ID: 1150102631 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:62437671-62437693 |
| Sequence | GCCTTAAAATGTATCTGTTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 205 | |||
| Summary | {0: 2, 1: 0, 2: 2, 3: 16, 4: 185} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150102627_1150102631 | 29 | Left | 1150102627 | 17:62437619-62437641 | CCAATGAGAAACAAACTCACATA | 0: 2 1: 0 2: 2 3: 37 4: 338 |
||
| Right | 1150102631 | 17:62437671-62437693 | GCCTTAAAATGTATCTGTTATGG | 0: 2 1: 0 2: 2 3: 16 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150102631 | Original CRISPR | GCCTTAAAATGTATCTGTTA TGG | Intronic | ||