ID: 1150108221

View in Genome Browser
Species Human (GRCh38)
Location 17:62478006-62478028
Sequence CAGCATCCCCGCGGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150108211_1150108221 -8 Left 1150108211 17:62477991-62478013 CCTCCTTCCGGAGGGCAGCATCC 0: 2
1: 0
2: 0
3: 9
4: 153
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108204_1150108221 20 Left 1150108204 17:62477963-62477985 CCGGGGAGAGTACCTTGGGGGCA 0: 2
1: 0
2: 0
3: 13
4: 141
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108197_1150108221 30 Left 1150108197 17:62477953-62477975 CCCTGGGTGCCCGGGGAGAGTAC 0: 2
1: 0
2: 0
3: 5
4: 72
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108210_1150108221 -7 Left 1150108210 17:62477990-62478012 CCCTCCTTCCGGAGGGCAGCATC 0: 2
1: 0
2: 0
3: 8
4: 117
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108203_1150108221 21 Left 1150108203 17:62477962-62477984 CCCGGGGAGAGTACCTTGGGGGC 0: 2
1: 0
2: 0
3: 5
4: 110
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108198_1150108221 29 Left 1150108198 17:62477954-62477976 CCTGGGTGCCCGGGGAGAGTACC 0: 2
1: 0
2: 1
3: 13
4: 99
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108205_1150108221 8 Left 1150108205 17:62477975-62477997 CCTTGGGGGCAGCGCCCCTCCTT 0: 2
1: 0
2: 1
3: 18
4: 212
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245
1150108209_1150108221 -6 Left 1150108209 17:62477989-62478011 CCCCTCCTTCCGGAGGGCAGCAT 0: 2
1: 0
2: 1
3: 14
4: 140
Right 1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG 0: 1
1: 1
2: 1
3: 20
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150108221 Original CRISPR CAGCATCCCCGCGGGGGCGG GGG Intronic
900317836 1:2068288-2068310 CAGCTTCCCCTCTGGGGTGGGGG - Intronic
900375663 1:2353472-2353494 CAGCATCACCCCGAGGTCGGAGG - Intronic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900983748 1:6061106-6061128 CAGCATCCCTGCTGTAGCGGAGG - Intronic
901088340 1:6625446-6625468 CCGCATCCCCGCGGCGGGCGCGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901526015 1:9823867-9823889 CAGCGTCACGGCGGCGGCGGCGG - Exonic
902375124 1:16026913-16026935 TAGCCACCCCCCGGGGGCGGCGG + Intronic
902927917 1:19709275-19709297 TAACATCCCGGCGGGGGGGGGGG + Intronic
903373155 1:22849933-22849955 CTGCATCCCCGGGGGGTCCGGGG + Intronic
903750519 1:25617829-25617851 CGGCCTCCCCGTGGGGGCTGCGG + Exonic
903875878 1:26472732-26472754 CAGCCTCCCCGCGCGGGGGCTGG + Intronic
904424623 1:30415454-30415476 CAGCATCCTCCCGGGGGCTCTGG + Intergenic
904567256 1:31435217-31435239 CAGCAGCCCCGCGGCTGCCGTGG - Intergenic
905602490 1:39265776-39265798 TAGGATCCCCCCGGGGGCTGGGG + Intronic
905731858 1:40303628-40303650 CCGCATCCCCGCTGGGGCCAGGG + Exonic
905843453 1:41205518-41205540 CTGCATCCTCGCGGGGGGGAGGG + Intronic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
910251199 1:85200915-85200937 CAGCTTCCCCGCGGGAGCCCGGG - Exonic
912174643 1:107141113-107141135 GAGGCTCCCCCCGGGGGCGGAGG + Exonic
919640306 1:200039540-200039562 CGGCAGCCCCGAGGAGGCGGAGG + Intronic
920418277 1:205813022-205813044 CCGCTTCCACGCGGGGGAGGTGG + Exonic
920541837 1:206784652-206784674 GAGCATGGCCCCGGGGGCGGCGG + Intergenic
922596916 1:226821124-226821146 CAGCATCCCCCGGAGGGCGTGGG + Intergenic
922674628 1:227542770-227542792 CTGCCTCCCCGCGGGGGGAGCGG + Intergenic
922696948 1:227735606-227735628 CCGCATCCCCGGGGGGTGGGGGG + Intronic
1062820669 10:532272-532294 CAGCATGACTGCGGGGGTGGAGG - Intronic
1062904233 10:1169311-1169333 CAGGGTCCCAGCGGGGGTGGAGG + Intergenic
1063607219 10:7533285-7533307 CAGCATCACTGCGGGGGCGGGGG + Intergenic
1064053945 10:12081703-12081725 CAGCATCCCCACTGGAGCTGAGG + Intronic
1067478099 10:46579244-46579266 CTGCACCCCAGCGGGGGCGGCGG - Intronic
1067616641 10:47762543-47762565 CTGCACCCCAGCGGGGGCGGCGG + Intergenic
1070959233 10:80487307-80487329 CAGTATCACCGTGGGGGCGGGGG + Intronic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1072420981 10:95290633-95290655 CAGCCTCCGCGAAGGGGCGGCGG + Intronic
1073449796 10:103602619-103602641 CAGCTTCCCCGCGGGCGTGGAGG - Exonic
1076191969 10:128489488-128489510 TAGCAAGCCCGCTGGGGCGGGGG - Intergenic
1076265108 10:129103598-129103620 CAGCATCTCCACGAGGGCTGAGG + Intergenic
1076428031 10:130381234-130381256 CAGCATCACCGGCGGGGCTGTGG + Intergenic
1076683826 10:132187836-132187858 AAGCCTCCCCGCTCGGGCGGGGG + Intronic
1076770164 10:132658632-132658654 GAGCACCCCCGGGGGGCCGGCGG - Intronic
1076869662 10:133187168-133187190 CAGCGTCCCCGCGGAGGCAGCGG - Intronic
1076992101 11:280717-280739 CTGCAGCCTCCCGGGGGCGGCGG - Exonic
1079128502 11:17734838-17734860 CAGCAGCGTCGCGGCGGCGGCGG + Exonic
1080606671 11:33869769-33869791 CACCATCCCCGCGGGCGGCGCGG - Exonic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1083289169 11:61680364-61680386 CAGCGTCCCCCGGGGGGCGGAGG + Intergenic
1083762671 11:64827158-64827180 CAGCATCTCCCTGTGGGCGGAGG + Exonic
1083843003 11:65315249-65315271 CAGCATCCCCACCGGGGCTGGGG + Intronic
1084146777 11:67269192-67269214 CAGGATCACCACTGGGGCGGCGG - Intronic
1084214162 11:67638703-67638725 CTGCAGCCTCGCGGGGGAGGGGG + Intronic
1085304054 11:75475281-75475303 GAGAATCCCCCCTGGGGCGGGGG + Intronic
1085375924 11:76060843-76060865 CAGGATCCCCACGGAGGAGGGGG - Intronic
1085784781 11:79440004-79440026 CAGCAGCCCCGCACGGGCGGTGG - Intronic
1089046134 11:115503623-115503645 CAGCAGAGCCGAGGGGGCGGAGG + Intronic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089453205 11:118610796-118610818 GCGCATTCCCGCGGGGGAGGAGG + Intronic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1092460619 12:8682733-8682755 CTGCAGCCCCGCCGGGGGGGAGG + Intronic
1096105964 12:48997293-48997315 CACCAGCCCGGCGGGGGCCGCGG - Exonic
1097267754 12:57755610-57755632 CCGCAACCCCGGGGGGGCCGGGG + Exonic
1102136890 12:110583037-110583059 CCGCCTCCTCGGGGGGGCGGCGG - Exonic
1102705026 12:114873837-114873859 CAGCAGCCCCGCGTGGCCGGCGG + Intergenic
1103074260 12:117969299-117969321 CAGCCTGCTCCCGGGGGCGGCGG + Intergenic
1103377730 12:120469680-120469702 CAGCGTCCCCGCGGGCTCCGAGG + Exonic
1104929161 12:132329244-132329266 CAGCATCCCCGCCCGGGCCTGGG + Intronic
1105017419 12:132794175-132794197 CAGTATCCACGTGGGGGCTGAGG - Intronic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1108622199 13:52195413-52195435 CAGATTCCCCGCGGGCGCGCGGG + Intergenic
1109300753 13:60587551-60587573 CAGCATACCCGCTGGGGCTTCGG + Intergenic
1113798529 13:113074570-113074592 CGGGGTCCCGGCGGGGGCGGCGG + Intronic
1113891764 13:113739705-113739727 CTGCAGCCCCGCGGGAACGGAGG - Intergenic
1113942958 13:114028191-114028213 CAGCGTCATCGGGGGGGCGGGGG + Intronic
1113982046 13:114284323-114284345 CTGCATCCCAGCCGGGGCGACGG + Intronic
1114483251 14:23048049-23048071 CAGCGGCTCCGCGGGGCCGGGGG + Exonic
1114523401 14:23352579-23352601 CAGACGCTCCGCGGGGGCGGGGG + Intronic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1117647362 14:57865980-57866002 CCGCATCACAGCGGCGGCGGCGG + Intronic
1118220972 14:63853770-63853792 TAGCGCCTCCGCGGGGGCGGGGG + Intronic
1118350930 14:64972149-64972171 CAGCGTCCCCGGGCGGGCGCGGG - Exonic
1120788078 14:88554908-88554930 AAGAAGCCCCGTGGGGGCGGGGG + Intergenic
1122634346 14:103123234-103123256 CAGCAGCCGGGCAGGGGCGGGGG - Intergenic
1122658011 14:103274542-103274564 GAGAATCCCCGCGGGAGCGTGGG - Intergenic
1123036033 14:105472335-105472357 CAGCAACCCCACAGGGGCCGCGG + Intergenic
1123065803 14:105618578-105618600 CTGCAGCCCCGCGGGGGGTGAGG - Intergenic
1123069964 14:105637824-105637846 CTGCAGCCCCGCGGGGGGTGAGG - Intergenic
1123074554 14:105661492-105661514 CTGCAGCCCCGCGGGGGGTGAGG - Intergenic
1123089201 14:105734611-105734633 CTGCAGCCCCGCGGGGGGTGAGG - Intergenic
1123094987 14:105762768-105762790 CTGCAGCCCCGCGGGGGGTGAGG - Intergenic
1123473700 15:20572240-20572262 CAACATCTCTGCGGGGGTGGGGG + Intergenic
1123644309 15:22428113-22428135 CAACATCTCTGCGGGGGTGGGGG - Intergenic
1123734000 15:23167251-23167273 CAACATCTCTGCGGGGGTGGGGG + Intergenic
1124284503 15:28388562-28388584 CAACATCTCTGCGGGGGTGGGGG + Intronic
1124298194 15:28523052-28523074 CAACATCTCTGCGGGGGTGGGGG - Intronic
1124346335 15:28923870-28923892 GAGGAGCCCCGGGGGGGCGGTGG - Intronic
1124959104 15:34381935-34381957 CAACATCCCTGTGGGGGTGGGGG - Intronic
1124975730 15:34528156-34528178 CAACATCCCTGTGGGGGTGGGGG - Intronic
1127144082 15:56007187-56007209 CAGGATCCGGGCGGCGGCGGCGG + Intergenic
1128737442 15:70061205-70061227 CAGCCTCACCGTGGAGGCGGGGG - Intronic
1129038652 15:72665896-72665918 CAACATCTCTGCGGGGGTGGGGG + Intronic
1129185602 15:73904309-73904331 CTGCATGCCTGCGGGGGCTGGGG - Intergenic
1130302744 15:82692396-82692418 CAGCGTCCCCGCGGGCTCTGAGG + Intronic
1131188644 15:90295237-90295259 CAACATCTCTGTGGGGGCGGGGG + Intronic
1132637631 16:960190-960212 AAGCATCCCTGCGGGGAAGGAGG + Intronic
1132652473 16:1027902-1027924 CGGCATGCCCTCGGGGGAGGAGG + Intergenic
1132934696 16:2474574-2474596 CTGCAGCCCCACGAGGGCGGCGG + Intergenic
1133464858 16:6019500-6019522 CAGCACCCGCGGTGGGGCGGGGG + Intronic
1134240510 16:12502521-12502543 CAGCTTCCCCACGGTGGCCGGGG + Intronic
1135727670 16:24869582-24869604 CAGTATCCCTGCGGGGGTCGGGG - Intronic
1136654180 16:31699896-31699918 CAGCAGCCCCACGTGGGCAGTGG - Intergenic
1137583874 16:49652162-49652184 CAGCAGCCATGTGGGGGCGGGGG - Intronic
1137788534 16:51155369-51155391 CAGCGGCGCCCCGGGGGCGGGGG + Intergenic
1138023429 16:53503951-53503973 CAGCATCCGAGTGGGGGCCGGGG + Intronic
1138360787 16:56425560-56425582 CAGCGTCCCGCTGGGGGCGGCGG - Intergenic
1138379355 16:56589627-56589649 CAGGATGCGAGCGGGGGCGGGGG - Intronic
1139546889 16:67653661-67653683 CTGCAAGCCCGCGGGGGCAGCGG + Intronic
1141712899 16:85710189-85710211 CATCATGCCCGTGGGGGTGGGGG + Exonic
1142120464 16:88384020-88384042 CAGGTCCCCGGCGGGGGCGGGGG + Intergenic
1142298323 16:89241348-89241370 CAGCAGCCCGGCGGGAGCCGCGG + Intergenic
1143030452 17:3964446-3964468 CAGCATCCTGGCGCGGGCCGGGG - Intronic
1146792875 17:35762728-35762750 CAGCATCTCCGCTGGTGGGGTGG - Intronic
1147200631 17:38799385-38799407 CAGCACCACGGCGGTGGCGGTGG - Exonic
1147393446 17:40123166-40123188 CAGGGTCCCGGCGGTGGCGGTGG - Intronic
1147705287 17:42421784-42421806 CCGCATGCCTGCGGGGGCGGGGG - Intronic
1147985850 17:44307719-44307741 CAGCTTCTCCCCGGGGGTGGGGG - Intergenic
1148110960 17:45144465-45144487 CCGCGTCCCCGACGGGGCGGCGG - Intergenic
1148764033 17:50027245-50027267 CAGCAGCCCCGCGGGGGTGCCGG + Intergenic
1149599622 17:57885165-57885187 CAGCATCCCCCCGGAGGTAGGGG - Intronic
1149599641 17:57885222-57885244 CAGCATCCCCCCGGAGGTAGGGG - Exonic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150848984 17:68686795-68686817 CGGCATCCCAGCGGGGCAGGGGG + Intergenic
1151766567 17:76136158-76136180 CAGCATCCCCGGGGAGGAAGGGG - Intergenic
1151979335 17:77499385-77499407 CTGCAGCCCGGTGGGGGCGGGGG - Exonic
1152245706 17:79183556-79183578 CAGCCTCCCCGCCCGGGCAGGGG - Intronic
1153480554 18:5543276-5543298 AAGCATCCCCGCTGGGCAGGGGG - Intronic
1155096374 18:22559813-22559835 CCGGACGCCCGCGGGGGCGGGGG + Intergenic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1157610666 18:48952865-48952887 CAGCATCCCGGCGGGAGAAGGGG + Intergenic
1158877259 18:61745237-61745259 CAGCAACTCTGAGGGGGCGGTGG - Intergenic
1159797896 18:72867003-72867025 CAGGAACCCCCCGGGGGTGGAGG - Intronic
1160499850 18:79396208-79396230 TGGCATCCGCGCGGCGGCGGCGG - Exonic
1160568548 18:79801352-79801374 GAGGATCCCCTCGGGGGAGGAGG - Intergenic
1160680351 19:409233-409255 CCCCCTTCCCGCGGGGGCGGGGG - Intergenic
1160807782 19:1000295-1000317 CAGCAACCGCGCGGGGGGAGTGG - Intergenic
1160872947 19:1285490-1285512 CAGTCTCCCTGCGGGGGCCGGGG - Intergenic
1160895824 19:1401410-1401432 CTGCAGCCCCGCGTGGGGGGCGG - Exonic
1161069150 19:2251857-2251879 CAGCTTGCCCGCGTAGGCGGTGG - Exonic
1161087790 19:2343175-2343197 CAGCATCCTCGCCGGGGCAGAGG - Intronic
1161139428 19:2638731-2638753 CAGCATCCCCTGGGGAGGGGAGG + Intronic
1161659983 19:5539957-5539979 CAGCAGCCCTGCGGTGGGGGTGG + Intergenic
1161667474 19:5586005-5586027 TAACTTCCCAGCGGGGGCGGGGG + Intergenic
1162479859 19:10921808-10921830 AAGCCGCCCGGCGGGGGCGGCGG - Exonic
1163163527 19:15479915-15479937 CAGCATCGGTGCGGGGGCTGAGG + Intronic
1163701841 19:18790107-18790129 CTGCATCCCTGCGGGGGGGAGGG + Exonic
1164544159 19:29145245-29145267 CAGAATCCCCTGGGGGGCTGAGG - Intergenic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
1166486807 19:43220852-43220874 CAGCAACCCCGCGGAGGATGAGG - Intronic
1166493919 19:43284299-43284321 CAGCAACCCCGCGGAGGATGAGG - Intergenic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1167557172 19:50203687-50203709 CGGCAGCCCTCCGGGGGCGGCGG + Intronic
1168175241 19:54623852-54623874 CACCCTCCCTGCGGGGCCGGGGG - Intronic
925276670 2:2654217-2654239 CAGCATCCCTGCTGGAGAGGGGG - Intergenic
926724018 2:15983636-15983658 CAGGACCCCAGCGGGGGAGGTGG - Intergenic
930011452 2:46941147-46941169 CTCCACCCCCGCGGGGGCGTGGG - Intronic
931671877 2:64654407-64654429 CAGGGTCCCCGCGGGGGGCGAGG + Intronic
932675802 2:73779940-73779962 CATCATCCCCGCAGTGGCTGGGG - Exonic
933728149 2:85437904-85437926 CAGGAACCCCGCGGGGGATGGGG + Intergenic
934846372 2:97663710-97663732 CAGCGGCCCGGCGGGGGCGACGG + Intronic
935746576 2:106194355-106194377 AAGCAGGCGCGCGGGGGCGGGGG - Intergenic
937866401 2:126754472-126754494 CAGCATCCCAGCTGGGACAGAGG + Intergenic
938904369 2:135824713-135824735 CAGCAGCCCAGCGGGTGTGGTGG + Intronic
946410693 2:219513807-219513829 CAGCCTCCCAGAGGGGGCAGGGG + Intergenic
948148950 2:235729471-235729493 CAGCATCCTCCTGGGGGAGGGGG - Intronic
948874336 2:240819134-240819156 CAGCATCCCCGCCGGGAGGGAGG - Intronic
948893245 2:240917008-240917030 CAGCAGCCCAGTGGGGGAGGGGG - Intergenic
1169042594 20:2508470-2508492 CAACATCCCCGCGGCTGGGGTGG - Intronic
1169107596 20:3010339-3010361 CAGCATCCAGCCGGGTGCGGTGG + Intronic
1173279684 20:41617857-41617879 CAACTTCTCCGCGGGGGCGGCGG + Intronic
1175747097 20:61464785-61464807 CAGCATCCACTGGGGGGTGGAGG + Intronic
1179329608 21:40386453-40386475 CAGCGGCCCGGCGTGGGCGGCGG - Intronic
1180131046 21:45827270-45827292 CACCATCGCAGCGGGGGCAGAGG - Intronic
1180703387 22:17794069-17794091 CAGCATCACAGAGGGGGCGGGGG + Intronic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182586686 22:31347374-31347396 TAGCATCCCCGGGCGGGCCGGGG - Intergenic
1184390677 22:44201428-44201450 ATGCATCCCCGTGGGGGCGAGGG - Intronic
1184401969 22:44279696-44279718 CAGGAGCCCAGCAGGGGCGGGGG - Intronic
1185397709 22:50601101-50601123 CAGAATCCCGGCGGGGCCCGGGG - Intronic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
951558884 3:23946122-23946144 GTGCAACCCCGCGGGGGAGGAGG - Intronic
951564115 3:23995652-23995674 CAGCATCCCCAAGGGGCGGGTGG - Intergenic
951981973 3:28575984-28576006 GCGCATCCCGGCGGCGGCGGCGG - Intergenic
953165028 3:40457412-40457434 CAGCTTCCCAGCGGAGGTGGAGG - Exonic
961536683 3:127575147-127575169 CGGCAGCCACGCGGGGGCGCCGG + Intronic
961795120 3:129403610-129403632 CAGCATCCCTGCAGAGGCAGGGG - Intronic
964497183 3:157303853-157303875 CAGAACCCCAGTGGGGGCGGAGG - Intronic
965590829 3:170358308-170358330 CCGCCCCCCCGCGGGGGCCGCGG - Intronic
968084491 3:195868278-195868300 CAGCACCCTCGTGGGCGCGGGGG - Exonic
968479399 4:826658-826680 CAGGGTCCGCGCGGGGCCGGTGG + Intergenic
968575069 4:1362227-1362249 CCGCCTCCCCGCGGTGGCTGGGG + Intronic
969470201 4:7383079-7383101 CAGCAGCCCCGCGGGGCATGAGG - Intronic
970438198 4:16056123-16056145 GAGCATCCTCGTGGGGGCTGTGG + Intronic
971158633 4:24109911-24109933 CAGCATCCCCACAGAGGAGGTGG + Intergenic
974047291 4:56908406-56908428 CAGCAGCCGCCCGGGGGCTGGGG + Intronic
975552849 4:75630831-75630853 TAGCATCGCCGCTGGGGCAGGGG + Intergenic
976390028 4:84497758-84497780 CAGCAGCCCCGCCGGGGATGAGG + Exonic
977964173 4:103124151-103124173 TGGCATCCCCTCGGGGGTGGGGG + Intronic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
982712209 4:158768950-158768972 CCGCAGCCCCACGGCGGCGGCGG - Intergenic
985574834 5:669253-669275 CAGCATCCCCCAGGGGGCGCTGG + Intronic
985782096 5:1876731-1876753 CCCCATCCCCGCGGCGGAGGCGG - Intergenic
986297053 5:6448630-6448652 CAGCAGCACCCCGGGGGCGCGGG + Exonic
986311141 5:6551935-6551957 CAGCATGGGGGCGGGGGCGGGGG - Intergenic
989379270 5:40797897-40797919 CCGCAGCCCCGCGGCGGCTGGGG + Intronic
990382919 5:55233467-55233489 CCGCCTCCCCGCTCGGGCGGCGG + Exonic
991967669 5:72108293-72108315 CAGCATCTCCCCGGGGAGGGGGG - Intronic
995106250 5:108381039-108381061 AAGCAGCCCCGCTGCGGCGGCGG - Exonic
995764679 5:115602366-115602388 GAGCGGCCCCTCGGGGGCGGCGG - Exonic
997382639 5:133448716-133448738 CAGAATCCCCAGGGGTGCGGGGG + Intronic
997897842 5:137735917-137735939 CAGCAAGCCTGCGGGGGAGGGGG - Exonic
999273083 5:150309394-150309416 CAGCATCCCAGCGTGGCAGGGGG - Intronic
1001599409 5:172919319-172919341 TTGCATCTCCCCGGGGGCGGGGG - Intronic
1002041974 5:176521221-176521243 CAGCCTCCCCGCGGGAGGGATGG - Intergenic
1002055827 5:176597468-176597490 CAGCGCCCCCGCCGGGGCCGCGG - Exonic
1002888691 6:1316758-1316780 CAGCAGCCTCGCGGTGGCGGTGG + Intergenic
1003624097 6:7727062-7727084 CAGCTGCCCCCCGGCGGCGGCGG - Exonic
1003964641 6:11241591-11241613 CAGCATAGCTCCGGGGGCGGAGG + Intronic
1004044475 6:12011847-12011869 GGGCGTCCCCGCGGGGGCTGGGG - Intronic
1006369176 6:33633736-33633758 TCGCTTCGCCGCGGGGGCGGGGG + Intronic
1007614278 6:43171372-43171394 CAGCGTCCCCCGGGGGGCAGGGG - Exonic
1009431559 6:63572271-63572293 GAGCATCCCCGGGGCGGGGGAGG - Exonic
1009540804 6:64955737-64955759 CAACGTCCCCGGGGGAGCGGGGG + Intronic
1013273662 6:108562831-108562853 CAGCAGCCCAGCAGGGGCAGAGG - Intronic
1013393697 6:109713299-109713321 CAGCATGGCTGAGGGGGCGGGGG + Intronic
1014871756 6:126604451-126604473 CAGCATCCCCGCAGTGGGGGTGG - Intergenic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1017672493 6:156779560-156779582 CCGTCTTCCCGCGGGGGCGGCGG + Intronic
1017793898 6:157823873-157823895 CACCCGCCCCGCGGGGGCGAGGG - Intronic
1017978206 6:159376062-159376084 CACCATCCCTGCTGGGGAGGAGG + Intergenic
1018652900 6:166006139-166006161 CAGCAGCCGCGGGCGGGCGGGGG - Intergenic
1018774212 6:166998863-166998885 CTGCAGCCCCGGGGGGGCGCCGG - Intergenic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1024579918 7:50793241-50793263 CCGCAGCCACGCGGAGGCGGCGG - Intronic
1029927010 7:104328805-104328827 GAGCATCGCGGCGGCGGCGGCGG - Exonic
1032037269 7:128530540-128530562 CAGCATCCCGGCGGGGGCGGGGG + Intergenic
1033220529 7:139524040-139524062 CAGCAGCCCCTCGGGGCCGCGGG - Exonic
1037059146 8:14485271-14485293 CTGCATTCCAGCGGGGGCAGGGG - Intronic
1037977753 8:23225240-23225262 CGGCATCCACGCGGCGGCCGTGG - Intergenic
1039439005 8:37581693-37581715 CAGCATCCCCGCAGAGACAGTGG - Intergenic
1039963988 8:42270963-42270985 AATCATCCCAGCGGGGGCGCGGG + Intergenic
1048980936 8:139703207-139703229 CAGCCGCCTCGCGGTGGCGGTGG - Intergenic
1049214792 8:141402626-141402648 CAGCCTCCCCATGTGGGCGGGGG - Intronic
1049371551 8:142270283-142270305 CAGCCTCCCTGCGGGGGCCTGGG - Intronic
1049462573 8:142736966-142736988 CACCATCCATGCAGGGGCGGAGG + Intergenic
1049697231 8:143990265-143990287 CAAGATCCGCGTGGGGGCGGGGG - Exonic
1049756727 8:144314110-144314132 CTGCTTCCCTGCGGGGGTGGGGG - Exonic
1049762193 8:144336645-144336667 CCCCATGCCCCCGGGGGCGGCGG + Intergenic
1057489150 9:95508375-95508397 CTCCGTCCCCGCGGCGGCGGCGG - Exonic
1058053353 9:100427419-100427441 CCGCAGCCGGGCGGGGGCGGGGG + Intronic
1060480027 9:124012332-124012354 CAGCATCGCGGCGGGACCGGCGG - Exonic
1060855808 9:126914594-126914616 CAGCATCCCTGCGGGCGGGGAGG + Intergenic
1061235951 9:129342740-129342762 CAACATCCCCGGGAGGGGGGTGG + Intergenic
1061236249 9:129344236-129344258 CAACATCCCCGGGAGGGGGGTGG + Intergenic
1062284808 9:135768229-135768251 CAGGATGCCTGCGGGGGGGGGGG + Intronic
1062389229 9:136327466-136327488 CCCCCTCCCCGCGCGGGCGGCGG + Exonic
1062402449 9:136378500-136378522 CAGCAGCCCTGCGGGGCCAGGGG + Exonic
1062565089 9:137160813-137160835 CTGCAGCCCCGGGGGGGTGGGGG - Intronic
1192274598 X:69616349-69616371 CAGCAGCGCCGCGGGAGCGAGGG + Exonic
1202197376 Y:22308716-22308738 CTGCAGGCCCGCAGGGGCGGAGG + Intergenic