ID: 1150102631

View in Genome Browser
Species Human (GRCh38)
Location 17:62437671-62437693
Sequence GCCTTAAAATGTATCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150102627_1150102631 29 Left 1150102627 17:62437619-62437641 CCAATGAGAAACAAACTCACATA 0: 2
1: 0
2: 2
3: 37
4: 338
Right 1150102631 17:62437671-62437693 GCCTTAAAATGTATCTGTTATGG 0: 2
1: 0
2: 2
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150102631 Original CRISPR GCCTTAAAATGTATCTGTTA TGG Intronic