGGG + Intronic
1100950793 12:99847311-99847333 TGGCCTGCCTTGGGGAAGAAAGG - Intronic
1101104423 12:101425873-101425895 TGGCTGGCTTTGGGGAAAAAGGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101497761 12:105271925-105271947 TGGGAAGTCTAAGAGAAAAAGGG + Intronic
1101522001 12:105492666-105492688 AGCCAAGCCTTGGGGATAAAAGG - Intergenic
1101674653 12:106907061-106907083 TGAGATGCTATGGGGAAAAAGGG + Intergenic
1101930146 12:109007053-109007075 TTGGAAGAGTTGGGGAGAAAGGG - Intronic
1102042731 12:109810891-109810913 TGGGAAGGCTTGGGGACAGAAGG + Intronic
1102358725 12:112264352-112264374 TGGAAAGCCATGTGGAAATAAGG - Intronic
1102407926 12:112690343-112690365 TGGAAAACCTTGGGACAAAAGGG - Intronic
1102408159 12:112692165-112692187 TGGGAAGCGTAGGGGAAAGATGG + Intronic
1103289448 12:119832682-119832704 TGGGAAGTGTTGGGATAAAATGG - Intronic
1103826893 12:123746201-123746223 TGGGAGGCATAGGGGAAAATTGG + Intronic
1104047609 12:125174186-125174208 TGGGAAGCCTTGGGGTGAAGGGG - Intergenic
1105175876 13:17666223-17666245 TTTGATGCCTTGGTGAAAAAGGG + Intergenic
1105650243 13:22369533-22369555 TGGCTAGCCTTGGGGAAGAATGG + Intergenic
1105812185 13:24005525-24005547 ATGGAATCCTTGGTGAAAAAGGG + Intronic
1105967278 13:25396367-25396389 TGGCTGGCCTTGGGGAAAAGGGG + Intronic
1106055239 13:26231148-26231170 TTGGAAGCTTGGGGGAAAAGCGG - Intergenic
1106101581 13:26698070-26698092 TGGGTAGCCTTGGGGGAAAATGG - Intergenic
1106592134 13:31106931-31106953 TTGGAACCTTTGGGGAGAAAAGG + Intergenic
1107115207 13:36739601-36739623 TGGGCAGCTTTGGGGAGTAATGG + Intergenic
1108203883 13:48068652-48068674 TGGTAAGCCCTGGGGACATACGG + Intronic
1109012715 13:56971498-56971520 TGGTAAGGCCTGGGGAAATATGG + Intergenic
1109306661 13:60648935-60648957 TGACAAACCTTGGGGAAGAATGG - Intergenic
1109608631 13:64733581-64733603 TGGGAAGCATTGGGTAGAGAAGG - Intergenic
1109854086 13:68106486-68106508 GGAGATGGCTTGGGGAAAAAAGG + Intergenic
1110357250 13:74581349-74581371 TGGAAAGCTTTGGGGACAATTGG + Intergenic
1111022991 13:82479217-82479239 TGGCAAGTCTTGGGGGATAATGG - Intergenic
1112228709 13:97566612-97566634 TGGGCAGACTTGGGGAAGTATGG - Intergenic
1112246642 13:97741228-97741250 TGGCTAGCTTTGGGGAAAAGAGG - Intergenic
1114723333 14:24907008-24907030 TGGGAAGTGTAGGGGGAAAAGGG + Intronic
1116563515 14:46415258-46415280 TGTGAGGGCTTGGGGAAAAGAGG - Intergenic
1118195188 14:63618875-63618897 TAGCAACCCTCGGGGAAAAAAGG + Intronic
1118478134 14:66137883-66137905 TGTGAAACTTTGGGGAAAAGGGG - Intergenic
1118702723 14:68450030-68450052 TGGGTACCCTAGGGGAACAAAGG + Intronic
1118908898 14:70045099-70045121 TGGAAAGGCTTGGGCAAAGAGGG + Exonic
1119569408 14:75657085-75657107 AGAGAAGCTTGGGGGAAAAAGGG + Intronic
1119668894 14:76504001-76504023 GGGGAGGCCCTGGGGAACAAGGG + Intergenic
1120020539 14:79525137-79525159 TGGCTAGCATTGGGGAAGAATGG + Intronic
1120948370 14:90019338-90019360 TGGGGAGCATTGGAGAAGAATGG + Exonic
1121024852 14:90608202-90608224 TGGGAAGGCTTGCCTAAAAATGG - Intronic
1122455214 14:101845005-101845027 TAGAAAGCCTTGGGGAGAACAGG - Intronic
1122540714 14:102496331-102496353 TGGGAAGCCCTGGGGCAAACTGG + Intronic
1122593436 14:102871742-102871764 TAGGAAGCCATGGGAGAAAAGGG - Intronic
1202873368 14_GL000225v1_random:185894-185916 TGAGAGGGCTTAGGGAAAAAAGG + Intergenic
1125103508 15:35943407-35943429 TGGGTAGGCTTGGGTAAGAATGG + Intergenic
1125532857 15:40424962-40424984 TGGGAAGGCCTGGAGAAAACAGG - Intronic
1127374936 15:58375509-58375531 TGGGTAGCCTTTGGGGGAAATGG + Intronic
1129205656 15:74035718-74035740 TGGGAAGCCATGGAGGAGAAGGG - Intronic
1129233979 15:74212840-74212862 TGGCTAGCTTTGGGGAAAAGGGG - Intergenic
1129392328 15:75226580-75226602 TGGGCAGCCTTGGGGGACTAGGG + Intergenic
1129739395 15:77982708-77982730 TGGGAAGACTGAGGGGAAAAGGG - Intergenic
1129846513 15:78770379-78770401 TGGGAAGACTGAGGGGAAAAGGG + Intronic
1130702016 15:86193627-86193649 TGGAAAGCCTTGAGGAGAAGTGG + Intronic
1130806235 15:87326505-87326527 AGGGAATTCTGGGGGAAAAAAGG + Intergenic
1132552450 16:559185-559207 AGGGGTGCCTTGGGGAAGAAGGG - Intergenic
1132606790 16:796995-797017 TGGGGGGCATTGGGGAGAAAGGG + Exonic
1132655912 16:1041581-1041603 GGGGGACCCTTGGGGAAAAGTGG - Intergenic
1133499227 16:6349781-6349803 TGGAAAACCATGGGGAAAAATGG - Intronic
1135245028 16:20848232-20848254 TGGGAAACGTTGGGGAAAAAAGG + Intronic
1137320630 16:47377961-47377983 TGGAAAGTCTTGGGGAAAGAAGG + Intronic
1137381428 16:48003081-48003103 TGGGTAGCCTTGGGAGAAAATGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138270198 16:55690625-55690647 TGGGTAGCCTTGCTGAAAGAAGG - Intronic
1138349518 16:56339010-56339032 TGGCCAGCCTTGGGGAAGGAAGG - Intronic
1138507923 16:57487245-57487267 TGAGAAGCCCTGGTGTAAAAAGG - Intronic
1138813534 16:60178297-60178319 TGGGTAGCTTTGGGGGAAAATGG - Intergenic
1138925375 16:61583798-61583820 TTAACAGCCTTGGGGAAAAAGGG - Intergenic
1138948016 16:61875786-61875808 TGGAAAGCCTTGGATGAAAACGG - Intronic
1138998504 16:62480101-62480123 TGGTAAGTCTTGGGGATATATGG - Intergenic
1139531369 16:67544284-67544306 TTGGAGGCCTGAGGGAAAAATGG - Exonic
1141990779 16:87608270-87608292 TGTGGAGGCTTGGGGAAAACAGG - Intronic
1143250183 17:5517745-5517767 TGGGAGGCCTTGGTGAAACCAGG - Exonic
1143756268 17:9069955-9069977 TGGGTAGCCTTCGGGAGAAAAGG + Intronic
1144299730 17:13912226-13912248 TGGTTAGCCTTGGGGGAGAATGG - Intergenic
1144333606 17:14248653-14248675 AGAAAAGCCTTTGGGAAAAAGGG - Intergenic
1145688005 17:26696265-26696287 TTTGAAGCCTTCGGTAAAAAAGG + Intergenic
1146926447 17:36749213-36749235 TGGGAGGGAGTGGGGAAAAATGG - Intergenic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1150139854 17:62718438-62718460 TGGAAAGGCTTGGGGCCAAAAGG + Intronic
1150842797 17:68624880-68624902 TGGGCAGCCATGGGGAAGACAGG - Intergenic
1151094727 17:71483601-71483623 TGGAAAGCTTTTGGGAAAAGAGG - Intergenic
1151214379 17:72567797-72567819 TGGGAAGCCTTGGGGAGGGGAGG + Intergenic
1151598423 17:75091690-75091712 TGGGAAGCTCTGGGGAAACTCGG - Intronic
1151608530 17:75155371-75155393 AGGAAAGCCTTGGGCAAAAGAGG + Intronic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1153157716 18:2167970-2167992 TGGCTAGCCTTAGGGAAGAATGG - Intergenic
1153517129 18:5914252-5914274 TGGGAAGCCCTGTGGAAAGCAGG + Intergenic
1153673385 18:7434240-7434262 TGTGTAGTCTGGGGGAAAAATGG - Intergenic
1154200866 18:12299750-12299772 TTGGAAGATTTGGGGAAAAAAGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156801580 18:41121378-41121400 GGGGAAGCCTTGGGAACACAGGG + Intergenic
1157013834 18:43684595-43684617 TGGGAAGGATTGGGGAAGAAAGG + Intergenic
1158162144 18:54497170-54497192 TGGGAAGCCTAGGTTAAGAATGG + Intergenic
1159322073 18:66865662-66865684 TGGGAAGTCTTCAGAAAAAAAGG - Intergenic
1163192932 19:15692573-15692595 TGGAAAGCCTTCTGGAAAAAAGG + Intronic
1163200377 19:15762649-15762671 TGGAAAGCCTTCTGGAAAAAAGG - Intergenic
1163280296 19:16312256-16312278 TGGGAAGGCTGAGGGAAAAGTGG - Intergenic
1165683055 19:37793720-37793742 TGGAAAGCCTACAGGAAAAAAGG + Intronic
1165952775 19:39483390-39483412 TGGGAGGGCTTGGGGACACAGGG + Intronic
1166121410 19:40689730-40689752 TGGGCAGCCCTGGGGACAAAGGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166710736 19:44935672-44935694 AGGGAAGGCTGGGGTAAAAAAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925159174 2:1671467-1671489 TGGAAAGGCTCGGAGAAAAATGG + Intronic
925405122 2:3601125-3601147 TGGGAAGGGTGGTGGAAAAAGGG - Intronic
925602560 2:5624015-5624037 TATGGAGCCTTGGGGAAACAAGG + Intergenic
927693059 2:25221950-25221972 TAGGAAGCCTAGGGAAAAAGGGG + Intergenic
929418694 2:41769217-41769239 TAGGAAGCAATGAGGAAAAATGG - Intergenic
929575543 2:43049649-43049671 TGGGAAGGCTTTGGAGAAAAGGG - Intergenic
930242851 2:48954263-48954285 TGGTCTGCCTTGGGGAAGAAAGG - Intergenic
930341195 2:50117060-50117082 TGAAAAGCCTTGGGGATAAAGGG + Intronic
930461025 2:51676223-51676245 TTGGAAGCTTGGGGAAAAAAAGG - Intergenic
933115651 2:78467337-78467359 TAGGATGCCTTAAGGAAAAATGG + Intergenic
933312617 2:80679520-80679542 TGGGACGCCTTTGTGAACAATGG + Intergenic
935277320 2:101486169-101486191 CGGGAAGCCTTCAGGACAAAGGG - Intergenic
935377118 2:102411008-102411030 TGGGAAGGCTTGTGGACATATGG + Intergenic
936611502 2:114006263-114006285 TGGGAACTCAGGGGGAAAAAGGG + Intergenic
937129778 2:119500719-119500741 TGGGAAGGGTAGGGGAGAAAAGG + Intronic
938612439 2:132962000-132962022 TGAGAACCCTTGGGGAGACAAGG + Intronic
938852662 2:135277148-135277170 TGGGAAGTATAGGGGAAAGAAGG - Intronic
940789154 2:158013475-158013497 TGGAAAGGCTTGGGGAAGAGGGG + Intronic
940862579 2:158786040-158786062 TGGTAACACTTGGGGGAAAAAGG + Intergenic
941037959 2:160588356-160588378 TGGGAAGGATTGGGGGGAAAAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941943483 2:171069143-171069165 TGGTAAGTCTTGGACAAAAATGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
944899353 2:204198509-204198531 TGGCATCCCTTGGGGAAAAGGGG - Intergenic
945426479 2:209710649-209710671 AGGAAATCCTTGGGGAAGAAAGG - Intronic
945538918 2:211058017-211058039 TGGGAAGTCTTCAGGAAAGAGGG + Intergenic
947363818 2:229373453-229373475 TGGCAAGGCTGAGGGAAAAAGGG + Intronic
947907056 2:233772500-233772522 CGGAAATGCTTGGGGAAAAAAGG + Exonic
948135602 2:235633798-235633820 TGGCTAGCTTTGGGGAAAAGGGG + Intronic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
948699695 2:239751877-239751899 TGTGCAGGCTTGGGGAAGAAGGG + Intergenic
1168823849 20:795433-795455 TGTGAACCCTTGGGGCAAGACGG - Intergenic
1169655526 20:7918549-7918571 GGGGATTCCTTGGGGAGAAAAGG - Intronic
1169655851 20:7922324-7922346 AGGGAACCCTTGTGGAGAAAAGG + Intronic
1170032097 20:11954679-11954701 GGGGGAGCCTTAGGGAAAAAGGG + Intergenic
1170409178 20:16069902-16069924 TGGGGACCCTTGGGGAAACTGGG + Intergenic
1172526422 20:35602600-35602622 TGGAAAGCCTTGGGGGAAGGTGG + Intergenic
1174830634 20:53809005-53809027 CGGCAAGCCTTGGGGATCAAAGG - Intergenic
1174882930 20:54300595-54300617 TGGGCAGAGTTGGGGAGAAATGG + Intergenic
1174978650 20:55364669-55364691 TGAGAAGGCTTAGGGTAAAAGGG + Intergenic
1175192446 20:57220587-57220609 TGGGATGCATTTGGGAAGAATGG - Intronic
1175316778 20:58054189-58054211 TGGGAACCCTTGGGGATGCAGGG + Intergenic
1176701159 21:10052144-10052166 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1177180740 21:17742188-17742210 TGGCTAGCCTTGGGAAAGAATGG + Intergenic
1177182094 21:17755610-17755632 TGGGTAGCCATTTGGAAAAATGG - Intergenic
1177576403 21:22962210-22962232 TGTCAAGACTTGGGGATAAAGGG - Intergenic
1178710432 21:34911875-34911897 TGAGCAGCCATGGGGAAAACTGG - Intronic
1178929126 21:36802215-36802237 TTGGAGGCCTTGTGGGAAAATGG - Intronic
1179174641 21:38999662-38999684 TGGGAAGACTTGGTGCAAAAAGG - Intergenic
1180231000 21:46426714-46426736 GGGGAGGACTTGGGGAAAAGTGG - Intronic
1181235915 22:21447537-21447559 AGGGAAGCCTTTGGGCAAGAAGG - Exonic
1182024448 22:27107036-27107058 AGGGAAGCCTTGGGAAAAGAGGG - Intergenic
1182702152 22:32249165-32249187 TGGGAAGACTTGGGGAGCACTGG - Intronic
1183453093 22:37906968-37906990 TGGGAAGCCTCGGGGGAGAGGGG - Intronic
1184907476 22:47498607-47498629 TGGGAAGAGATGGGGAACAATGG + Intergenic
950394812 3:12725999-12726021 AGGGGAGCAGTGGGGAAAAATGG + Intergenic
950450715 3:13063592-13063614 TGGGAGGCATTGGGGGACAATGG + Intronic
951668285 3:25151122-25151144 TGGAAAGCCAAGGGGCAAAATGG - Intergenic
952728908 3:36618787-36618809 TGGGAAGGAGTGGTGAAAAAGGG + Intergenic
953067599 3:39488660-39488682 GGGGAAGGCTGGGGGGAAAAAGG - Intronic
953988306 3:47462916-47462938 TGAGAAGCCCTGGGGAGAAAGGG - Intronic
955378733 3:58419689-58419711 TGGCTAGCCTTGGGGAACAATGG + Intronic
956432778 3:69204253-69204275 GGGAAAGCCTTGGACAAAAAGGG + Intronic
957723706 3:84037142-84037164 TGGTGAGATTTGGGGAAAAAAGG + Intergenic
958853362 3:99355270-99355292 TGTGAAGCCTTGGATAAAGATGG - Intergenic
959656571 3:108812685-108812707 GGGGAAGGCTTGGGGAAATGAGG - Intergenic
961513008 3:127414620-127414642 TGGGAAGCCCTGGGGAGACAGGG - Intergenic
961557676 3:127707771-127707793 TGTGAAGCCTTCAGGAAAAAAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962080520 3:132134593-132134615 TGGGAAGAATTGAGGTAAAAGGG + Intronic
962738121 3:138343942-138343964 TGGGCAGCCCAGGGGAAGAAAGG + Intergenic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963282355 3:143397226-143397248 AGTGAAGCCTTAGGGAAGAAAGG - Intronic
964540769 3:157777185-157777207 TAGAAAGCCTTGAGGAAACATGG + Intergenic
965107833 3:164380586-164380608 TGGCTAGCCTGGGGGAAGAATGG + Intergenic
965950154 3:174299016-174299038 AGGGAAGTCTTTGGGAAGAAGGG - Intergenic
966793737 3:183695589-183695611 TGGGAAGTCAAGGGGAAGAAGGG - Intergenic
967830306 3:193912898-193912920 TGGGAAGCCTCTGTGACAAAGGG - Intergenic
969529992 4:7725313-7725335 TGGGGAGCCTGCGGGAAGAAGGG - Intronic
969700224 4:8763973-8763995 AAGGAGGCCTGGGGGAAAAATGG + Intergenic
969902778 4:10364970-10364992 TGTGATGCCTTTGGGAAAAGTGG + Intergenic
970697717 4:18697280-18697302 TGGGTAGCCTTTGGGGAGAATGG + Intergenic
971085240 4:23267302-23267324 TGGGAAGCTATGGGGAAAGTGGG - Intergenic
971148394 4:24004975-24004997 TGGAAAGCCCTTGGGAAAAAAGG - Intergenic
972217838 4:36916879-36916901 TGGCTAGCCTTGGGGGAGAATGG - Intergenic
972878802 4:43398009-43398031 TGTCAGGCCTTGGGGTAAAATGG - Intergenic
972928239 4:44039217-44039239 TGGGAAGCCCTGGAGGAAGATGG + Intergenic
973680496 4:53313295-53313317 GGGGAAGAATGGGGGAAAAAAGG + Intronic
974262339 4:59542009-59542031 TGGGCAGGCTGGGGGAAAGAAGG + Intergenic
974415369 4:61599706-61599728 TGGCTAGCCTTGGGGAAAAGGGG + Intronic
974920514 4:68233514-68233536 TGAGAAGCTTTTGGGAAAGAGGG + Intronic
975463085 4:74677447-74677469 GGGGAAGCATAGGGGAGAAATGG - Intergenic
976401496 4:84611973-84611995 TGGGCAGGCTTGAGGAAGAAGGG + Intronic
977643185 4:99380456-99380478 TGGTAAGGGTTGGGGAAAATGGG + Intergenic
977646102 4:99414582-99414604 TGGCAAGCTTTGGGTAAACATGG - Intronic
977958491 4:103057719-103057741 TGGAAAGCTTTGGGAAATAAAGG - Intronic
978267408 4:106842874-106842896 TGTGAACTCTTGAGGAAAAAAGG + Intergenic
978505808 4:109454722-109454744 TGGCTTGCTTTGGGGAAAAAAGG - Intronic
981057944 4:140385089-140385111 TGGGAAACAGTGGGGAAAATGGG - Exonic
982094682 4:151911239-151911261 TGGCTAGCTTTGGGGAAAAGGGG - Intergenic
983103970 4:163662443-163662465 TTGGAAGTTTGGGGGAAAAAAGG - Intronic
983321336 4:166199699-166199721 TGGTAAGGCTTGGGGACATATGG + Intergenic
983493713 4:168418844-168418866 TGGGAAGCCTAGGCAAGAAATGG + Intronic
983644930 4:169979895-169979917 TGGGAAGCATTGTGGAGATAGGG + Intergenic
983922581 4:173362164-173362186 TGGGAAGCCTAGGCCAAAAGTGG + Intergenic
985347981 4:189027212-189027234 TGGGAAGCCTCCAGAAAAAAAGG - Intergenic
987560992 5:19519773-19519795 TGGGCAGCCTTGAGGAGTAAAGG + Intronic
987741323 5:21912812-21912834 TGGCTGGCTTTGGGGAAAAAGGG + Intronic
988157611 5:27475625-27475647 TGGGAACCCCTTGGGAAAACTGG + Intergenic
991021918 5:61988175-61988197 TGACAAGCCTTGGGAAAAGAAGG + Intergenic
991224395 5:64252780-64252802 TTGGAAGCCTTGTGGAACACAGG + Intronic
992232644 5:74678607-74678629 ATAAAAGCCTTGGGGAAAAAAGG + Intronic
992583284 5:78204535-78204557 TGGAATGCTTTGGGGAATAAGGG - Intronic
992833371 5:80616962-80616984 TGGCTAGCTTTGGGGAAAATAGG + Intergenic
993072517 5:83183184-83183206 TTGGAAGACTGGGGAAAAAAAGG - Intronic
993306688 5:86283370-86283392 AGGGGACCCTGGGGGAAAAATGG + Intergenic
993355162 5:86897098-86897120 ACAGAAGCCTTGGGGAGAAAAGG - Intergenic
993699745 5:91104580-91104602 TGGGAAGGGTAGGGGGAAAAAGG - Intronic
994149510 5:96432257-96432279 TGGGAAGCTGGGGGGAGAAATGG - Intronic
994983763 5:106909005-106909027 TGGGAAGAGATGGGGACAAAAGG - Intergenic
995753296 5:115475742-115475764 TGGGCATCCTTGGGGATAGATGG - Intergenic
995875704 5:116786956-116786978 TGGCCAGCCTTGGGGGAGAATGG + Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
998016127 5:138733815-138733837 TGGGAAGCCATGGGGGACAGAGG + Intronic
998169447 5:139863984-139864006 TAGGTAGCCTTGGAGAAAAGGGG - Intronic
999226914 5:150033290-150033312 TGGTCTGCCTTGGGGAAAGAGGG + Intronic
999903332 5:156111404-156111426 TGGGAAGCCTTTGGGAAGTTTGG + Intronic
1000240974 5:159407849-159407871 TGGCTAGCCTTGGGGTAGAAAGG - Intergenic
1000742913 5:164992789-164992811 TGGGAAGTGCTGGGGAGAAAGGG - Intergenic
1000963389 5:167626971-167626993 TGGAAAGCCTCTGGGTAAAAGGG - Intronic
1000965963 5:167657109-167657131 TGGGAAACATAGGGGAAGAAGGG - Intronic
1001712731 5:173791181-173791203 TGAGGAGTCTTGGGGAACAAAGG - Intergenic
1002929726 6:1624791-1624813 AGGGACGCCTTGGGGAGAAGAGG - Intronic
1002989939 6:2229066-2229088 AGTGAAGCCCTGGGGAAAAGTGG - Intronic
1003270504 6:4603555-4603577 TGGGAAGTCCTGGGCAAACAGGG - Intergenic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1004676957 6:17852319-17852341 TGGGGAGGATTGGGGGAAAAAGG + Intronic
1006413691 6:33891090-33891112 TTGGAAGCCTTGGTGATTAAAGG - Intergenic
1007079652 6:39090415-39090437 TTGGATGCATCGGGGAAAAATGG - Intergenic
1007174648 6:39887618-39887640 TTGGATGCCTGGGGGACAAAGGG + Intronic
1007298111 6:40844054-40844076 GGAGCAGGCTTGGGGAAAAACGG + Intergenic
1008226492 6:48924658-48924680 TGGGATCCCTTGGCGAAGAAAGG - Intergenic
1008803530 6:55399708-55399730 AGGGAAGCCAAGGGGAAAGATGG - Intronic
1010701474 6:79053521-79053543 AAGGAAGCCTCGGGGAAAATTGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011918786 6:92545303-92545325 TCAAAAGCCTAGGGGAAAAAGGG + Intergenic
1012147216 6:95700186-95700208 TGGGAAACCTTGAGGAGTAAGGG - Intergenic
1013135675 6:107280536-107280558 TGAGAAGCTTTGGAGGAAAATGG - Intronic
1013605690 6:111745418-111745440 TGGGAAGGACTGGTGAAAAAGGG + Intronic
1014099295 6:117492435-117492457 TGGGTATCCTTGGAGACAAAGGG - Intronic
1014832778 6:126122371-126122393 TGCCTAGCCTTGAGGAAAAATGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015668817 6:135664134-135664156 TGGGAAGTGTAGGGGAAAAGGGG + Intergenic
1015822764 6:137281216-137281238 TGGGGAGCTTGGGGGCAAAATGG + Intergenic
1015990337 6:138935085-138935107 TGTGAAGTGTTGGGGAAAAGTGG - Intronic
1016121214 6:140343477-140343499 AGGGAAGACTAGGGGAAAGATGG - Intergenic
1017400265 6:154053230-154053252 TTGGAAGCTTTCAGGAAAAATGG + Intronic
1017774564 6:157670672-157670694 GGGGAAGGCTTGGGAAAGAAAGG - Intronic
1021327810 7:19296325-19296347 TGAGAAGCATTGGAGAAAGAGGG + Intergenic
1021357208 7:19665566-19665588 TGGGAACACATGGGGTAAAAAGG + Intergenic
1021642201 7:22749142-22749164 TGGCCAGCCTTGAGGGAAAATGG - Intergenic
1022379662 7:29847876-29847898 TGGTTAGCCTTGGGGGAGAATGG + Intronic
1022403589 7:30065052-30065074 TGAGAAACCTTGAGGAGAAAAGG - Intronic
1022524135 7:31026700-31026722 TGGGAACCCATGGGGAAGCACGG + Intergenic
1023334464 7:39153814-39153836 TGAGAAGCCTTGCGGGCAAAGGG + Intronic
1024682339 7:51705862-51705884 TGGGAAGCCTTAAGGAGAATTGG - Intergenic
1028616952 7:92779322-92779344 TGATAAACCTTGGAGAAAAAAGG + Intronic
1028883194 7:95903308-95903330 TTGGAAGCATTTGGGTAAAATGG - Intronic
1029530522 7:101122268-101122290 AGGGAAGGCTCGGGGAAGAAAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030296720 7:107936077-107936099 TGGAAAGCATTTGGAAAAAATGG + Intronic
1030826116 7:114160234-114160256 TGGCTAGCCTTGGGGGAAAATGG + Intronic
1032633207 7:133676669-133676691 AAGAATGCCTTGGGGAAAAAAGG - Intronic
1032903469 7:136337469-136337491 TGGGAAGCTGTGTGGAATAATGG + Intergenic
1033578950 7:142714064-142714086 TAGGAAGCTTTTGGGAAGAAAGG + Intergenic
1033865060 7:145680182-145680204 TGAGCAGCCTCAGGGAAAAATGG + Intergenic
1034119420 7:148613648-148613670 TGGGGAGACTTAGGGAGAAATGG + Intronic
1034982806 7:155489564-155489586 TGGGAAGCCTCAGGGAAACTGGG + Intronic
1038613954 8:29076105-29076127 AGGGAAGCCTCGGGGAGAGAAGG + Intronic
1040136003 8:43854623-43854645 TTTGAAGCCTAGGGGAAAAACGG + Intergenic
1040513869 8:48118882-48118904 TGGGAACTCCTGGGGAAGAATGG + Intergenic
1040857244 8:51960893-51960915 TGGGAAAGATTGGGGAAGAAGGG + Intergenic
1041117580 8:54554794-54554816 TGGGAAACCTGGGAGCAAAACGG + Intergenic
1041694805 8:60724649-60724671 TGGGAAGGCATGCAGAAAAAAGG - Intronic
1044115485 8:88328568-88328590 GGGGAAGGGTTGGGGAAAGAAGG + Intergenic
1044621553 8:94195591-94195613 TGGGAAGCCTTAAGGAGGAAGGG - Intronic
1045154600 8:99453343-99453365 TAGGATTCCTTGGGGAGAAAAGG + Intronic
1047193535 8:122700417-122700439 TGGGAAGAATTGGGGCAATAGGG + Intergenic
1047786378 8:128157690-128157712 TGGTATGCCTTAGGGAAAAGAGG + Intergenic
1048148049 8:131864851-131864873 AGGGAAGCCATATGGAAAAAAGG - Intergenic
1048308458 8:133299818-133299840 TGGGGAGCCTATGGGAAAATGGG - Intronic
1048937962 8:139372633-139372655 TTGGAAGCCTTCAGGAAAGAAGG + Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050863074 9:10461245-10461267 TGGTAAGAATGGGGGAAAAAAGG + Intronic
1051028126 9:12638877-12638899 TGGTAAGACTTTGGAAAAAAGGG - Intergenic
1051533141 9:18127711-18127733 TGGGAATGGGTGGGGAAAAAGGG + Intergenic
1053638302 9:40038643-40038665 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1053767782 9:41426577-41426599 TAGGAAGCATTGTGAAAAAATGG + Intergenic
1054546448 9:66338081-66338103 TAGGAAGCATTGTGAAAAAATGG + Intergenic
1055859312 9:80729871-80729893 GGGGATCCCTTTGGGAAAAATGG - Intergenic
1055871306 9:80883813-80883835 TGGGTATTCTTGGGGCAAAAAGG + Intergenic
1057182582 9:93038005-93038027 GGGGTGGCCTTGGGGAGAAAGGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057901001 9:98948221-98948243 TGAGAAGACTTCAGGAAAAATGG - Intronic
1057955604 9:99405125-99405147 TGGGAAGGGTAGGGGAAGAAGGG - Intergenic
1058082820 9:100717377-100717399 TGGGAAGCTTTGGTGAAACCTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058507454 9:105680599-105680621 TGGCTAGCTTTGGGGAAAAGGGG - Intergenic
1059295981 9:113271181-113271203 TGGGAAACACTGGGGAAGAATGG + Intronic
1060109188 9:120894506-120894528 TGGGAGGCGTCGTGGAAAAAGGG - Intronic
1060498953 9:124138377-124138399 TGGCTAGCCTTGGGGGACAATGG + Intergenic
1060534565 9:124374223-124374245 TGGGAAGGTTGGGGGAAAATGGG + Intronic
1060555598 9:124505800-124505822 TGGGCGGTCTTGGGGACAAAGGG + Intronic
1061905919 9:133697366-133697388 TTGGAAGAGTTTGGGAAAAATGG - Intronic
1061958985 9:133978408-133978430 TGGGAGGCCTTGAGGAAACTTGG + Intronic
1062361729 9:136191513-136191535 TGGGATGCCCTGGGCAGAAAAGG - Intergenic
1202786175 9_KI270719v1_random:22199-22221 TAGGAAGCATTGTGAAAAAATGG - Intergenic
1203731091 Un_GL000216v2:90644-90666 TGAGAGGGCTTAGGGAAAAAAGG - Intergenic
1185830910 X:3302170-3302192 TGAAAAGCCTTGGGAAAACATGG - Intergenic
1186075056 X:5869432-5869454 TGGAAACTCTTGGGGAAAATAGG + Intronic
1187018738 X:15357556-15357578 TGGGCAGAATTGGGGAAAGAGGG - Intronic
1187047537 X:15662190-15662212 AGGGAAACCATTGGGAAAAATGG - Intronic
1187235584 X:17464143-17464165 TGGGTAGCCTTGGAGAGAATGGG + Intronic
1187652800 X:21428038-21428060 TGGGAAGTGATGGGAAAAAAGGG + Intronic
1188156503 X:26748741-26748763 TGGGAAGCCAGAGGGAACAATGG - Intergenic
1188484406 X:30667347-30667369 TGAGAAGCCTAGGAGAAATATGG - Intronic
1190507473 X:51140555-51140577 TTGGAAGGGTAGGGGAAAAAGGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193125943 X:77870237-77870259 TGGGAACTTTGGGGGAAAAAGGG + Intronic
1193241383 X:79174238-79174260 TGGGCAGGCCTGGGGAAAAAGGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194765804 X:97844631-97844653 TCGGAAGCCTTGCGGGAGAACGG - Intergenic
1195056598 X:101151984-101152006 TGGGAGGCCCTGGGGAATGATGG - Intronic
1195063748 X:101220600-101220622 TGGAAAGCCTTGGCTAACAAGGG + Intronic
1195328411 X:103776646-103776668 AGGCAAGCCTTAGGGAAAAAAGG + Exonic
1196235703 X:113277241-113277263 TGGCAAGCCATGGGGCAGAAAGG + Intergenic
1196314093 X:114202409-114202431 TGGCTAGCCTTGGGGGAGAATGG + Intergenic
1198851187 X:140966787-140966809 TGGCTAGCCTTGGGGAGAATGGG + Intergenic
1199672448 X:150158653-150158675 TGGACAGACTTGGGGAAAGATGG + Intergenic
1200381326 X:155840455-155840477 TGAGAAGGGTTGGGGAAAAGGGG + Intergenic
1200701881 Y:6409456-6409478 AGGGCAGCCATGGGGAAAACAGG + Intergenic
1201032230 Y:9755242-9755264 AGGGCAGCCATGGGGAAAACAGG - Intergenic
1201413851 Y:13728235-13728257 AGGGGAACCTTGGGGAACAAAGG - Intergenic