ID: 1150102626

View in Genome Browser
Species Human (GRCh38)
Location 17:62437599-62437621
Sequence TGGCCAAAGCTGATTCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150102626_1150102630 21 Left 1150102626 17:62437599-62437621 CCTGTTTGAATCAGCTTTGGCCA 0: 2
1: 0
2: 1
3: 13
4: 148
Right 1150102630 17:62437643-62437665 TTGCAGAAGACGGACATTGAGGG 0: 1
1: 0
2: 2
3: 13
4: 97
1150102626_1150102629 20 Left 1150102626 17:62437599-62437621 CCTGTTTGAATCAGCTTTGGCCA 0: 2
1: 0
2: 1
3: 13
4: 148
Right 1150102629 17:62437642-62437664 TTTGCAGAAGACGGACATTGAGG 0: 1
1: 0
2: 2
3: 12
4: 140
1150102626_1150102628 11 Left 1150102626 17:62437599-62437621 CCTGTTTGAATCAGCTTTGGCCA 0: 2
1: 0
2: 1
3: 13
4: 148
Right 1150102628 17:62437633-62437655 ACTCACATATTTGCAGAAGACGG 0: 1
1: 1
2: 2
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150102626 Original CRISPR TGGCCAAAGCTGATTCAAAC AGG (reversed) Intronic
905272321 1:36795159-36795181 TGGCCTGAGCTTTTTCAAACTGG - Intergenic
906819797 1:48917793-48917815 TGGACAAATCTGTTTCAACCAGG - Intronic
908027071 1:59964131-59964153 TGGCCAAAACTTATTTAAACTGG + Intergenic
910115908 1:83731500-83731522 TGGCCAAAGCAGTTCAAAACTGG - Intergenic
910351747 1:86306661-86306683 TGGGCATAGCTAATGCAAACAGG - Intergenic
910487835 1:87735398-87735420 TGCCCAAAGATGATTTATACAGG - Intergenic
917358937 1:174155785-174155807 TGGGCAAAGTTGATTTAAATAGG + Intergenic
918394332 1:184098333-184098355 TGGCCAAACCTGTTAGAAACAGG + Intergenic
919062818 1:192655600-192655622 TGGCCAATGCTGACATAAACAGG + Intronic
922236076 1:223723732-223723754 TGGCCAAAGCTGAGGCAGCCAGG - Intronic
924033419 1:239910433-239910455 TGGCCACAGCTGATTAACAAAGG - Exonic
924801075 1:247330191-247330213 TGGGCAAAGCTGATTCTGGCTGG - Intronic
1065644729 10:27822420-27822442 TGCCCAGAGCTGATTTGAACTGG + Intronic
1066293104 10:34031576-34031598 TGGCCAAATATGACTCAATCAGG + Intergenic
1066417531 10:35235171-35235193 TGGTCAAAGTTGATTGAAATTGG - Intergenic
1067214444 10:44290164-44290186 TGGTCAAAACTGATTCAGACTGG + Intergenic
1068045894 10:51885792-51885814 AGGCCCAAGCAGATTCAAATTGG - Intronic
1068992920 10:63169341-63169363 AGGCCCAAGCTGATCCAATCTGG + Intronic
1069233349 10:66039598-66039620 TGGACAAAGCTGACAAAAACAGG + Intronic
1071750030 10:88464942-88464964 TGCCTAAAGGTGGTTCAAACTGG + Intronic
1071868790 10:89768657-89768679 TGGCCACAGCTGAATTAAAGAGG - Intronic
1074435870 10:113433727-113433749 TGGCCAAATCTGATGTCAACAGG - Intergenic
1078561408 11:12376611-12376633 AGGCCACAGCTGATTGAACCTGG - Intergenic
1079339735 11:19602070-19602092 TGGCCAAAGCTGATTGGACTGGG - Intronic
1079708807 11:23654394-23654416 TGGCCAAAATTAATTCAAAATGG + Intergenic
1080392044 11:31857431-31857453 TGGCCAAAACTGATTGAACTGGG - Intronic
1080773815 11:35366975-35366997 TGGTCAAAGCTGACTAATACAGG + Intronic
1083359000 11:62092317-62092339 TGGTCAAAGCTGATTGATATTGG + Intergenic
1084392401 11:68886385-68886407 TGGTCAAAGCTGATTAAGATTGG - Intergenic
1086430987 11:86736880-86736902 TGGCCACAGCTGATTGAATAGGG + Intergenic
1091915466 12:4269667-4269689 TGTCCTAAGCTGAATCAGACAGG + Intergenic
1092114758 12:5992072-5992094 TGGGCACAGCTGATTCAACATGG + Intronic
1093884755 12:24446924-24446946 TGGCCAAAGCTGAAACAATTTGG + Intergenic
1095196384 12:39323510-39323532 TGCCCAAAGCTGATACTAGCTGG - Intronic
1098439995 12:70507551-70507573 TGGCCAAAGCTGATTGAGATTGG + Intergenic
1100331185 12:93583657-93583679 TGCCCAACGCAGCTTCAAACTGG - Intergenic
1100497990 12:95144035-95144057 TGGCAAAAGCTGTGTCAAACCGG - Intronic
1105584009 13:21727027-21727049 TGGCCAGAGCTGATTGAATAAGG - Intergenic
1110310616 13:74044884-74044906 TGGCCAAAGCTAAAACAAATTGG + Intronic
1111495710 13:89046959-89046981 TGAACAAAATTGATTCAAACGGG - Intergenic
1112458144 13:99580325-99580347 TGGCCACAGCTGATTGGACCAGG - Intergenic
1112749459 13:102567309-102567331 TGGCCACAGTTGATTTATACAGG + Intergenic
1117207769 14:53462206-53462228 TGGCCAAAGTTGTTTAAAAGAGG + Intergenic
1118891096 14:69909814-69909836 CGGCCAAAGATAATTCTAACTGG + Intronic
1119105095 14:71916249-71916271 TGGAAAGAGCTGAATCAAACTGG + Intergenic
1120442554 14:84558796-84558818 TGGCCACAGCTGTTTCACCCTGG + Intergenic
1121785125 14:96652807-96652829 TGACCAAAACTGACTCAAAAAGG - Intergenic
1121986507 14:98511980-98512002 TGGCCAAAGCGCATTCTAAGAGG - Intergenic
1122083660 14:99284682-99284704 TGTCCTAGGCAGATTCAAACTGG + Intergenic
1125275141 15:37980742-37980764 TGGCCAATGCTACATCAAACTGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127121919 15:55779411-55779433 TGGCCATAGCTGATTGATCCAGG - Intergenic
1127893958 15:63278139-63278161 TGGCCACAGGTGATTCTAATAGG - Intronic
1128418034 15:67465113-67465135 TGCCCACACCTGATTAAAACAGG - Exonic
1129229259 15:74187747-74187769 TGGCCCAAGAAGATTCAAAGTGG + Intronic
1129800579 15:78410759-78410781 TGGCCACAGCTGATTGAATTTGG - Intergenic
1131821880 15:96282028-96282050 TGGCCCCAGCTGATTGGAACAGG - Intergenic
1134125546 16:11613557-11613579 GGGCCCCTGCTGATTCAAACTGG + Intronic
1137491411 16:48936302-48936324 TTGACAAAGCTGTTTAAAACTGG + Intergenic
1137937594 16:52649428-52649450 TGGCAAAAGCTAATTCTACCTGG - Intergenic
1143600865 17:7944990-7945012 TGGCCATAGCTCACTCAGACTGG + Intronic
1144936399 17:18902568-18902590 TGGCCAAATATGATTGAAATTGG + Intronic
1146848557 17:36201732-36201754 AGGCCAAAGCTGGGCCAAACAGG - Intronic
1150102626 17:62437599-62437621 TGGCCAAAGCTGATTCAAACAGG - Intronic
1155964591 18:32023989-32024011 TGGTCAAAGCTGACTGAAATTGG - Intronic
1155997244 18:32343210-32343232 TGGCAAAAAATGATACAAACTGG + Intronic
1156347324 18:36269476-36269498 TGGTCAAAGATGATACAGACAGG - Exonic
1158783029 18:60674902-60674924 TGGCCAAAGCTGAGACAGTCTGG + Intergenic
1159248112 18:65836279-65836301 GGGCGAAAGCTGATCCAGACAGG + Intronic
1160346402 18:78135802-78135824 TGGCAAAAGGTGATTCAGATGGG - Intergenic
1160508912 18:79442475-79442497 TGGAGAAAGATCATTCAAACCGG - Intronic
1161697323 19:5776617-5776639 GGGCCAGAGCTGGCTCAAACTGG + Intronic
1162924789 19:13924907-13924929 TGGCCAAAGCTGAGTGAAGCGGG - Intronic
1163288155 19:16362140-16362162 GGGATAAAGCTGATTAAAACTGG - Intronic
1166940590 19:46361885-46361907 TGGTCAAAGCTGATTGAGATTGG - Intronic
925641301 2:5988254-5988276 AGGCCCAACCTGATGCAAACCGG - Intergenic
925872674 2:8284679-8284701 TGACAAAGGCTGATTCAACCTGG - Intergenic
926157344 2:10463917-10463939 TGGCCAATGCTGAGTCCCACAGG - Intergenic
928464019 2:31503373-31503395 CTGCCAAAGCAGATTCACACAGG - Intergenic
933048162 2:77565353-77565375 TGGCCAAAGCTGGAACAATCTGG + Intronic
934714142 2:96533528-96533550 TGGCCAAAGCTCTTTCAGGCAGG + Intergenic
935952747 2:108345644-108345666 TGACCAAAGCTGTTTCTAGCCGG + Intergenic
937920551 2:127126396-127126418 TTGCAAAAGCTGACTCAAAATGG - Intergenic
939501702 2:142994513-142994535 TGACCAAAGCTGATTGGAGCAGG - Intronic
940629314 2:156217828-156217850 AGGCCAAATCTGAGTCCAACAGG - Intergenic
943104456 2:183527351-183527373 TGGCCAAAACTGAACCAAATAGG - Intergenic
943736457 2:191361187-191361209 TGGCCAAAGCTGATTATTAGGGG + Intronic
947280895 2:228453448-228453470 TGCCCAAAGCAAATTCATACAGG - Intergenic
1170142431 20:13138259-13138281 TGGCCAAAGCTGATGCTGAATGG - Intronic
1173924558 20:46771190-46771212 TATCCAAAGCTGATAGAAACAGG + Intergenic
1180138634 21:45877475-45877497 TGGCAAAATCTGTTTAAAACTGG - Intronic
1180551223 22:16543545-16543567 TGGCCAGAACTGATTCACTCAGG - Intergenic
1181891182 22:26065012-26065034 TGGCCAAAGCGGGTTCAAGCTGG - Intergenic
1182265563 22:29112277-29112299 TGGCCACAGCTGCCTCACACTGG - Intronic
1184311004 22:43642747-43642769 TCTTCAAAGCTGATGCAAACTGG + Intronic
1184432336 22:44448826-44448848 TGGCAAAAGCTGTTTCAAAAAGG + Intergenic
949844663 3:8357377-8357399 GGGCAAAAGCTGGTTAAAACAGG + Intergenic
950686749 3:14623819-14623841 TGGCCAAATCTGATTTAAAATGG + Intergenic
950850144 3:16054372-16054394 TGGCCACAACTGATTGAACCAGG - Intergenic
951230638 3:20174743-20174765 TCACCAAAGCTGATTCAGCCAGG - Exonic
955405068 3:58620762-58620784 TGCCCAGGGCTGCTTCAAACAGG - Intronic
957390185 3:79555313-79555335 TGGCCAAAGCTCTTTGAACCAGG + Intronic
957513351 3:81218677-81218699 TTCCCAAATCTGATTAAAACTGG + Intergenic
960511329 3:118552962-118552984 TGGCCCAAGCTGGTCCAATCAGG + Intergenic
964947637 3:162245401-162245423 TTGACAAACCTGATACAAACAGG - Intergenic
965071525 3:163921886-163921908 TGACCAAAACTGAATTAAACTGG - Intergenic
965665550 3:171089970-171089992 TGGTCACAGCTGATTGAATCAGG + Intronic
965673239 3:171168675-171168697 TGGCCAACGCTGATTCATCCTGG - Intronic
967409408 3:189152338-189152360 TGGCCAAAGCTGATTGGACTAGG - Intronic
969047939 4:4351671-4351693 TGGCCAAAGATGATTGAGATTGG - Intronic
970078411 4:12251741-12251763 TGGAGAAATCTGACTCAAACAGG - Intergenic
970184245 4:13432296-13432318 TGGCCAAACCTAAGACAAACTGG + Intronic
970935470 4:21565098-21565120 TAGCCCAAGCTGATTAACACAGG - Intronic
971342706 4:25785259-25785281 TGGCCAACGTTAATTCACACAGG - Intronic
971859490 4:32086381-32086403 TGGCCAGAGCTGTTTCATTCTGG + Intergenic
972867778 4:43255936-43255958 TGGCCAGAGCTGTTTCACCCTGG + Intergenic
972916354 4:43884615-43884637 GAGCCAAACCTGATTCAAGCAGG - Intergenic
973603131 4:52561404-52561426 AGGCCACAGCTGATTCCAAGGGG - Intergenic
974204158 4:58677788-58677810 TGGTCAAAGCTGATTGAGATTGG + Intergenic
978423626 4:108560086-108560108 TGGCCAAAGCTGGTTCCATCTGG - Intergenic
981352056 4:143742749-143742771 TGGCCACAGCTGACTGGAACAGG + Intergenic
982446015 4:155491565-155491587 GGGAGAAAGCTGATTTAAACTGG + Intergenic
982916784 4:161221211-161221233 TTGCCAGAGCTGATTCAATTTGG - Intergenic
985808593 5:2066985-2067007 TGGGCAAAGCAGATCTAAACAGG + Intergenic
986508170 5:8474277-8474299 TGGCCAGAGCTGTTTCACTCTGG + Intergenic
986945467 5:13013182-13013204 TCGACAAAGCTGATAAAAACAGG - Intergenic
990320711 5:54627639-54627661 TGGCTAAAGCTGTGTCAAGCAGG + Intergenic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
991166536 5:63569779-63569801 TGGCCAGAGCTGTTTCACCCTGG - Intergenic
992195077 5:74330969-74330991 TTGCCAAAGGAGATTAAAACTGG - Intergenic
993689568 5:90982762-90982784 TGGCCACAGCTGATTTAATCAGG - Intronic
996226976 5:121011470-121011492 TGGCCAAAGCTAGGTCAATCAGG + Intergenic
997036609 5:130200558-130200580 TGGTCAAAGTTGATTAAAATAGG + Intergenic
1000469700 5:161625613-161625635 TTGCCATTGCTGATTCAAACAGG - Intronic
1003538719 6:6999747-6999769 TTGCCAAAGCTCTTTCAGACAGG - Intergenic
1011594233 6:89000851-89000873 TGGTCAAAGCTGATTGAGATTGG + Intergenic
1015292837 6:131558191-131558213 TGCCCAAAGCTGATTTTAACAGG - Intergenic
1016119223 6:140327064-140327086 TGGCCAGAGCTGTTTCACCCTGG + Intergenic
1020736932 7:11962377-11962399 TGGTCAAAGCTGATTGAGATTGG - Intergenic
1021992321 7:26151103-26151125 TGGACAAAGGTGAACCAAACAGG + Intergenic
1023210563 7:37799658-37799680 TCGCAAAAGCTAATTCAAAATGG - Intronic
1024412407 7:49060436-49060458 TTACCAAAGCTGAAGCAAACCGG - Intergenic
1030187554 7:106778470-106778492 TGACCAATGCTGATCCACACTGG + Intergenic
1031953395 7:127915687-127915709 TGGCCACAGCTTATTCTAAGTGG + Intronic
1032031830 7:128490788-128490810 TGGCCAAAGCTGATTCAAACAGG - Intronic
1032211203 7:129915722-129915744 TGGCCAAAGCAAAAGCAAACGGG + Intronic
1032438474 7:131921843-131921865 TGGCCATAGCTACTTCAAAGAGG + Intergenic
1033297127 7:140150156-140150178 TGGTCAAAGCTGCTAGAAACAGG - Intronic
1040807826 8:51413528-51413550 TGAACAATGCTGATTCACACAGG + Intronic
1042106027 8:65327078-65327100 TGGTCTCAACTGATTCAAACGGG - Intergenic
1042384709 8:68161006-68161028 TGGTCAAAGCTGATTAAGATTGG - Intronic
1045669595 8:104534408-104534430 TGGCCAAATTTGTTACAAACAGG + Intronic
1046795634 8:118368606-118368628 TGGTGAAAGATGATTCAAAATGG + Intronic
1047039440 8:120976447-120976469 TGGCCAAAGATGATAGAACCAGG + Intergenic
1050888284 9:10791656-10791678 TGGCCACAGAGGATTCCAACTGG + Intergenic
1053198043 9:36135400-36135422 TGCCCAACCCTGATTCAAAAGGG - Intergenic
1056127046 9:83544403-83544425 TGGCCAAAGCTGAGTCAAGCTGG - Intergenic
1057423422 9:94929656-94929678 TGGCCAATGCTGATTGATCCAGG + Intronic
1057891195 9:98871270-98871292 TGACCAAAGCTGGTCCAATCAGG + Intergenic
1192810872 X:74546301-74546323 TGGTCACAGCTGGTTAAAACTGG - Intergenic
1193868989 X:86773796-86773818 TGACAAAAGCTGATGCAAAAAGG - Intronic
1197024690 X:121734688-121734710 TGGCCACAGTTGATTGAACCAGG + Intergenic
1199545722 X:149005706-149005728 TAGCCAAAGCTGCTTCATCCGGG + Intergenic
1200476420 Y:3645837-3645859 TGGCCAGAGCTGTTTTAACCTGG + Intergenic