ID: 1150101450

View in Genome Browser
Species Human (GRCh38)
Location 17:62427250-62427272
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150101450_1150101455 12 Left 1150101450 17:62427250-62427272 CCTTACCCTCTCTGAGCAGTGAG 0: 2
1: 0
2: 1
3: 25
4: 196
Right 1150101455 17:62427285-62427307 GCACTTTATAGTTATGAGGATGG 0: 1
1: 0
2: 1
3: 12
4: 180
1150101450_1150101454 8 Left 1150101450 17:62427250-62427272 CCTTACCCTCTCTGAGCAGTGAG 0: 2
1: 0
2: 1
3: 25
4: 196
Right 1150101454 17:62427281-62427303 CTCTGCACTTTATAGTTATGAGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150101450 Original CRISPR CTCACTGCTCAGAGAGGGTA AGG (reversed) Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG + Intronic
903557907 1:24206600-24206622 CTTCCTGCTCAGGGAAGGTAGGG - Intergenic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
906777471 1:48542992-48543014 CCCACTGTTCAGAGAAGATAAGG + Intronic
907928633 1:58978536-58978558 CTCTGTGCTCAGAGGAGGTAAGG - Intergenic
909136106 1:71802518-71802540 TTTACTTCTCAGAGAGGGTGGGG + Intronic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
913257363 1:116965533-116965555 CTCACTGATTAGAGAGGCTGAGG - Intronic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915271755 1:154758616-154758638 CCCACTGCACAGAGAGTTTAAGG - Intronic
917176299 1:172239440-172239462 TTCATGCCTCAGAGAGGGTATGG - Intronic
918238661 1:182603188-182603210 CTCAGGGCTCCGAGAGGGAAGGG - Intronic
919142723 1:193592959-193592981 CTCACTGCTAATAGAGGCTCTGG + Intergenic
919569203 1:199224470-199224492 TTCACAGCTCAGAGTGGGAAAGG + Intergenic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1066026221 10:31362507-31362529 CTCACTGCCCAGACGGGGCAGGG + Intronic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1073029299 10:100512268-100512290 CTCAGTGTATAGAGAGGGTAAGG + Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1078188692 11:9074091-9074113 CTCCCTGCTCTGGGTGGGTAGGG - Intronic
1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG + Intronic
1083182497 11:60996271-60996293 CCCACTGCTCTGATAGGGAAAGG - Intronic
1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG + Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090782718 11:130021778-130021800 CTCACTGCCCAGGGCTGGTAGGG - Intergenic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1092098708 12:5865113-5865135 GTCACTGCTAAGAGAAGGCAGGG - Intronic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1092184520 12:6469066-6469088 ATAACTCCTCAGAGAGGCTATGG + Intronic
1095556763 12:43516002-43516024 CTGACAGGTCAGAGTGGGTAGGG + Intronic
1095800374 12:46265992-46266014 GTCACTGCTCAAAGTGGGAAGGG + Intronic
1095951881 12:47786062-47786084 CTCAAGGCTCAGGGAGGTTAAGG + Intronic
1096769257 12:53923686-53923708 CTCCCTGCACAGATAGGGTGTGG + Intergenic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1102281017 12:111618997-111619019 CTCAGTGCTTTGAGAGGCTAAGG + Intergenic
1102383876 12:112490555-112490577 CTAACTACTCAGAGAGGCTGAGG - Intronic
1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG + Intergenic
1103047470 12:117749262-117749284 CCCACTTCTCAGAGCTGGTAAGG - Intronic
1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG + Intronic
1103217748 12:119215797-119215819 TTCAGTGCCCAGAGAGAGTAGGG - Intronic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1105296066 13:19088916-19088938 CACACTGCTCTGAGGGGGCAAGG - Intergenic
1106562283 13:30857116-30857138 CTCACATCTCTGAGAGGGTTTGG + Intergenic
1110367295 13:74701331-74701353 CTCATAGGTCAGAGAGGTTAAGG + Intergenic
1110626571 13:77661084-77661106 CTCACTGCCCAGACGGGGCAGGG + Intergenic
1114570047 14:23660579-23660601 CTCACTGCTCAGACAGAGGAAGG - Intergenic
1115706156 14:36000333-36000355 ACCACTGCTCATAGAGGGTTGGG - Intergenic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1121011618 14:90523266-90523288 CTCACTGATCAGAGAAGGGCGGG + Intergenic
1124147683 15:27143328-27143350 CCCAGTGCTTAGAGAGGCTAAGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125015410 15:34928881-34928903 CTGACTGGTGAGAGATGGTATGG + Intronic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG + Intergenic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1135139491 16:19909312-19909334 CTCACTTCTCAGGGTGGGCAAGG + Intergenic
1137234202 16:46600348-46600370 CTCACTACTCAAGGAGGCTAAGG + Intronic
1140477443 16:75245899-75245921 CTAGATGCTCAGAGAGGCTAAGG - Intronic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142374024 16:89697664-89697686 CTCACGGCGCAGAGAGAGGAAGG + Exonic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1148522650 17:48295588-48295610 CTCACTGCTATGAGAGGCTTTGG - Intronic
1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG + Intronic
1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG + Exonic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG + Intronic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1153866438 18:9273788-9273810 CTCAATGCTCTGGGAGGCTAAGG - Intronic
1156937746 18:42731379-42731401 CTTAGTGCTCAGAGAGGTGAAGG + Intergenic
1157817954 18:50744015-50744037 ATGACTGCCCTGAGAGGGTATGG - Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1161065920 19:2237165-2237187 CTCACTGCTCAGGGAGGCCTTGG + Intronic
1162367308 19:10257256-10257278 CTGCCTGGTCAGAGAGGGAAAGG - Intronic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1165773668 19:38392306-38392328 CTCTCTGCTGGGGGAGGGTAGGG + Intronic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
925060793 2:888585-888607 ATCACTGCTCAGTGAGGGCTGGG + Intergenic
929335492 2:40739223-40739245 CTCACTGCCCAGGGAAGGAAAGG - Intergenic
929461439 2:42104689-42104711 CTCTCTGATCAGAGATGGAAAGG + Intergenic
929829995 2:45339437-45339459 CTCCGTGCTCACAGAGGGAAAGG - Intergenic
930373379 2:50533127-50533149 CTCAGTGCTTAGAGAGGTTCTGG - Intronic
930599023 2:53423167-53423189 CTCAGTACTCTGAGAGTGTAGGG + Intergenic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932063133 2:68527922-68527944 CTCACTGCCCAGACGGGGCAGGG + Intronic
934689552 2:96347829-96347851 CTCACCACTCAGAGTGGGCATGG - Intronic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
944065381 2:195614512-195614534 GACACTGCTCAAAGTGGGTAAGG - Intronic
944898108 2:204186584-204186606 CTCTTTGCTCAGAGAGGTGAAGG - Intergenic
946168131 2:217877799-217877821 CTCACTGCCAGGAGAGGGCAAGG + Intronic
947227752 2:227856728-227856750 CTCACAGCTCAGAGAGGACTTGG + Intergenic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
948123200 2:235546012-235546034 CTCACTCCTCACAGAAGGCAAGG - Intronic
1169297467 20:4412492-4412514 CTCAGTGCTTAGAGATGGTATGG - Intergenic
1170151474 20:13231314-13231336 CTGACTGCTCCGGGAGGGCATGG - Intronic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1174566614 20:51469265-51469287 CTCAGTGCTTTGAGAGGCTAAGG - Intronic
1177356646 21:20017395-20017417 TTCACAGTTCAGAGAGAGTAAGG - Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179060498 21:37974735-37974757 CTCATTGGTCAGAGATGGTTTGG - Intronic
1179484653 21:41702143-41702165 CTCACAGTTCAGAATGGGTAAGG + Intergenic
1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG + Intergenic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182652391 22:31862674-31862696 CCCACTGCACTGGGAGGGTAAGG + Intronic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1182889965 22:33809374-33809396 CTCACTGCTTATTGAGGGCATGG - Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
950043859 3:9937543-9937565 CTCACTGATCGGACAGGGCAGGG - Exonic
950110774 3:10417253-10417275 CTCACTTCCCAGAGAGTGTGGGG + Intronic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
950917343 3:16659275-16659297 CTCACTGATCATAGGGGTTATGG + Intronic
953600362 3:44357152-44357174 CCCATTGCTTTGAGAGGGTAAGG + Intronic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
961736624 3:129005726-129005748 CTCACAGCTGGGAGATGGTAAGG + Intronic
962398341 3:135036682-135036704 CTGACTGATCACAGAGGTTAAGG - Intronic
966116323 3:176467654-176467676 CTCACTGCTGAGATAGAGAAAGG + Intergenic
967048132 3:185756116-185756138 CTCACTCTTCAGTAAGGGTATGG - Intronic
967451324 3:189626626-189626648 CTCTCTGCTCAGTCATGGTAGGG + Intergenic
968595988 4:1485283-1485305 CTCAGTGCTTTGAGAGGCTAAGG - Intergenic
968862318 4:3182678-3182700 CCCACAGCTCCGAGAGGTTATGG + Intronic
972574776 4:40341672-40341694 CACACTCCACAGAGTGGGTATGG - Intronic
972810036 4:42573763-42573785 CTTACTGCTCAGAGTGAGTGGGG + Intronic
976591221 4:86851481-86851503 CTCAGTGCTGATAGAGGGGAGGG + Intergenic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
980023850 4:127740845-127740867 ATCTCTGCACAGAAAGGGTAGGG + Intronic
981568477 4:146126385-146126407 CTCACTGGTCAGAGTTGTTATGG - Intergenic
985997818 5:3606501-3606523 CTCACTGCCCAGAAAGGGCCAGG - Intergenic
986672737 5:10157332-10157354 TTCACTGCTCAGAGATGCTTGGG - Intergenic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
989378552 5:40791052-40791074 CTCACTGCACAGTGATGGTGGGG - Intronic
990762399 5:59144250-59144272 CTCAGTACTCAGAGAGGTCATGG - Intronic
991456100 5:66806244-66806266 CTCCCTGCTCTGACAGGGTAAGG - Intronic
996436942 5:123444614-123444636 TTCTCTGCTCAGAGAGAATATGG + Intergenic
997262666 5:132476506-132476528 GTCACTGGTCAGAGAAGGGAGGG + Intergenic
997654045 5:135542400-135542422 CTCACTGCTGAGGAAGGGTGGGG - Intergenic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
1000105704 5:158056929-158056951 CACACTGCAGAGAGAGGGAAAGG - Intergenic
1004549394 6:16632115-16632137 CTCACTGGCCAGAGAGGAAAAGG - Intronic
1005080219 6:21949579-21949601 CTGATTGCTTAGAGAGGTTATGG - Intergenic
1005243407 6:23855730-23855752 CTCACTGCCCAGACGGGGCAGGG - Intergenic
1005345413 6:24884585-24884607 CTCACTCCTCAGCAAGGGGATGG + Intronic
1006618442 6:35345526-35345548 CTCAGTGCTCTGAGAGGCCAAGG - Intronic
1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG + Intergenic
1007387338 6:41528697-41528719 ATCACAGCTCAGAGTGGGTTTGG + Intergenic
1008072975 6:47116558-47116580 CTCACTGGTCAAAGAGGCTCAGG - Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1009418911 6:63443561-63443583 CTCACTGCTGAGAGTCGGTCTGG - Intergenic
1014740873 6:125146588-125146610 CTCACTTATCAGAAAGGGGATGG - Intronic
1015157794 6:130116500-130116522 CTCAATGCTTTGAGAGGGTGAGG + Intronic
1017521894 6:155209785-155209807 CTCACTTCTAAGATAGGGGAAGG - Intronic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018581976 6:165315569-165315591 CTCACTGGGCAGAGAAGATATGG - Intergenic
1018660388 6:166080730-166080752 CTCGCTGCTCAGGGAGAGAAAGG - Intergenic
1020220021 7:6229032-6229054 CCCTCTGCTCAGAGGGGGTGTGG - Intronic
1021717602 7:23473935-23473957 CTCACGGCTCACAGTGGGGAGGG + Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG + Intronic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1030365271 7:108638767-108638789 CTGACTCCTCAGAGAGTCTAAGG - Intergenic
1030912594 7:115270370-115270392 CCCAGTGCTTTGAGAGGGTAAGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034237399 7:149583048-149583070 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1034240419 7:149606419-149606441 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1040699418 8:50042845-50042867 CCCACTGCTTTGAGAGGCTAAGG - Intronic
1044523918 8:93230134-93230156 CTCGCTGCTCAGGGAGAGAATGG - Intergenic
1045683604 8:104688693-104688715 CACACTGCTCAGAAAGCATAGGG - Intronic
1046376566 8:113389831-113389853 CTCACTTTTCAAAGAGGGAAGGG - Intronic
1046685800 8:117225534-117225556 ACCACTGCTCAGATAGGGAAGGG + Intergenic
1047173904 8:122522331-122522353 CTCAAGGCTCAGAGAGAATAAGG + Intergenic
1048235906 8:132690438-132690460 CTCACTGTTCGGCAAGGGTAGGG - Intronic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1050687854 9:8191327-8191349 CTCACTGCTCAGCCTGGGTGAGG - Intergenic
1052413542 9:28149546-28149568 CTCACTGCCCAGACGGGGCAGGG - Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054959120 9:70947628-70947650 CTCAGAGCTCAGAGAAGGTGGGG + Intronic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1056019936 9:82430953-82430975 CTCACTTCTCAGACAGTGCAGGG + Intergenic
1057071815 9:92105681-92105703 GTCACTTCCCAGAGAGGGTGGGG - Intronic
1057258931 9:93573435-93573457 AGGACTGCTCACAGAGGGTAAGG - Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1058847181 9:108972424-108972446 CTAACTTCTCTGAGAGGATAAGG + Intronic
1059470102 9:114498516-114498538 AGCACTGCTCAGAGAATGTATGG + Intronic
1059932839 9:119278319-119278341 TTCACTGCTCAGAAAGATTAAGG - Intronic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1061800134 9:133109188-133109210 CACACAGCTCTGAGAGAGTAAGG - Intronic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG + Intronic
1186326034 X:8477571-8477593 CACAATGGTCAGGGAGGGTAGGG - Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1194546280 X:95239093-95239115 CCTAGTGCTCAGAGAGGCTACGG - Intergenic
1195857305 X:109345132-109345154 CTCACTTCTCAGGGAGGTTAGGG + Intergenic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic