ID: 1150101112

View in Genome Browser
Species Human (GRCh38)
Location 17:62424252-62424274
Sequence GGCGGCGGAGAGAAAAGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150101103_1150101112 28 Left 1150101103 17:62424201-62424223 CCCGTTTGATTTTCTCAGGGACA 0: 2
1: 0
2: 3
3: 21
4: 214
Right 1150101112 17:62424252-62424274 GGCGGCGGAGAGAAAAGTCCAGG 0: 2
1: 0
2: 0
3: 10
4: 117
1150101104_1150101112 27 Left 1150101104 17:62424202-62424224 CCGTTTGATTTTCTCAGGGACAA 0: 2
1: 0
2: 2
3: 35
4: 318
Right 1150101112 17:62424252-62424274 GGCGGCGGAGAGAAAAGTCCAGG 0: 2
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150101112 Original CRISPR GGCGGCGGAGAGAAAAGTCC AGG Exonic
901089577 1:6632406-6632428 GGGGCCGGAGAGGACAGTCCTGG + Exonic
901483102 1:9539595-9539617 GGCAGCGGGGAGACAAGACCCGG + Exonic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
903419109 1:23205898-23205920 GGAGGGGGAGAGAAGAGTCAAGG - Intergenic
904857977 1:33514458-33514480 GGAGGTGGAGAGAAATGTCAGGG + Exonic
905167031 1:36088807-36088829 GGCGGCGGAGTGGAAACTCTAGG + Intergenic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
910678989 1:89843543-89843565 GGCGGCGGGGAGGCAAGACCAGG - Intronic
913396760 1:118380016-118380038 GGCAGCAGAGGGAAAAGTCAAGG - Intergenic
914428291 1:147599212-147599234 GGCGGAGGAGAGCGCAGTCCTGG + Intronic
917060570 1:171033078-171033100 GGCTGCGGAGGGACAAGTCTTGG + Intronic
917522245 1:175757799-175757821 GGTGGTGGAGTGAAAAATCCAGG + Intergenic
918332511 1:183472943-183472965 AGGGGTGGAGAGAAACGTCCGGG + Intronic
920179121 1:204121867-204121889 GGCAGCAAGGAGAAAAGTCCTGG - Intronic
921701356 1:218272292-218272314 GGGAGGGGAGAGAAGAGTCCAGG - Intergenic
1064532362 10:16323265-16323287 GTAGGAGGAGAGAAAAGTCAGGG - Intergenic
1064585801 10:16838223-16838245 TGCTGGGGAAAGAAAAGTCCAGG - Intronic
1073119626 10:101113544-101113566 GGCTGCAGAGAGAGGAGTCCAGG - Intronic
1074225957 10:111484418-111484440 GGGGGTGGGGAGAAAAGGCCTGG + Intergenic
1076515773 10:131043672-131043694 GGAGGCAGAGAGAAAAGTGCAGG - Intergenic
1076857612 10:133124891-133124913 GGCGGCGGCGAGAAAAGCGGCGG + Intronic
1076991684 11:279140-279162 GACGGGGGAGGGAAAAGTCTGGG + Intronic
1077317664 11:1926578-1926600 GGCGGCGGAGCGAGCAGGCCAGG - Intronic
1078489403 11:11755284-11755306 GGCTGAGTAGAGACAAGTCCAGG - Intergenic
1080571096 11:33557899-33557921 GGCGGGGTAGAGAAAAGGCGGGG + Intronic
1083655215 11:64226175-64226197 GGCGGCGGGGACAAACCTCCAGG + Exonic
1085571082 11:77558602-77558624 GTCGGCCGGGTGAAAAGTCCAGG - Intronic
1088989556 11:114940205-114940227 GGAGGAGGGGAGAAAAGTACAGG - Intergenic
1090180707 11:124696787-124696809 GGCAGAGGAGAGAAAGGTCTGGG - Exonic
1096577484 12:52562296-52562318 GAAGGCAGAGAGCAAAGTCCAGG + Intergenic
1100013258 12:89978720-89978742 GGCTATGGAGAAAAAAGTCCTGG + Intergenic
1103592725 12:122003963-122003985 GGCGGAGGCGAGAAAAACCCTGG + Intergenic
1107043413 13:35972155-35972177 GGAGGAGGAGAGAAATGTCTAGG - Intronic
1112394753 13:99019470-99019492 GCAGGCAGAGAGGAAAGTCCAGG + Intronic
1112659806 13:101495225-101495247 GGTGGCTGAGACAAAACTCCTGG + Intronic
1114647372 14:24263236-24263258 GGGGGCGGAGAGAAGAGGCCAGG + Intronic
1120005682 14:79355236-79355258 GGTGGGGGACAGAAAAGCCCAGG - Intronic
1120640714 14:87008920-87008942 GGTGGTGGAGAGAAAAGTCTGGG - Intergenic
1122208478 14:100159973-100159995 GGCTGCGGAGAGAACGGGCCGGG - Exonic
1122318740 14:100840805-100840827 GGCTGCGGGGAGAGAGGTCCAGG + Intergenic
1129470719 15:75751954-75751976 GGGGCCGGAGAGAAAACTCAGGG + Intergenic
1131826343 15:96324658-96324680 GGGAGGGGAGAGAAAAGGCCAGG + Intergenic
1132933317 16:2469455-2469477 GACAGTGGAGAGAAAAGCCCAGG - Intergenic
1133177378 16:4025509-4025531 GGCGGCGAAGAGCACAGGCCAGG + Intronic
1133270515 16:4608991-4609013 GGAGGCGGTGGGAAGAGTCCTGG + Exonic
1136685203 16:31989969-31989991 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1136785814 16:32933504-32933526 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1136796914 16:33028337-33028359 GGCGGCGGTGGAAAAAGTCGCGG + Intergenic
1136883955 16:33920300-33920322 GGAGGCGGGGAGGAAAGTTCTGG - Intergenic
1138139693 16:54557601-54557623 GGCTTGGGAGAGAAATGTCCTGG - Intergenic
1141674242 16:85509261-85509283 GGCGGCGGTAACAAGAGTCCTGG + Intergenic
1142415545 16:89939166-89939188 GGCGGAGGAGAGAGAAGTCAGGG - Intergenic
1203088048 16_KI270728v1_random:1195166-1195188 GGAGGCGGGGAGGAAAGTTCTGG + Intergenic
1143368945 17:6426519-6426541 TGGGGTGGAAAGAAAAGTCCAGG + Intronic
1143381024 17:6496438-6496460 GGCAGTGGAGAGAAGAGCCCAGG - Intronic
1147015902 17:37490846-37490868 GGAGGCGAAGAGCAAACTCCGGG + Intronic
1147146146 17:38485650-38485672 GGAGGCGGGGAGGAAAGTTCTGG + Intronic
1147161763 17:38572750-38572772 GCCGGGGGAGAGAAGAGCCCGGG - Intronic
1148004283 17:44413002-44413024 GGTGGGTGAGAGAAAAGACCAGG + Intronic
1150101112 17:62424252-62424274 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1151731511 17:75914220-75914242 GGCAGCGGAGAGAGCAGCCCTGG - Exonic
1152272556 17:79333619-79333641 GGTGCAGGAGAGGAAAGTCCTGG + Intronic
1154518347 18:15197917-15197939 GGCGGCGGGGACAAAAATCCTGG + Intergenic
1156465319 18:37345070-37345092 GGAGGCGGACAGAAAAGTTTGGG + Intronic
1160178398 18:76614067-76614089 GGCGCGGGAGAGAAAAGCCCAGG + Intergenic
1161716365 19:5878182-5878204 GCCCGGGGAGAGAAAATTCCAGG + Intronic
1164398929 19:27889555-27889577 GGCTGCTCAGAGAAAAGTCAGGG + Intergenic
1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG + Intronic
1165246691 19:34501878-34501900 GGGGCCAGAGAGTAAAGTCCAGG + Exonic
928115537 2:28543079-28543101 AGGGGCTGAGAGAAAAGGCCTGG + Intronic
934467174 2:94273338-94273360 GGCGGAGGAGCGAAAAGCCGGGG + Intergenic
937927206 2:127176520-127176542 GGAGGCGGAGACAGAAGCCCCGG + Intergenic
948653937 2:239465217-239465239 AGAGGAGGAGAGAAACGTCCTGG - Intergenic
1172277010 20:33685452-33685474 GGCGGGGCGGAGGAAAGTCCTGG - Intronic
1172944850 20:38679129-38679151 GGTGGAGGAGAGAAAAGTGGTGG - Intergenic
1174424515 20:50422673-50422695 GGAGACGGAGAGAACATTCCAGG + Intergenic
1176061649 20:63175306-63175328 GGCGGCGGAGAGAAGGCGCCGGG + Intergenic
1176743370 21:10627649-10627671 GGCGGCGGAGCCAAAAAGCCGGG - Intergenic
1178469886 21:32882981-32883003 GGCAGCAGTGACAAAAGTCCTGG - Intergenic
1179801696 21:43814308-43814330 AGCAGCGGAGAGAAAAGGACAGG - Intergenic
1180534532 22:16386735-16386757 GGCGGCGGAGCAAAAAGCCGGGG - Intergenic
951222493 3:20083639-20083661 GGCAGCAGAGAGAACAGTCTAGG + Intronic
956401473 3:68884321-68884343 GAAGGCGGGGAGAAATGTCCTGG - Intronic
957801125 3:85083311-85083333 GAAGGCAGAGAGAAAAGTGCAGG - Intronic
959670423 3:108971061-108971083 GGTGGGGGAGAGAGAAGTCAGGG + Intronic
960015612 3:112884866-112884888 GGAGCCAGAGAGAAAAGTCATGG - Intergenic
962436439 3:135371450-135371472 GGTGGGAGAGAGAAAAGGCCAGG - Intergenic
966949783 3:184805731-184805753 GAGGGTGGAGAGAAATGTCCAGG - Intergenic
968282910 3:197490509-197490531 GCCAGGGGAGAGAAAACTCCTGG + Intergenic
968383637 4:116843-116865 AGAGGCGGAGAGAAAGGTCATGG - Intergenic
969462655 4:7336899-7336921 GGCGGCTCAGGGACAAGTCCAGG - Intronic
975395486 4:73869475-73869497 GGCGGCGGAGAGAGCAGCGCGGG - Exonic
977553879 4:98469107-98469129 GAAGGCTGAAAGAAAAGTCCAGG + Intergenic
981620819 4:146696644-146696666 GTCAATGGAGAGAAAAGTCCAGG + Intergenic
985812960 5:2103599-2103621 GGCTGCACAGAGAAAAGCCCAGG - Intergenic
988455220 5:31381605-31381627 GGCAGGGCAGAGAAAAGTCTAGG - Intergenic
989105799 5:37861964-37861986 TGCCGTGGAGAGAAAAGGCCTGG + Intergenic
992089382 5:73303767-73303789 GGCGGAGTGGAGAAAGGTCCCGG + Intergenic
1004196088 6:13506641-13506663 AGTGCTGGAGAGAAAAGTCCTGG + Intergenic
1004512552 6:16294748-16294770 TGTTGCGGAGAGGAAAGTCCTGG - Intronic
1004950486 6:20665102-20665124 GGTGATGGAGAGAAGAGTCCAGG + Intronic
1005372905 6:25153741-25153763 GGCAGCACAGAGAAAAGTTCTGG - Intergenic
1006803739 6:36775553-36775575 AGCGGAGGAGAGAATATTCCAGG - Intronic
1006826122 6:36937621-36937643 GGCCTCGGAGAGAACTGTCCTGG + Intergenic
1018632364 6:165832263-165832285 GGAGGCGGAGAGGAACGTTCTGG + Intronic
1018938060 6:168286998-168287020 GGGGGCGGGGGGAAAAATCCAGG + Intergenic
1020105385 7:5420276-5420298 GGCGGCGGAGGGGAAAACCCTGG - Intronic
1021234046 7:18120607-18120629 GGCAGCGGGGAGAAAAGACAGGG + Intronic
1022185228 7:27960792-27960814 GGCTGCTGGGAGAAAAGTGCAGG + Intronic
1023448672 7:40258143-40258165 GGCAGAGGAGAGAAAAGGCCAGG - Intronic
1026777980 7:73243250-73243272 CGCGATGGAGAGAAAACTCCTGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1031409110 7:121421232-121421254 ATCTGCGGAGAGAAAATTCCAGG - Intergenic
1032030264 7:128477115-128477137 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1032789543 7:135232304-135232326 GGCCCAGGAGAGAAAAGTCAGGG + Intronic
1034012099 7:147540315-147540337 GGAGGCAGACAGAAGAGTCCAGG - Intronic
1036179974 8:6576160-6576182 GGAGGGGGTGAAAAAAGTCCAGG + Intronic
1044692672 8:94895460-94895482 GGCGGCGGGGAGAACAGCCGCGG - Intronic
1049843066 8:144786723-144786745 GGCTGCGGGGAGAAAAGCCTTGG + Intronic
1051329792 9:16012127-16012149 GGCAGCACAGAGGAAAGTCCTGG - Intronic
1052196838 9:25727656-25727678 GGCAGGGTAGAGAAAAATCCTGG - Intergenic
1056730934 9:89166250-89166272 GACGGAGGAGAGAAAATACCAGG - Intronic
1059399502 9:114060056-114060078 GGCGGAGGGGAGAAAAAGCCAGG - Intergenic
1061237635 9:129351853-129351875 GGCCCCAGAGAGAAAAGACCAGG - Intergenic
1061577040 9:131513830-131513852 GGCGGTGGAGAGAGCAGTCAGGG - Intronic
1061779435 9:132987102-132987124 GGCGGCGGCAAGAAGAGGCCAGG - Intronic
1195694452 X:107656320-107656342 GGCTGAGGTGAGAAAAGTGCTGG + Intergenic
1196791381 X:119468266-119468288 GGCGGCGCGGAGAGCAGTCCCGG + Intergenic
1201049490 Y:9918080-9918102 GGGAGCGGAGATAAAAGTCAAGG + Intergenic