ID: 1150108507

View in Genome Browser
Species Human (GRCh38)
Location 17:62478895-62478917
Sequence GTGCGGCGCGGAGGGCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 1, 2: 12, 3: 85, 4: 977}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150108507_1150108531 25 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108531 17:62478943-62478965 CCCCACCTCCTGGCCCGGCCTGG 0: 2
1: 1
2: 8
3: 78
4: 744
1150108507_1150108528 20 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108528 17:62478938-62478960 CGGGCCCCCACCTCCTGGCCCGG 0: 2
1: 1
2: 4
3: 101
4: 1287
1150108507_1150108521 1 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108521 17:62478919-62478941 CGAGTGGCCCCCAGCCGAGCGGG 0: 3
1: 0
2: 1
3: 6
4: 89
1150108507_1150108520 0 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108520 17:62478918-62478940 CCGAGTGGCCCCCAGCCGAGCGG 0: 3
1: 0
2: 0
3: 9
4: 84
1150108507_1150108527 15 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108527 17:62478933-62478955 CCGAGCGGGCCCCCACCTCCTGG 0: 2
1: 0
2: 2
3: 32
4: 451
1150108507_1150108533 26 Left 1150108507 17:62478895-62478917 CCCCCCCGCCCTCCGCGCCGCAC 0: 1
1: 1
2: 12
3: 85
4: 977
Right 1150108533 17:62478944-62478966 CCCACCTCCTGGCCCGGCCTGGG 0: 2
1: 0
2: 5
3: 52
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150108507 Original CRISPR GTGCGGCGCGGAGGGCGGGG GGG (reversed) Intronic
900101658 1:964611-964633 GTGCTGCGGGGAGGGGGGCGCGG + Intronic
900116029 1:1028323-1028345 GTGCAGGGCGGGGGGGGGGGGGG - Intronic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900161005 1:1223788-1223810 GGGTGGGGCGGTGGGCGGGGCGG - Intronic
900227521 1:1540107-1540129 GAGGGGAGCGGAGGCCGGGGTGG + Intronic
900314657 1:2050734-2050756 GTGAGGCAGGGAGGGCGGGGAGG + Intronic
900344595 1:2204955-2204977 GTGGCGCCCGGGGGGCGGGGCGG - Intronic
900382559 1:2392043-2392065 GGGCCGCGCTGAGGGCCGGGCGG + Intronic
900418692 1:2546407-2546429 GCGCGGGGCGGAGGGCGGCCGGG - Intergenic
900763762 1:4489691-4489713 GGGCGGAGTGGAGGGCTGGGTGG + Intergenic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901255983 1:7827268-7827290 GTGCGGAGAGGAGGCCGCGGAGG - Exonic
901489408 1:9589063-9589085 GGGCGGCGCAGAGGGCCGCGTGG - Intronic
901540107 1:9910134-9910156 GTCCGGCGCGCAGCGCGCGGCGG + Exonic
901636394 1:10672215-10672237 GTGCGGAGGGGAGGGGGTGGCGG - Intronic
901659857 1:10792328-10792350 GTGCGGGGCCGGGGGGGGGGGGG - Intronic
902412095 1:16217639-16217661 GAGGGGCGCGGCGGGAGGGGCGG - Intergenic
902444390 1:16452769-16452791 GGGCGGGGCGGCGGGCGGGGGGG - Intronic
902476987 1:16693478-16693500 TTGCGGCGCGGACAGCGCGGGGG + Intergenic
902509975 1:16961140-16961162 GTGCCGCGCGCAGGGAAGGGGGG + Intronic
902772180 1:18651814-18651836 GTGGGGTGGGGGGGGCGGGGAGG - Intronic
903136520 1:21313095-21313117 GTGGGGCGCAGAGGGCAGAGTGG - Intronic
903233804 1:21937126-21937148 GTGCGGGGCAGAGGGGCGGGGGG - Intronic
903468398 1:23568214-23568236 GGGCTGCGCGGGGGGCGGAGAGG - Intergenic
903777071 1:25800161-25800183 GGGCGGGGCCGGGGGCGGGGCGG - Exonic
903777832 1:25804642-25804664 TTGCGGCGGGGGGGGGGGGGCGG - Intronic
903785542 1:25859024-25859046 GAGCGGTGCGCAGGGAGGGGCGG - Intronic
904128856 1:28260678-28260700 GAGCGGCGCGAAGGGAGGGTGGG - Intronic
904463272 1:30693032-30693054 GGGAGGAGCGGAGGCCGGGGTGG - Intergenic
904756317 1:32770668-32770690 GTCCGGCGGGGAGGGGGTGGAGG - Exonic
904944241 1:34187767-34187789 GGGCGGCGGGGGGGGGGGGGTGG - Intronic
904944244 1:34187772-34187794 GTGGGGGGCGGCGGGGGGGGGGG - Intronic
905028314 1:34865854-34865876 GTGAGGGGCGCAGGGCGGAGAGG + Exonic
905202501 1:36323656-36323678 GCGGGGCGGGGCGGGCGGGGAGG + Intronic
905249023 1:36636280-36636302 GAGCAGCAGGGAGGGCGGGGAGG - Intergenic
905399876 1:37693226-37693248 TTGGGGGGCGGCGGGCGGGGCGG + Intronic
905449319 1:38046745-38046767 GCGCGGCGCAGGGCGCGGGGCGG - Exonic
905655478 1:39683863-39683885 GAGCAGCGCGGAGGCAGGGGCGG + Intronic
905912247 1:41662698-41662720 GGCGGGCGCGGAGGGAGGGGCGG - Intronic
906290674 1:44617548-44617570 GTTCAGCGGGGAGCGCGGGGAGG + Intronic
906517508 1:46448320-46448342 GGGAGGCGCGGCAGGCGGGGCGG - Intergenic
906616415 1:47235621-47235643 GGGTGGCGAGGAGGGAGGGGAGG + Intergenic
906942816 1:50271303-50271325 GTGGGGGGCGGGGGGCGGGGTGG - Intergenic
907069180 1:51518929-51518951 CAGCGGCGCGGAGGGCGGCGAGG + Intronic
907118581 1:51990196-51990218 GAGCTGCGAGGAGGGCGGAGTGG - Intronic
907278309 1:53328802-53328824 GTGGGGCGGGCCGGGCGGGGGGG + Intergenic
907364120 1:53945829-53945851 GGGCGGGGCTGAGGGCAGGGCGG - Exonic
910549723 1:88462684-88462706 GGGCGGCGCGGGGAGCGGGCAGG - Intergenic
911081688 1:93939264-93939286 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
911178930 1:94843867-94843889 GTGGGGCGGGGTGGGGGGGGTGG + Intronic
911902656 1:103525510-103525532 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902663 1:103525527-103525549 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902670 1:103525544-103525566 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902677 1:103525561-103525583 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902684 1:103525578-103525600 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902691 1:103525595-103525617 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902698 1:103525612-103525634 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902705 1:103525629-103525651 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911902712 1:103525646-103525668 GGGCGGGGCGCACGGCGGGGCGG - Intergenic
911930424 1:103895900-103895922 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
912431475 1:109630470-109630492 GTGGGGGGCGGTGGGGGGGGCGG + Intronic
912831310 1:112956276-112956298 GTGTGGCGGGGAGGGGGCGGCGG - Intronic
912993427 1:114510899-114510921 GGCCGGCGCTGAGGGCGGCGCGG - Exonic
913477586 1:119253118-119253140 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
913485180 1:119327366-119327388 GTGCGGGGAGGGGGGCGCGGTGG - Intergenic
914197335 1:145454426-145454448 GGGCGGCGGGGCCGGCGGGGCGG - Intergenic
915099811 1:153491169-153491191 GTGCTGAGTGGGGGGCGGGGAGG - Intergenic
915224984 1:154405526-154405548 GGGCGGGGCGGTGGGCGGGCAGG - Exonic
915302845 1:154961502-154961524 GGGCGGCGCAGGGGGCGGTGCGG + Exonic
915485378 1:156216645-156216667 GGGCGGCGGGGAAGGCGGCGAGG + Intronic
918229578 1:182515559-182515581 GGGCGGGGTGGAGGGCGTGGGGG + Intronic
918487523 1:185045445-185045467 GCGCTGCGGGGAGGGCGGGAAGG - Exonic
919723644 1:200866985-200867007 GTGGGGGGCGGGGGGCGGGGAGG - Intergenic
919789760 1:201283621-201283643 GTGCGGTGCAGCGGGCGGGCAGG - Exonic
919989363 1:202698433-202698455 GAGTGAAGCGGAGGGCGGGGAGG - Intronic
920135987 1:203769770-203769792 GTGCGGGGGGGGGGGCGGCGGGG + Intronic
920367728 1:205456922-205456944 GGGGGGCGCGGAGGGCGGGGTGG - Intergenic
920385659 1:205568959-205568981 CCGCGGCGGGGAGGGAGGGGCGG - Exonic
920461718 1:206145688-206145710 GAGCGGGGCGGAGGGGGGAGTGG + Intergenic
920491203 1:206416762-206416784 GTGGGGCAGGGAGGGGGGGGCGG - Intronic
920605437 1:207378863-207378885 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
920805620 1:209231585-209231607 GGGCGGGGCGCAGGGCGGCGCGG - Intergenic
921189823 1:212699605-212699627 GCGCGCCGCGGGGGGCGAGGAGG - Intronic
921355601 1:214281541-214281563 GGGCGGGGTGGGGGGCGGGGAGG + Intronic
922130474 1:222772243-222772265 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
922196614 1:223364635-223364657 AGGCCGCGCGGAGGCCGGGGCGG - Intergenic
922440717 1:225653217-225653239 GGGCGGTGCGGGGGGAGGGGAGG + Intergenic
922586718 1:226738812-226738834 GAGCGGCCCGGAAGGCGGGTAGG + Intronic
923485257 1:234423606-234423628 GTGCTGCGTGGAGGACGAGGAGG - Intronic
923506497 1:234609893-234609915 GGCCGGCACGGAGTGCGGGGCGG + Intergenic
923506506 1:234609905-234609927 GTGCGGGGCGGGGGGCGGGGAGG + Intergenic
923506512 1:234609914-234609936 GGGGGGCGGGGAGGCCGGGGGGG + Intergenic
924539848 1:244970622-244970644 GGGCGGAGCGGCGGGCCGGGCGG - Exonic
924801432 1:247331737-247331759 GCGGGCCGAGGAGGGCGGGGCGG + Exonic
924820730 1:247487784-247487806 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
1062774672 10:135435-135457 GACGGGCGCGGGGGGCGGGGGGG - Intronic
1062932594 10:1362976-1362998 GGGCGGCGCTGGGGGCGCGGGGG - Intronic
1063624286 10:7675019-7675041 GTGTGGGGGGGGGGGCGGGGGGG - Intergenic
1063994969 10:11611173-11611195 GCGCCGCGCGGGGTGCGGGGAGG - Intronic
1064244311 10:13657137-13657159 GGGGGGCGCGGGGGGCGCGGGGG - Exonic
1064418245 10:15168744-15168766 GGGCGGGACGGAGGGCGGGACGG - Intergenic
1064418256 10:15168767-15168789 GGGCGGGACGGAGGGCGGGGAGG - Intergenic
1064552777 10:16520443-16520465 GGGCGGCGGGGAGGGCGGGGAGG - Intronic
1065100396 10:22325634-22325656 GTGCGGGGCGGCGGGCGGGCGGG - Intronic
1066022645 10:31319134-31319156 GTGCGGTGGGGAGGGGGGAGGGG + Intronic
1067085933 10:43238088-43238110 TTGGGGGGCGGAGGGAGGGGGGG + Intronic
1067478194 10:46579586-46579608 GTGCGACGCGGTGGACGAGGTGG - Intronic
1067616545 10:47762201-47762223 GTGCGACGCGGTGGACGAGGTGG + Intergenic
1068088504 10:52404240-52404262 GTGGGGTGCGGAGAGGGGGGAGG - Intergenic
1068191069 10:53653943-53653965 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
1069438554 10:68407344-68407366 GAGCGGCGCCCCGGGCGGGGCGG + Intergenic
1069887923 10:71635573-71635595 CTGCGGAGAGGAGGGAGGGGAGG + Intronic
1071792568 10:88970718-88970740 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1071997654 10:91163258-91163280 GTGCGGGCCGGTGGGCGGCGCGG + Intronic
1072784025 10:98268316-98268338 GCGCCGCGCGGAAGGCCGGGCGG - Intergenic
1073098619 10:100995728-100995750 GTGCAGCGGGTAGGGCTGGGGGG - Intergenic
1073403460 10:103277131-103277153 GTGCGGCAGGCAGGGCGCGGCGG - Intergenic
1073583483 10:104687724-104687746 GTGGGGAGCGGAGGGCTGGAAGG + Intronic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074405471 10:113177150-113177172 GGGCGGAGGGGAGGGCCGGGTGG - Intergenic
1074721952 10:116271902-116271924 TTTTGGTGCGGAGGGCGGGGTGG + Intronic
1075032170 10:119030621-119030643 CTGCGGGGCGGCGGGCGGGCGGG - Exonic
1075801765 10:125159152-125159174 CGGCGCCGCGGAGGGCTGGGAGG + Intronic
1076464060 10:130666390-130666412 TTGGGGTGCAGAGGGCGGGGTGG + Intergenic
1076722305 10:132397955-132397977 GTGGGGGGCGCAGGGCAGGGCGG + Intronic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076792863 10:132786063-132786085 GCGGGGCGCGGGGGGCGGGCGGG + Intergenic
1076856289 10:133116918-133116940 GTTCGGGACAGAGGGCGGGGAGG + Intronic
1076878764 10:133230134-133230156 GCGGGGCGCGCGGGGCGGGGCGG + Intergenic
1076989905 11:267467-267489 GAGGGGCGAGGAGGGAGGGGAGG + Intergenic
1077008316 11:369379-369401 GCGGGGCGCGGGGTGCGGGGCGG - Intergenic
1077008504 11:369955-369977 GTACGGCGCGGGGGGCGCGGGGG + Intronic
1077008509 11:369964-369986 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1077008524 11:369991-370013 GGGCGGCGCGGGGGGCGCGGGGG + Intronic
1077010196 11:376197-376219 GCGGGGCGGGGTGGGCGGGGCGG + Intronic
1077014135 11:392556-392578 GGGGGCCTCGGAGGGCGGGGTGG - Intergenic
1077048118 11:555130-555152 GAGAGGCGCGCGGGGCGGGGCGG + Intronic
1077062539 11:624182-624204 GTGGGGCGGGGAGAGCGGGGCGG + Intronic
1077063321 11:627033-627055 GTGGGGCCCGGGGGGCGGGCGGG + Intronic
1077152374 11:1078043-1078065 GTGAGGCCCGGAGGGCTTGGAGG + Intergenic
1077176705 11:1194376-1194398 GTGTGCCGCGGAGGGGGTGGGGG + Intronic
1077197135 11:1287401-1287423 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197140 11:1287415-1287437 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197146 11:1287429-1287451 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197151 11:1287443-1287465 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197157 11:1287457-1287479 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197162 11:1287471-1287493 GTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197168 11:1287485-1287507 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197192 11:1287555-1287577 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197197 11:1287569-1287591 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197203 11:1287583-1287605 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197208 11:1287597-1287619 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197219 11:1287625-1287647 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197224 11:1287639-1287661 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197230 11:1287653-1287675 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197235 11:1287667-1287689 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197258 11:1287737-1287759 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197263 11:1287751-1287773 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197269 11:1287765-1287787 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197284 11:1287807-1287829 GTGCGGCGGGGAGGCTGCGGCGG - Intronic
1077197289 11:1287821-1287843 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077204663 11:1336696-1336718 GCGGGGCGGGGCGGGCGGGGGGG + Intergenic
1077204675 11:1336718-1336740 GCGGGGCGTGGAGGGCGGGGGGG + Intergenic
1077204726 11:1336813-1336835 GCGGGGCGTGGAGGGCGGGGGGG + Intergenic
1077228952 11:1450243-1450265 GGGCGGCTCGGGGGGCGGTGGGG - Intronic
1077322062 11:1947049-1947071 GTGGGGCCGGGAGTGCGGGGCGG + Intergenic
1077491497 11:2862909-2862931 GCGCGGCGCGGTGGGGGCGGCGG + Intergenic
1077923115 11:6655905-6655927 CGGCGGCGCGGAGCGCGGGTGGG - Intergenic
1078317562 11:10305601-10305623 GCGGGGCACGGAGGGCGGGCAGG - Exonic
1078363012 11:10684456-10684478 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1079437531 11:20472865-20472887 GTGGGGGGTGGAGGGTGGGGAGG + Intronic
1080034893 11:27700527-27700549 GCGGGGGGCGGGGGGCGGGGGGG - Intronic
1080045787 11:27806319-27806341 GAGCGGCGTGCGGGGCGGGGCGG - Intergenic
1080727909 11:34916218-34916240 ATGCGGCGCGCAGGTAGGGGCGG - Exonic
1080746437 11:35112381-35112403 GTGTGGCTGGGAGGGCGGGGAGG - Intergenic
1081039961 11:38197723-38197745 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1081774049 11:45665698-45665720 GGGCGGCGCGGGGGGCGGGAAGG - Intergenic
1081805019 11:45885767-45885789 GCGCGGCGCGGAGGAGGCGGCGG - Exonic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1082787381 11:57324505-57324527 GCGCGGCCCGGAGGAAGGGGAGG + Intronic
1083227756 11:61295308-61295330 GAGAGGCGCGGAGCCCGGGGCGG + Exonic
1083315926 11:61815157-61815179 GTGTGGGGCGGGGGCCGGGGCGG + Intronic
1083329819 11:61892104-61892126 CTGCAGCGCCGAGGGCGGAGGGG - Intergenic
1083849088 11:65354962-65354984 GTGCGGAGCGGGAGGCCGGGCGG + Intronic
1083922692 11:65788961-65788983 GTGGAGGGCGGAGGGCGGAGCGG - Intronic
1084151345 11:67289296-67289318 GGGCGGCAGGGAGGGCGGGGCGG - Exonic
1084171271 11:67401965-67401987 GTGAGGCGCGGCGGCCCGGGGGG + Intronic
1084471902 11:69367210-69367232 GAGCGGGGCGGAGGGTGGTGGGG + Intronic
1084621341 11:70271803-70271825 GTGGGGTGGGGAGGGTGGGGGGG - Intronic
1085522784 11:77147995-77148017 GTGGGGCGAGGTGGGCGGGGCGG - Intronic
1085615514 11:77994980-77995002 GCGCGGCGCGAAGGGAGGGAGGG + Intergenic
1085700352 11:78740360-78740382 GTGAGGTGAGGAGGGTGGGGTGG - Intronic
1086348561 11:85922343-85922365 GTGTGGGGCGGCGGGGGGGGGGG + Intergenic
1088932736 11:114368476-114368498 GGGTGGCGGGGGGGGCGGGGGGG - Intergenic
1089496436 11:118910595-118910617 GTGCAGGGCGGGGGGAGGGGAGG - Exonic
1089729642 11:120512049-120512071 GAGCGGGGAGGAGGGCGCGGGGG - Intronic
1089815643 11:121172330-121172352 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1090233795 11:125131160-125131182 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1091238562 11:134037384-134037406 CTGCGCCGCGGAGGGGAGGGCGG + Intergenic
1091286689 11:134412085-134412107 GCGGGGGGCGGGGGGCGGGGAGG + Intergenic
1202805078 11_KI270721v1_random:2362-2384 GTGGGGCCGGGAGTGCGGGGCGG + Intergenic
1091740916 12:2959800-2959822 GAGCGGAGCGGAGCGCGCGGAGG - Intronic
1091915334 12:4269200-4269222 GCGAGGGGCGGGGGGCGGGGAGG + Intergenic
1092383790 12:8019672-8019694 GTGGGGCGGGGTGGGGGGGGCGG + Intergenic
1092385362 12:8032670-8032692 GAGGGGCGCGGAGCGCGGCGCGG + Intergenic
1092385367 12:8032682-8032704 GCGCGGCGCGGAGGCCGGGGAGG + Exonic
1092487442 12:8914666-8914688 CGGGGGCGCCGAGGGCGGGGTGG - Exonic
1092861910 12:12725668-12725690 GCGCGGCGCGCGAGGCGGGGAGG - Intergenic
1092968493 12:13669005-13669027 GTGGGGAGGGGAGGGAGGGGAGG + Intronic
1093285365 12:17253240-17253262 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1093894685 12:24562732-24562754 GTGCGGCGGGGGCGGGGGGGGGG + Intergenic
1094097178 12:26719745-26719767 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1094842075 12:34346364-34346386 ATGCGGCAGGGAGGGCGTGGGGG + Intergenic
1095672374 12:44876267-44876289 GGGCGGCGGGGAAGACGGGGGGG - Intronic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1095958534 12:47819722-47819744 GTGCCGCGCGCAGGGCGGGGCGG + Intronic
1096278293 12:50229543-50229565 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1096337124 12:50764658-50764680 GAGCCGGGCGGAGGGCGGCGCGG + Intronic
1096544423 12:52327969-52327991 GTACAGCACGGAGGGTGGGGTGG - Intergenic
1096634313 12:52948956-52948978 GGGCTGCGCGGAGGGCGCGGGGG + Exonic
1096946730 12:55414975-55414997 CGGGGGCGCCGAGGGCGGGGTGG + Intergenic
1096981219 12:55729028-55729050 GGGCCGCGCGGCAGGCGGGGCGG - Intronic
1097191198 12:57220386-57220408 GTGAGGCGCGGGGCGGGGGGCGG + Intronic
1097191203 12:57220391-57220413 GCGCGGGGCGGGGGGCGGGGGGG + Intronic
1097265180 12:57740204-57740226 GTGGGGGGCTGAGGGTGGGGGGG + Intronic
1097863895 12:64543445-64543467 GTGGGGAGCGGGGGGCGGGCGGG - Intergenic
1098973505 12:76879075-76879097 GGGCTGGGAGGAGGGCGGGGCGG - Intergenic
1100275618 12:93069168-93069190 GTGTGGCGAGGAAGGCGGGTGGG + Intergenic
1100391477 12:94148996-94149018 GCGGGGCGCGGGGGGCGCGGCGG - Exonic
1101371962 12:104138341-104138363 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1102278354 12:111599390-111599412 GCGCGGCGGAGCGGGCGGGGCGG - Exonic
1102501818 12:113358525-113358547 GGGCGGGGCCGAGGGCGGGCGGG - Intronic
1102571664 12:113830567-113830589 CTGCGGGGCGGGGGGGGGGGGGG + Intronic
1102924928 12:116819378-116819400 CGGCGGCGCGCAGAGCGGGGCGG + Intronic
1102962006 12:117099187-117099209 GGGCGGCGCGGGGACCGGGGCGG - Intronic
1103342066 12:120226008-120226030 ATGGGACCCGGAGGGCGGGGCGG - Intronic
1103359039 12:120342807-120342829 GCGCGGCACGGAGGGAGGGATGG + Exonic
1103474776 12:121210308-121210330 GGGCCGCGCGGGGGGCGCGGCGG + Intronic
1103595640 12:122022878-122022900 GGGCGCCGCGCAGAGCGGGGTGG - Intronic
1103623839 12:122204337-122204359 CCGCGGCTCGGAGGGCGGCGGGG + Intronic
1104376194 12:128267113-128267135 GGGCGGGGCCGGGGGCGGGGCGG + Intergenic
1104929321 12:132329693-132329715 GGGGGGCGCGGTGGGGGGGGCGG - Intergenic
1104988552 12:132611260-132611282 CTGAGGCGGGGAGGGTGGGGAGG + Intergenic
1106340151 13:28819918-28819940 GCGGGGCGCGGAGCGCGGGCCGG + Intergenic
1107058433 13:36131009-36131031 GCGGGGCGCCGAGGGCAGGGCGG - Intronic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1107706294 13:43109710-43109732 GTGGGGCGGGGAGAGGGGGGAGG + Exonic
1109025164 13:57146293-57146315 GTGGGGCGGGGGGGGGGGGGGGG - Intronic
1110788037 13:79557328-79557350 GTGGGGCGGGGCGGGGGGGGGGG - Intergenic
1111640374 13:90961920-90961942 GTGCGGTGGGGGGAGCGGGGAGG + Intergenic
1111676790 13:91398569-91398591 GCGGGGCGGGGAGTGCGGGGCGG + Intergenic
1112290870 13:98143288-98143310 GCGCGGGGCGGAGGGGAGGGCGG - Intronic
1112344520 13:98577819-98577841 ATGGGGCGCAGAGGGCAGGGAGG + Intronic
1112449809 13:99498500-99498522 GGCCTGCGTGGAGGGCGGGGCGG + Intergenic
1112505128 13:99970755-99970777 GCGCGGCGCGAAGGGCGGTTCGG + Exonic
1112652734 13:101416397-101416419 GCGCGGCGCCCAGGGCGGGCGGG + Intronic
1113120040 13:106916436-106916458 GTGGGGCGGGGGGGCCGGGGGGG - Intergenic
1113312027 13:109140978-109141000 GGGCGGCGTGGACGGCGGGGAGG - Exonic
1113537485 13:111079673-111079695 GTGCGGGAGGGAGGGCAGGGCGG - Intergenic
1113835591 13:113326366-113326388 GGGTGGCGCGGTGGGGGGGGGGG + Intronic
1113874266 13:113584819-113584841 GTGCGGAGCGCGGGGCGGCGCGG - Exonic
1113874267 13:113584824-113584846 GCGCGGTGCGGAGCGCGGGGCGG - Exonic
1113946064 13:114044384-114044406 GCGGGGCGGGGGGGGCGGGGGGG - Intronic
1113946069 13:114044389-114044411 GTGAGGCGGGGCGGGGGGGGCGG - Intronic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1114627779 14:24140793-24140815 GCGTGGGGCGGTGGGCGGGGCGG - Intronic
1115288587 14:31745193-31745215 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1115761669 14:36582662-36582684 GTGCGGGGCGGGGTGCGGGGCGG - Intergenic
1116042918 14:39707458-39707480 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1116471944 14:45295599-45295621 GTGGGGAGCGGGGGGCGGGGAGG + Intergenic
1116772542 14:49144097-49144119 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1116905097 14:50396678-50396700 GTGGGGCGCGGGGCGCGGGTTGG - Intronic
1117072441 14:52069046-52069068 GCGCGGCGCGGAGAGTGGGCTGG - Intronic
1118006558 14:61568800-61568822 GTGCGCCGTGTGGGGCGGGGCGG + Intronic
1118610034 14:67532992-67533014 GGGCGGCAGGGAGGGCGGCGGGG - Intronic
1119438407 14:74612403-74612425 GTGCGGAGCAGGGGGCGGCGCGG + Intergenic
1121104349 14:91270985-91271007 GAGGGGCGCAGAGGGAGGGGTGG + Intergenic
1121104420 14:91271160-91271182 GAGGGGCGCAGAGGGAGGGGTGG + Intergenic
1121516497 14:94555769-94555791 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
1121690791 14:95876228-95876250 GAGGGGCGGGGAGGGAGGGGAGG - Intergenic
1121721002 14:96108617-96108639 GTGGGGAGGGGAGGGAGGGGAGG - Intergenic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122444955 14:101761596-101761618 GAGCGGCGGGCGGGGCGGGGCGG + Intergenic
1122603542 14:102932881-102932903 GGGGGGCGGGCAGGGCGGGGCGG + Exonic
1122620948 14:103057440-103057462 GGGCGGGGCTGAGGGCGGCGGGG - Exonic
1122660360 14:103290797-103290819 GTGCTGCCCGGGGGCCGGGGTGG + Intergenic
1122688779 14:103522000-103522022 GTGCGGGGCTGCGGGCGGGCCGG - Intronic
1122878855 14:104680939-104680961 GTGGGGCGCGGTGGGCAGTGAGG + Intergenic
1122917315 14:104865174-104865196 GGGCGGCGCGGGGTGCGGCGCGG + Intergenic
1122959423 14:105087667-105087689 CAGCGGCGGGGCGGGCGGGGAGG + Intergenic
1122971906 14:105155701-105155723 GGGCTGCGTGGAGGGCAGGGAGG - Intronic
1123004467 14:105314713-105314735 GGGCGGGGCGCCGGGCGGGGCGG + Exonic
1123038713 14:105481729-105481751 TGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1124129541 15:26971692-26971714 CTGCGGCACGGCGGGCCGGGAGG + Intronic
1124239342 15:28017055-28017077 CTGGGGAGCGGGGGGCGGGGGGG + Intronic
1124427047 15:29570949-29570971 GCGCGGCGCGGCCGGCGGGCGGG - Intergenic
1124957226 15:34367319-34367341 GGGCGCCGCGGCGGGCGCGGAGG - Intergenic
1124966730 15:34437440-34437462 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966734 15:34437457-34437479 GCGCGGCGAGGACGGCGGCGCGG - Intronic
1124966738 15:34437474-34437496 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966742 15:34437491-34437513 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966746 15:34437508-34437530 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966750 15:34437525-34437547 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966754 15:34437542-34437564 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966758 15:34437559-34437581 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966762 15:34437576-34437598 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966766 15:34437593-34437615 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966770 15:34437610-34437632 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966774 15:34437627-34437649 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966778 15:34437644-34437666 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966782 15:34437661-34437683 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966786 15:34437678-34437700 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1124966790 15:34437695-34437717 GCGCGGCGAGGACGGCGGCGCGG - Intergenic
1125201280 15:37102139-37102161 GAGCGGGGAGGAGGGCGGGTGGG + Intergenic
1126034882 15:44536933-44536955 GAGGGGGGCGGAGGGAGGGGCGG - Intergenic
1126447929 15:48770722-48770744 GTGCAGGGGGCAGGGCGGGGAGG + Intronic
1126736556 15:51737274-51737296 GTGCGGCTCGGGGTGCGGTGGGG - Intronic
1127165832 15:56243979-56244001 GCACGGCGCGGAGGGCGGCGCGG + Intergenic
1127326035 15:57896255-57896277 GTGCGGCGGGGGGGGGGGGGAGG - Intergenic
1128145504 15:65330487-65330509 GTGCGGCGCTGAGGGCCAGGAGG - Intronic
1128501433 15:68229766-68229788 GAGCGGAGCGGAGGGAGGCGGGG + Intronic
1128547547 15:68578554-68578576 GTGTGGCGCGGCGGGCTGGGAGG - Intergenic
1128582409 15:68818976-68818998 TTATGGCGCGCAGGGCGGGGAGG - Intronic
1128654679 15:69452036-69452058 GTGCCGCGCGGTGAGCGTGGAGG - Intergenic
1129016601 15:72474448-72474470 TGGCGGCGGGGAGGGCGCGGAGG - Exonic
1129537268 15:76323869-76323891 GTGGGGCATGGAGGGCGGGAAGG + Intergenic
1129710650 15:77818969-77818991 CTGGGGCGCGGCGGGCCGGGAGG - Intronic
1129780137 15:78264590-78264612 GTCCGGCGCGGGGCGGGGGGCGG + Intronic
1129780141 15:78264595-78264617 GCGCGGGGCGGGGGGCGGGCGGG + Intronic
1130531036 15:84748307-84748329 CGGCGGCGGGTAGGGCGGGGCGG - Intergenic
1130656519 15:85795067-85795089 GTGGGGGGCCGGGGGCGGGGAGG + Intergenic
1131284521 15:91046055-91046077 GTGGGGTGGGGAGGGCAGGGAGG - Intergenic
1131524288 15:93140178-93140200 GTGCGACGAGGATGGGGGGGAGG - Intergenic
1132055598 15:98648748-98648770 GAGGGGCGTGGAGGGCGCGGGGG - Intergenic
1132182634 15:99770662-99770684 TGGCGGGGCGGGGGGCGGGGGGG - Intergenic
1132320205 15:100919633-100919655 GAGGGGCGCGGAGGGCGTGTGGG + Intronic
1132398228 15:101489568-101489590 GGGGGGCGCGGGGGGCGCGGGGG - Exonic
1132426810 15:101724554-101724576 GGGCGGGGCGCTGGGCGGGGAGG + Exonic
1132480630 16:164811-164833 GCGGGGCGGGGCGGGCGGGGCGG + Intronic
1132480664 16:164872-164894 GGGCGGGGCGGGGCGCGGGGCGG + Intronic
1132480667 16:164877-164899 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132480697 16:164935-164957 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132515576 16:364245-364267 GGAGGGCGGGGAGGGCGGGGAGG + Intergenic
1132663914 16:1073147-1073169 GAGCGGCGCGGTGGGCAGAGTGG - Intergenic
1132683450 16:1153023-1153045 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1132828888 16:1918120-1918142 GGACGGCTCGGAGGGCGCGGGGG + Exonic
1132885095 16:2179021-2179043 GGGCGGGGCGGGGGGCGCGGCGG + Exonic
1132886417 16:2184175-2184197 GTGGGGGGAGGGGGGCGGGGGGG + Intronic
1132900423 16:2251287-2251309 GGGCGGCGCCGAGGGAGGGCGGG - Intronic
1132943602 16:2520461-2520483 GCGCGGCGAGCAGGGCGCGGCGG + Exonic
1133038122 16:3046105-3046127 TGGCGGGGCGGAGGGCGGGCCGG + Intergenic
1133063384 16:3189455-3189477 GTGCGTCGCGGAGGAGGGGCCGG + Intergenic
1133448570 16:5884440-5884462 GTGGGGAGCGGGGGGCGGGGCGG - Intergenic
1134084204 16:11345564-11345586 GCGCGACGCGGAGGGCGGCCCGG + Exonic
1135254801 16:20932634-20932656 GTGGGGTGGGGAGGGTGGGGGGG + Intergenic
1136111011 16:28063598-28063620 GCGCGGCGCGGGGGGCGTGCGGG + Intergenic
1136316126 16:29455496-29455518 GGGCGGCTCGGAGCGAGGGGCGG - Intronic
1136399510 16:30010069-30010091 GGGCGGCGGGGGCGGCGGGGAGG - Exonic
1136410893 16:30076324-30076346 GTGCGGTGCGGAGGGGGCGGCGG + Exonic
1136430703 16:30194838-30194860 GGGCGGCTCGGAGCGAGGGGCGG - Exonic
1136777433 16:32879392-32879414 GTGGGGCGGGGTGGGGGGGGCGG - Intergenic
1136893191 16:33982122-33982144 GTGGGGCGGGGTGGGGGGGGCGG + Intergenic
1136993318 16:35170357-35170379 GAGCGGCGCGGCAGGCCGGGCGG - Intergenic
1137655146 16:50153172-50153194 GGGCGGGGCGGTGGGGGGGGGGG + Intronic
1138390033 16:56663348-56663370 GTGCGGGGCGGGGGGGGAGGGGG - Intronic
1138398890 16:56730016-56730038 GGGCGGGGCCGGGGGCGGGGCGG - Intronic
1138591234 16:58000681-58000703 GGGCGGCGCGGGGGCCAGGGAGG + Intronic
1139780611 16:69348458-69348480 GTGCGGGGGGGAGGGGGGCGCGG + Intronic
1139785047 16:69385866-69385888 GCCCGGCCGGGAGGGCGGGGAGG - Exonic
1139896220 16:70289741-70289763 GGGGGGCGGGGGGGGCGGGGGGG - Intronic
1139952701 16:70679873-70679895 GTGCGCTGCGGAGGGCGGGCGGG + Exonic
1140033848 16:71358603-71358625 GCGCGGCGCGGCGGGGGCGGCGG - Intergenic
1141538466 16:84699948-84699970 GCGCGCCGCGGGGCGCGGGGAGG - Intergenic
1141582696 16:85011259-85011281 GTGCGGCGGGCTGGGCCGGGCGG - Intronic
1141585019 16:85027973-85027995 GTGGGGCGAGGGGCGCGGGGAGG + Intronic
1141607559 16:85163444-85163466 GTGGGGCACAGTGGGCGGGGTGG - Intergenic
1141990200 16:87604920-87604942 CTGGGGCGCTGAGGGCCGGGCGG + Intronic
1142180017 16:88663751-88663773 GTGCGGGGCTGAGGGGAGGGCGG + Intergenic
1142252581 16:88999570-88999592 GCGGAGGGCGGAGGGCGGGGGGG + Intergenic
1142252692 16:88999805-88999827 GCGGAGGGCGGAGGGCGGGGGGG + Intergenic
1142347070 16:89560867-89560889 GTTCGGGGCGGAGGCCCGGGGGG + Intronic
1142378985 16:89721339-89721361 GGGCGGGGCGGTGGGCGGAGGGG - Intronic
1142395285 16:89828399-89828421 GCGGGGCGCGGAGGGCGCGGGGG - Intronic
1203079846 16_KI270728v1_random:1141501-1141523 GTGGGGCGGGGTGGGGGGGGCGG - Intergenic
1142467394 17:144075-144097 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142467400 17:144087-144109 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142859033 17:2749734-2749756 GGGCGGGGCGGGGGGAGGGGAGG + Intergenic
1142980560 17:3668754-3668776 CGCAGGCGCGGAGGGCGGGGCGG + Intronic
1143000984 17:3794927-3794949 GTGCGCCGGGCAGAGCGGGGGGG - Intronic
1143099871 17:4499080-4499102 GGGCGGCGCGGAGGAGGAGGAGG + Exonic
1143100120 17:4499991-4500013 GCGGGGAGCGGAGGGAGGGGCGG + Intronic
1143334476 17:6162107-6162129 GGGAGGGGCGGGGGGCGGGGAGG - Intergenic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1143477667 17:7211815-7211837 CTGCGGCGGGGGGGGGGGGGGGG + Intronic
1143478736 17:7217227-7217249 GTGGGGTGCGGAGGGGGGAGGGG - Intronic
1143582650 17:7835745-7835767 GTGCGGCGCAGGGCGGGGGGTGG - Intergenic
1143677688 17:8447967-8447989 TTGCGGGGAGGTGGGCGGGGGGG + Intronic
1144695888 17:17303613-17303635 GCGCGGGGCGGCGGGCGGGCTGG + Exonic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1145047121 17:19627694-19627716 GGGCGGCTGGGCGGGCGGGGGGG + Intergenic
1146053305 17:29568653-29568675 GGGCGGCGCGGGCGGCGCGGGGG + Exonic
1146182941 17:30709085-30709107 GGGCGGCGCGGCCGGAGGGGGGG - Intergenic
1146276171 17:31517188-31517210 GTGCGGGGGGGGGGGCGGTGGGG + Intronic
1146276181 17:31517200-31517222 GGGCGGTGGGGGGGGCGGGGGGG + Intronic
1146419032 17:32665199-32665221 GGGCGGGTCGGGGGGCGGGGAGG - Intronic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1146909739 17:36641166-36641188 GCGGGGGGCGGAGGGCGAGGGGG + Intergenic
1147315485 17:39618167-39618189 GGGCCGCGCGCCGGGCGGGGCGG + Intergenic
1147629098 17:41918665-41918687 GTGTCGCGCGGGGGGAGGGGAGG + Intronic
1147702510 17:42404788-42404810 GGGCGGCGCGGAGCGCGGGGAGG - Exonic
1147897449 17:43759875-43759897 GGCCGGGGCGGGGGGCGGGGGGG + Intergenic
1147907592 17:43833044-43833066 GGGCGCCGCGGCGGGAGGGGCGG - Intronic
1147994701 17:44354398-44354420 GGGCGGCGGCGAGGGCTGGGGGG - Exonic
1148090277 17:45019144-45019166 GCGGGGCGCGGGGGGCGGCGAGG + Intergenic
1148233456 17:45951688-45951710 TTGAGGCCCGGGGGGCGGGGTGG - Intronic
1148603226 17:48909156-48909178 GGGCGGCGCCGAAGGCGGGAGGG - Intronic
1148619268 17:49022399-49022421 GGGCGGGGCGGGGGGCAGGGAGG - Intronic
1148846533 17:50533134-50533156 GGGCGGCAGGGAGGGAGGGGTGG - Intronic
1148936222 17:51166383-51166405 GCGCAGGGCGGAGCGCGGGGTGG - Intronic
1149470861 17:56914101-56914123 GTGCGGGGGGGCGGGCGGCGAGG + Intergenic
1149512685 17:57256426-57256448 GTGCGCCGGGGAGGAGGGGGAGG + Intronic
1149610569 17:57955465-57955487 GAGCGGGGCTGCGGGCGGGGCGG + Intergenic
1150069355 17:62138584-62138606 ATGCAGCGCGGTGGGCGGGCAGG + Intergenic
1150108507 17:62478895-62478917 GTGCGGCGCGGAGGGCGGGGGGG - Intronic
1150198302 17:63325064-63325086 GTGGGGGGCGGGGGGCGGGCAGG + Intronic
1150265060 17:63827024-63827046 GTGCGGAGAGGGGCGCGGGGTGG - Intronic
1150284242 17:63946463-63946485 TTGCGGCGGGGTGGGGGGGGGGG - Intronic
1151380007 17:73719411-73719433 GTGAGGCGGGGGAGGCGGGGGGG - Intergenic
1151780150 17:76240278-76240300 GTGAAGCGCGGAGGGCGGCGCGG - Exonic
1152110804 17:78356727-78356749 GCACGGGGCGGGGGGCGGGGGGG + Intergenic
1152196808 17:78923385-78923407 GTGGGGCGGGGTGGGGGGGGGGG + Intronic
1152222121 17:79074756-79074778 GGGCGGGGCCGAGGACGGGGCGG - Intergenic
1152222274 17:79075257-79075279 GTGGCGCGAGGACGGCGGGGCGG - Intronic
1152376615 17:79921923-79921945 GTGCTGCGGGGAGGGCCGGCGGG - Intergenic
1152443507 17:80325675-80325697 CTGGGGCGCGGGGGGCTGGGGGG - Intronic
1152581196 17:81166247-81166269 GAGCGGCGCGGGGGAGGGGGGGG + Intergenic
1152697405 17:81804026-81804048 AGGCTGCGCGGAGGGCGGGCGGG + Intergenic
1152721881 17:81927470-81927492 GGGCGGCGCGGCGGGGGCGGCGG - Intronic
1152754564 17:82081869-82081891 GAGCTGCGGGGAGGTCGGGGTGG + Intronic
1152783482 17:82236607-82236629 GTGCCCCGCGGGGGGAGGGGTGG + Intronic
1152793262 17:82293302-82293324 GCGGGGAGGGGAGGGCGGGGAGG + Intergenic
1152793271 17:82293332-82293354 GTGCGGAGAGGAGGGCGGGAAGG + Intergenic
1152793353 17:82293493-82293515 GGGCTGCGGGGAGGGAGGGGCGG + Intergenic
1152870864 17:82752337-82752359 CGGCGGCGCGGAGCGCGAGGTGG + Exonic
1153480684 18:5543654-5543676 CTGCGCCGCGGCGGGCGGAGCGG + Intronic
1153488867 18:5628913-5628935 GCGCGGCGCGGGAGGTGGGGTGG - Intronic
1154966534 18:21363280-21363302 GTGGGGGGGGGGGGGCGGGGGGG - Intronic
1155209339 18:23586981-23587003 GGGCGGGGCGGAGCGCGGGGTGG + Intergenic
1155308860 18:24504677-24504699 TTGGGGTGTGGAGGGCGGGGAGG + Intergenic
1156443226 18:37213290-37213312 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1156717060 18:40024190-40024212 GTGGGGGGCGGGGGGTGGGGCGG - Intergenic
1157632441 18:49112122-49112144 GTGCGGAGGGGAGGGGGGTGCGG - Intronic
1157665922 18:49486986-49487008 GAGGGGAGGGGAGGGCGGGGCGG + Intronic
1158137731 18:54224623-54224645 GCGCCGCGCTGCGGGCGGGGCGG - Exonic
1160256201 18:77250505-77250527 GAGCGGCGGGGCGCGCGGGGAGG - Intergenic
1160427495 18:78788153-78788175 GTGGGGGGCGGGGGTCGGGGGGG - Intergenic
1160453448 18:78980168-78980190 GCGCGGCGCGGGGCGCGGGGCGG - Intergenic
1160453590 18:78980637-78980659 GGACGGCTCGGAGGCCGGGGCGG + Intronic
1160464911 18:79068811-79068833 GCGCGGCGAGGAGGGCGCGTGGG + Intergenic
1160528391 18:79550052-79550074 GGGCGGTGCGGATGGCGGGAAGG + Intergenic
1160528425 18:79550210-79550232 GGGCGGTGCGGATGGCGGGAAGG + Intergenic
1160528447 18:79550314-79550336 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528459 18:79550368-79550390 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528471 18:79550422-79550444 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528483 18:79550476-79550498 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528495 18:79550530-79550552 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528507 18:79550584-79550606 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528519 18:79550638-79550660 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528531 18:79550692-79550714 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528543 18:79550746-79550768 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528555 18:79550800-79550822 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528567 18:79550854-79550876 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528579 18:79550908-79550930 GGGCGGTGCGGATGGCGGGAAGG + Intergenic
1160528613 18:79551066-79551088 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528625 18:79551120-79551142 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528637 18:79551174-79551196 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528659 18:79551278-79551300 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528671 18:79551332-79551354 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528683 18:79551386-79551408 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528707 18:79551494-79551516 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528730 18:79551602-79551624 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528742 18:79551656-79551678 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528776 18:79551818-79551840 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528812 18:79551980-79552002 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160528835 18:79552088-79552110 GGGCGGTGCGGACGGCGGGAAGG + Intergenic
1160609249 18:80073178-80073200 GTGGGGGGTGGGGGGCGGGGGGG - Intronic
1160680577 19:410155-410177 CTGAGGCGGGGAGGGCAGGGAGG - Intergenic
1160719450 19:590826-590848 CTGCGGCGCGGCGGGTGGGGTGG + Intronic
1160726965 19:621619-621641 ATGCAGCGCGGTGGGCGGGCAGG + Exonic
1160738704 19:676325-676347 GGGCGGGGCGGGGCGCGGGGCGG - Intergenic
1160745359 19:708860-708882 GAGCGGGGCGGGGAGCGGGGCGG + Intergenic
1160788724 19:913112-913134 GTGCGGCCCGGAGGCGGCGGAGG - Exonic
1160862089 19:1241770-1241792 GGGCGGCCTGGAGGGCGAGGAGG - Exonic
1160866373 19:1258043-1258065 GGGCGGGGCGGAGGGCAGGCTGG - Exonic
1160868981 19:1268469-1268491 GTGCAGCACGGTGGGAGGGGAGG + Intronic
1160930504 19:1567767-1567789 GGGGGGCGCGGACGGCGGGGCGG - Exonic
1160947193 19:1649123-1649145 GCCCGGTGGGGAGGGCGGGGCGG - Intronic
1160991710 19:1862942-1862964 GTGGCGCGTGGGGGGCGGGGAGG - Intronic
1160991894 19:1863511-1863533 GCGCGGCGCGGCGGGCGGAGCGG + Exonic
1161014914 19:1978748-1978770 CTGGTGCGCGGCGGGCGGGGCGG + Exonic
1161014917 19:1978753-1978775 GCGCGGCGGGCGGGGCGGGGCGG + Intronic
1161101308 19:2423459-2423481 GTGGGGGGTGGGGGGCGGGGGGG + Intronic
1161331985 19:3692822-3692844 GTGAGGAGGGGAGGGCAGGGAGG - Intronic
1161332891 19:3696728-3696750 GTGCGGAGGGGAGGGCAGGGAGG + Intronic
1161521221 19:4724374-4724396 GTGGGGCGGGGTGGGGGGGGGGG + Intronic
1161612493 19:5250941-5250963 GGGCGGCGGGGGGGGGGGGGGGG + Intronic
1161633318 19:5370446-5370468 GTGAGGGGCGGGGGGTGGGGTGG - Intergenic
1161702926 19:5804955-5804977 CGGGGGCGGGGAGGGCGGGGAGG + Intergenic
1161719752 19:5896231-5896253 GTGAGGAGGGGAGGGTGGGGAGG + Intronic
1161963420 19:7535082-7535104 GTGCGGCCTGGGGGGTGGGGTGG + Intronic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1162086861 19:8254625-8254647 GTGCGGGTCGGAGGGCATGGGGG - Intronic
1162237686 19:9321693-9321715 GGGGGGAGAGGAGGGCGGGGGGG - Intergenic
1162374429 19:10296361-10296383 GGGCGGCGCGGCGGGGGGCGCGG + Exonic
1162427010 19:10602829-10602851 GGGCGGCTCGGATGGCGGGCGGG + Intronic
1162818183 19:13208511-13208533 GGGCGGCGGGGAGGGGGCGGCGG + Intronic
1162909030 19:13839755-13839777 GGGTGGCGCGGCGGGCAGGGCGG - Intergenic
1163051846 19:14690169-14690191 GGAGGGCGGGGAGGGCGGGGAGG + Intronic
1163102573 19:15107325-15107347 GCGCGGGGCGGGGGGCGGGCGGG + Intergenic
1163282233 19:16325003-16325025 GGGCGGCGGGGACGGCGGGGCGG + Intronic
1163606933 19:18280860-18280882 GGGCGGCGCCGGGGGCGCGGGGG - Exonic
1163641717 19:18465916-18465938 GTGCTGCGTGGAGGGGGAGGGGG + Exonic
1163666699 19:18606889-18606911 GGGCGGCGGGGAGGCCGGTGCGG - Intronic
1163729537 19:18941166-18941188 GGGCGGCGTGGAGGGCGGCGCGG - Intronic
1164345934 19:27256964-27256986 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1165172895 19:33906238-33906260 GCGGGCCGCGCAGGGCGGGGGGG - Intergenic
1165297473 19:34939155-34939177 GAGGGGAGCGGAGGGAGGGGAGG - Intronic
1165721404 19:38082099-38082121 GTGTGACGCGGAGGACGCGGGGG + Exonic
1165763472 19:38336079-38336101 GTGAAGGGCGAAGGGCGGGGCGG + Intronic
1166048980 19:40246922-40246944 GCACCGCGCGCAGGGCGGGGTGG + Intronic
1166304905 19:41932208-41932230 GGGCAGCGGGGAGGGCAGGGTGG - Intergenic
1166547014 19:43639853-43639875 GCGGGGCGCGGGGGGCGGGGCGG - Intergenic
1166547045 19:43639893-43639915 GCGGGGCGCCGAGGCCGGGGCGG + Intergenic
1166547134 19:43640179-43640201 GCGCTGCGCGGAGGGGAGGGTGG + Intergenic
1166688326 19:44809013-44809035 GGGGGGCCTGGAGGGCGGGGCGG + Intergenic
1166857989 19:45792726-45792748 GGGCGGCGCGGAGGGCGGCTCGG - Exonic
1166882939 19:45940210-45940232 GGGCGGCGGGGCGGGCGGAGGGG - Exonic
1167118151 19:47500251-47500273 GAGCGGTGTGGGGGGCGGGGAGG - Intronic
1167258155 19:48443154-48443176 GGGCGGCGCGGGGGGCACGGGGG + Exonic
1167267993 19:48493055-48493077 GGGCGGAGCCTAGGGCGGGGCGG - Intronic
1167293165 19:48635557-48635579 GTGCGGCGAAGGGGGCGGGGCGG - Intronic
1167613411 19:50518069-50518091 GGGCCGCGAGGAGCGCGGGGCGG + Exonic
1168076535 19:53983169-53983191 GGGCGGGGCGGGGGGAGGGGAGG + Exonic
1168149295 19:54436219-54436241 GAGCAGCTCGGAGGGCGGGAGGG - Intronic
1168293868 19:55369620-55369642 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1168293873 19:55369629-55369651 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1168679935 19:58307605-58307627 GCGGGGCGGGGAGGGGGGGGCGG - Intronic
1168721812 19:58558511-58558533 GAGCGGCGCGGCAGGCCGGGCGG - Exonic
1202711003 1_KI270714v1_random:19304-19326 TTGCGGCGCGGACAGCGCGGGGG + Intergenic
925034725 2:676762-676784 GTGCGGCGGGGCGTGCGTGGTGG - Intronic
925169907 2:1744155-1744177 GGGGGGCGCGGAGGGTGGAGGGG - Intronic
925609572 2:5692233-5692255 AAGCAGCCCGGAGGGCGGGGTGG + Intergenic
926077257 2:9951514-9951536 GAGCGGCGCGGGGCGGGGGGCGG - Intergenic
926089877 2:10043198-10043220 GGGCGGCGGGGGCGGCGGGGCGG - Intronic
926268195 2:11344721-11344743 GCGCGGTGCGCGGGGCGGGGCGG - Intronic
926301929 2:11611032-11611054 GTGCTGTGCGCAGGGAGGGGCGG + Intronic
926447787 2:12965352-12965374 GTGCGGGGTGGGGGGCGCGGTGG - Intergenic
926914401 2:17878684-17878706 CGGCGGCGAGGAGAGCGGGGTGG - Intronic
927471277 2:23379440-23379462 GTGGGGCGGGGGGGGGGGGGGGG + Intergenic
930124351 2:47783895-47783917 GGGCGGGGCGGGGGGCGGGGTGG + Intronic
931691619 2:64838843-64838865 GTGGGGCGCGGAGGGGAGGAGGG - Intergenic
932632105 2:73353696-73353718 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
932776264 2:74530008-74530030 TGGCTGCGCCGAGGGCGGGGCGG + Exonic
933747996 2:85584653-85584675 ATGCGGCGCGCAGGGAGTGGAGG - Intronic
933758551 2:85659553-85659575 GGGCGGTGAGGAGGGCGGTGTGG + Intronic
933791784 2:85888952-85888974 GAGCGGCGCTGGGGGCGGGTGGG - Exonic
934048682 2:88191784-88191806 CTGCAGGTCGGAGGGCGGGGTGG + Intergenic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
935593753 2:104863953-104863975 GTGCGGCGCGCAGGGCCTGGCGG - Intergenic
936976247 2:118224775-118224797 TTGCGGGGCGCTGGGCGGGGCGG - Intergenic
937045150 2:118847182-118847204 GGCCGGCGCGGCGGCCGGGGCGG - Exonic
937157360 2:119730519-119730541 GTGCAGCACGGAGTGAGGGGCGG - Intergenic
937221670 2:120345925-120345947 GAGGGGCGCGCCGGGCGGGGCGG - Intergenic
937294019 2:120798958-120798980 GTGTGGGGCGGAGGGATGGGGGG - Intronic
937905345 2:127050263-127050285 GCCCGACGTGGAGGGCGGGGAGG + Intronic
937951070 2:127388171-127388193 GGGCGGGGCCGAGGCCGGGGCGG - Intronic
937993166 2:127675194-127675216 GTGGGGCCCGCGGGGCGGGGTGG + Intronic
938475982 2:131614067-131614089 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
939420216 2:141957382-141957404 GTGGGGGGGGGGGGGCGGGGGGG + Intronic
939900415 2:147844289-147844311 GGGCGGAGTGGAGGGCGAGGAGG - Intergenic
939969660 2:148644962-148644984 CGGCGGCGGGGCGGGCGGGGAGG - Exonic
940622857 2:156134740-156134762 GTGGGGGGTGGAGGGCGGAGAGG - Intergenic
940623413 2:156142693-156142715 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
942278962 2:174342289-174342311 GTGGGGCGCGGGGGGCGGCTGGG + Intergenic
942459038 2:176157133-176157155 GCCCGGCGCGGGGGGCAGGGAGG - Intronic
942565762 2:177264173-177264195 GAGCGGCCCGGTGGGCGGCGGGG - Intronic
944060046 2:195563113-195563135 GTGGGGGGAGGGGGGCGGGGGGG - Intergenic
944221750 2:197310514-197310536 GGGCGGCGCGGAGCCCGGCGGGG - Intronic
945247182 2:207729269-207729291 GTGCGGGGGGGTGGGGGGGGTGG - Intronic
945254435 2:207791885-207791907 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
945437658 2:209838251-209838273 GTGCGGGGTGGGGGGTGGGGAGG - Intronic
946328293 2:218996220-218996242 AGCTGGCGCGGAGGGCGGGGTGG + Intergenic
946358876 2:219207043-219207065 GTGAGGGGCGGAGCGCGCGGGGG + Intronic
946431030 2:219627563-219627585 GTGCGGAGCGGAGCGCGAGGAGG + Exonic
946613195 2:221481315-221481337 GGGTGGGGCGGAGGGTGGGGCGG - Intronic
947257741 2:228183719-228183741 GTGGGGCGGGGCGGGGGGGGGGG - Intergenic
947549769 2:231037804-231037826 GCGGGGCGCAGAGGGCGGCGAGG + Exonic
947860479 2:233354442-233354464 GGGCGGGGCCGAGGGCGGGCCGG - Intergenic
948231957 2:236355282-236355304 GTGGGGCGGGGAGAGTGGGGAGG + Intronic
948479515 2:238240836-238240858 GCGGGGCGCGGAGGACGAGGAGG - Intergenic
948858201 2:240740404-240740426 GTGCTGCGGGGAGGGCAGAGAGG - Intronic
948867225 2:240782307-240782329 GTGTGGCCCGGGGGGCGTGGGGG - Intronic
949014748 2:241702643-241702665 CTGCGGCGCGGAGGCGGGGAGGG + Intronic
1168750647 20:279030-279052 GGGCGGGACGGAGGGCGGGAGGG + Intronic
1168753401 20:299109-299131 ATGGGGCGGGGAGGGCGGGAGGG - Exonic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG + Exonic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169214839 20:3786834-3786856 GGTGGGCGCGGAGGGCGGGGAGG - Intronic
1169367220 20:5001360-5001382 GTGCGGCCCGCAGGCCGGGCAGG + Intronic
1169604453 20:7300980-7301002 GTGCGGGGCGGTGGGGGGCGGGG - Intergenic
1170908895 20:20543729-20543751 GTGGGGCGGGGGGAGCGGGGAGG + Intronic
1170969684 20:21105273-21105295 GTGGGGGGCGGGGGACGGGGGGG - Intergenic
1171473522 20:25390480-25390502 GCGCGGAGCGGGGGGGGGGGGGG - Intronic
1171851463 20:30311441-30311463 GTGGGGCGAGGAGGTGGGGGTGG + Intergenic
1172100454 20:32481953-32481975 GTGGGGCGGGGCGGGGGGGGGGG + Intronic
1172101182 20:32484477-32484499 GGGCGGGGAGGAGGGCGGAGGGG - Intronic
1172118287 20:32584096-32584118 GTGCCGCGGGGTGGGGGGGGGGG - Intronic
1172389654 20:34558484-34558506 GTAAGGCCCGGAGGGCGGTGGGG - Intronic
1172840793 20:37901886-37901908 GCGGGGGGCGGGGGGCGGGGGGG + Intergenic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173628427 20:44491163-44491185 GTGGGGCTGGGAGGGCAGGGGGG - Exonic
1174381095 20:50155795-50155817 GTGGGGGGCGGCGGACGGGGGGG + Intergenic
1174607006 20:51768393-51768415 AGGCGGCGCGGGGGGCGCGGCGG - Exonic
1175210450 20:57350874-57350896 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1175210485 20:57350926-57350948 GGGCGGCGCGGGGGGGCGGGGGG + Intergenic
1175210496 20:57350943-57350965 GGGGGGGGCGGGGGGCGGGGCGG + Intergenic
1175226984 20:57450495-57450517 GTGCGGGGTGGGGAGCGGGGGGG - Intergenic
1175428747 20:58888786-58888808 GCGCCGCTGGGAGGGCGGGGTGG + Intronic
1175561365 20:59933508-59933530 GCGGGGCGCGGAGGGAGGGTGGG - Intronic
1175847063 20:62064914-62064936 GGGCGGCACGGCGGGCGCGGCGG + Exonic
1175856963 20:62126323-62126345 GTGCGGCTGGAAGGGCGAGGCGG - Exonic
1175927027 20:62476018-62476040 GGGCGGCGCGGAGGGGGCTGCGG - Intergenic
1175985970 20:62764347-62764369 GTGCGGCTCGGAGGGGAAGGTGG - Intergenic
1176084022 20:63287786-63287808 CGACGGCGGGGAGGGCGGGGAGG + Exonic
1176148081 20:63574272-63574294 GGGCGGGGCGGGGGGCGGTGAGG - Intergenic
1176221088 20:63969684-63969706 GGGCGCGGCGGGGGGCGGGGGGG + Intronic
1176234828 20:64049361-64049383 GGGCGGCGAGGCGGGCGCGGCGG + Exonic
1176242129 20:64080033-64080055 GCGGGGCGCGGCGGGCGGGGCGG - Intergenic
1176247152 20:64102709-64102731 GTGGGGGGCGGAGGGGGCGGGGG - Intergenic
1176546925 21:8206193-8206215 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176549518 21:8215033-8215055 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1176554830 21:8250402-8250424 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176565876 21:8389240-8389262 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176568443 21:8398067-8398089 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1176573751 21:8433427-8433449 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176576355 21:8442297-8442319 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1177792281 21:25734604-25734626 GGGCGGCGCGGGGGGCAGGGAGG - Exonic
1178365500 21:31986200-31986222 GTGGAGGGCGGAGGGCGGCGGGG - Intronic
1178948459 21:36966805-36966827 CTGCGGCGGGAGGGGCGGGGGGG + Intronic
1179213750 21:39349146-39349168 GGGCGGCCCGGCCGGCGGGGAGG - Exonic
1179794775 21:43776443-43776465 GCGCGGGGCGGGGCGCGGGGCGG + Exonic
1179794781 21:43776455-43776477 GCGCGGGGCGGGGCGCGGGGCGG + Intergenic
1180016341 21:45087566-45087588 GTGGGGTGCAGAGGGCGAGGGGG + Intronic
1180095878 21:45555196-45555218 GGGCGGCGCAGGGGGCGGTGGGG + Intergenic
1180095920 21:45555288-45555310 GGGCGGCGCAGGGGGCGGCGGGG + Intergenic
1180170255 21:46054871-46054893 GTGCGGGGCAGAGGGAGGGAGGG - Intergenic
1180170267 21:46054899-46054921 GTGCGGGGCAGAGGGAGGGAGGG - Intergenic
1180170279 21:46054927-46054949 GTGCGGGGCAGAGGGAGGGAGGG - Intergenic
1180637901 22:17275491-17275513 GCGGGGCGGGGAGGGCGGCGTGG - Intergenic
1180731308 22:17984534-17984556 GTGGGGCGTGGGGGGTGGGGGGG - Intronic
1180801588 22:18634481-18634503 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1180852831 22:19030020-19030042 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1180891382 22:19291577-19291599 GTGAGGCCCGGCGGGCTGGGGGG - Intronic
1181064478 22:20299114-20299136 GCGCGGCTGGGAGCGCGGGGCGG + Intergenic
1181478007 22:23180502-23180524 CTGCGGCGCAGAGTGCGGGCCGG + Exonic
1181697914 22:24603114-24603136 GGGCGGGGCGGGGGGAGGGGAGG - Intronic
1182060198 22:27391741-27391763 GTGCTGCTCTGGGGGCGGGGGGG + Intergenic
1182500581 22:30743828-30743850 GTGCGGAGGTGAGGGCGGGGAGG + Intronic
1182777350 22:32840633-32840655 GTGGGGGGCGGAGGGGGCGGCGG - Intronic
1183201475 22:36388006-36388028 CCGCGGCTCCGAGGGCGGGGCGG - Exonic
1183646905 22:39132304-39132326 GAGCTGCGAGGAGGGCGGGCAGG + Exonic
1183931381 22:41237912-41237934 GGGCCGCGCGGAGGGCCGCGCGG + Exonic
1183994211 22:41620917-41620939 GTGCGAAGCGGAGGGAGAGGGGG + Exonic
1184018053 22:41800610-41800632 GAGCAGCGCGGTGGGCGGGACGG + Intergenic
1184152948 22:42649146-42649168 GTGGGGCGCGGCGGGCTGGGCGG + Intronic
1184236761 22:43187159-43187181 GCGCTGGGAGGAGGGCGGGGCGG - Intergenic
1184236779 22:43187190-43187212 GGGCTGGGAGGAGGGCGGGGCGG - Intergenic
1184236795 22:43187217-43187239 GGGCTGGGAGGAGGGCGGGGCGG - Intergenic
1184236811 22:43187244-43187266 GGGCTGGGAGGAGGGCGGGGCGG - Intergenic
1184236833 22:43187283-43187305 GTGCTGGGAGGCGGGCGGGGCGG - Intergenic
1184265299 22:43343134-43343156 GTGGGGGGCGGCGGGCGCGGGGG - Intronic
1184680945 22:46071829-46071851 GCGCGGCGCGGAGGGCGACCCGG - Intronic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185072993 22:48667518-48667540 GTGTGGCACGGAAGGCGGGAGGG - Intronic
1185109123 22:48891035-48891057 GAGCGGAGCGGTGGGCAGGGTGG - Intergenic
1185246484 22:49775862-49775884 GTTCGGCGAGGGGGGCGTGGGGG - Intronic
1185283098 22:49983984-49984006 GGGCTGCGGGGAGGGGGGGGAGG - Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185333358 22:50261349-50261371 GGGCGGGGCGGCCGGCGGGGCGG - Intronic
1185347524 22:50317008-50317030 GGGCGGCGAGGACGGGGGGGGGG + Intronic
1185371043 22:50461136-50461158 GTGGGGCGCGGTGCGCGGGTGGG - Intronic
1203251800 22_KI270733v1_random:122478-122500 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203254405 22_KI270733v1_random:131355-131377 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1203259851 22_KI270733v1_random:167561-167583 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203262461 22_KI270733v1_random:176434-176456 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
949970201 3:9397522-9397544 GTGCGGGGCGGTGGGCGGAGAGG + Intergenic
950176219 3:10876735-10876757 GTGGGGCGGGGGGGGGGGGGCGG - Intronic
950400976 3:12768928-12768950 GCGGGGCGGGGGGGGCGGGGGGG + Intronic
950400983 3:12768937-12768959 GGGGGGCGGGGGGGGCGGGGGGG + Intronic
950509969 3:13420215-13420237 GCGCGGCGAGGATGGCGGCGCGG - Exonic
950710596 3:14810684-14810706 GCGCGGCGCGCAGGGCAGTGGGG - Intergenic
951792137 3:26497669-26497691 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
952301238 3:32106447-32106469 GTGCCTCGGGCAGGGCGGGGCGG + Intronic
952867226 3:37862118-37862140 GCGCGGCGCGGGGGGCGCGGGGG - Intronic
953353042 3:42230315-42230337 GTGGTTGGCGGAGGGCGGGGGGG + Intergenic
953674049 3:44986213-44986235 GTGGGGGTGGGAGGGCGGGGAGG + Intronic
953705379 3:45226353-45226375 CTGGCGAGCGGAGGGCGGGGCGG - Intergenic
953761342 3:45689520-45689542 CTGAGGCGCGGCGGGCGGGGCGG + Intronic
953770889 3:45777952-45777974 GTGCGGGGTGCAGGGTGGGGAGG - Intronic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954615640 3:51967603-51967625 CCGCGGCGCGCGGGGCGGGGCGG - Intronic
954912736 3:54122523-54122545 GGGGGGCGGGGAGGGCGGAGAGG - Intergenic
955186058 3:56716601-56716623 GTTGGGCGGGGGGGGCGGGGGGG - Intergenic
955188019 3:56733323-56733345 GGGCGGGGCGGGGGGGGGGGGGG + Intronic
955228438 3:57079309-57079331 GGGCGGGGCCGGGGGCGGGGAGG + Intronic
955554243 3:60118768-60118790 GGGCGGCGGGGGGGGGGGGGTGG + Intronic
955769111 3:62371982-62372004 GTTCGGCGAGGGGGGCCGGGAGG - Intronic
956188367 3:66584033-66584055 GTGCGGCGGGGAGGTCAGCGGGG - Intergenic
956229541 3:66998391-66998413 GGGCGGCGTGGAGGGAGGTGAGG + Intronic
956675076 3:71725446-71725468 GCGGGGCGCGCGGGGCGGGGCGG - Intronic
956813595 3:72888210-72888232 GTGCGGCGCGGCGGCGGCGGCGG - Exonic
958141728 3:89570928-89570950 GTGGGGGGGGGGGGGCGGGGTGG + Intergenic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961320098 3:126067094-126067116 GGCCGGGGCGGGGGGCGGGGGGG - Intronic
961551567 3:127672885-127672907 GCGGGGCGGGGAGGCCGGGGCGG + Intergenic
961612620 3:128152986-128153008 GGGGGGCGGGGGGGGCGGGGTGG - Intronic
962498473 3:135965929-135965951 GCGGCGCGCGGAGGCCGGGGCGG + Intronic
962808999 3:138946176-138946198 GTGCGGCGTGGCGGGCGCCGGGG - Exonic
963477099 3:145821403-145821425 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
963637365 3:147815682-147815704 GTGGGGCGGTGGGGGCGGGGAGG + Intergenic
964569702 3:158097960-158097982 GCGGGGCGCGGAGGGCGTGCAGG + Exonic
964627283 3:158771859-158771881 GTGCTGGGCCGAGGGAGGGGAGG - Intronic
964801721 3:160565326-160565348 GTGCGGCGCGTTGGTTGGGGCGG - Exonic
965285456 3:166813755-166813777 GTGTGGGGCGGGGGGGGGGGTGG - Intergenic
965520372 3:169663796-169663818 GAGCCGCGGGGAGGGCGGCGGGG + Intergenic
965590529 3:170357260-170357282 GGGCGGCGGTGAGGGTGGGGTGG + Intergenic
965615214 3:170585853-170585875 CTGGGGCGCGGGGGGCGCGGAGG + Intronic
966234888 3:177689648-177689670 GTGGGGCGGGGAGGGGGGAGTGG + Intergenic
966874662 3:184315140-184315162 GGTCGGCCCGGAGGGCGGGCGGG - Intronic
966886595 3:184380566-184380588 GGGCGGCCCGGAGGGTGGGCGGG + Intronic
966890861 3:184406520-184406542 GTGGGGTGCGGGGGGTGGGGGGG + Intronic
967141717 3:186567229-186567251 GTGCGCCGGGGAGGGCGGTGTGG - Intronic
967327004 3:188250997-188251019 GGGCGGGGGGGAGGGCAGGGGGG - Intronic
968225562 3:196969937-196969959 GGGCTGCGCTGAGAGCGGGGTGG + Intergenic
968434172 4:576365-576387 GCGCGGGGCCGCGGGCGGGGTGG - Intergenic
968458465 4:711197-711219 GTGCGGCATGGTGGGAGGGGCGG - Intronic
968515008 4:1012105-1012127 GTGGGGCGCGGGGGCGGGGGCGG - Intronic
968653128 4:1767753-1767775 GCGGGGCGCGGGGCGCGGGGCGG - Intergenic
968661806 4:1801756-1801778 GGGCGGCGCGGGGGTGGGGGCGG + Intronic
968879819 4:3293106-3293128 GTGCGGGGCCGGGGCCGGGGCGG + Intronic
969226334 4:5800840-5800862 GCGCGGCGCGGAGGCTGCGGAGG - Intronic
969239313 4:5888618-5888640 GTGGGGGGCGGGGGGCGGGGTGG - Intronic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
969701640 4:8770904-8770926 GGGCGGGGTGGAGGGGGGGGTGG + Intergenic
969718908 4:8882308-8882330 GTGCGGCGGGGAGGGCGGGGAGG + Intergenic
969718916 4:8882325-8882347 GGGAGGCGGGGAGGGCAGGGAGG + Intergenic
970333143 4:15004208-15004230 CTGCGGCGCCGCGGGCGGCGGGG - Exonic
970754887 4:19413875-19413897 GTGTGGCGGGGGGGGGGGGGGGG - Intergenic
971136059 4:23869665-23869687 GCACGGCGGGGTGGGCGGGGGGG + Intronic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
971405594 4:26319396-26319418 GCACGGGGCGGAGGGCGGCGGGG - Intronic
971490991 4:27211837-27211859 GAGCGGCGGGGTGGGGGGGGTGG + Intergenic
972765857 4:42151949-42151971 GTGCGGCGCGAAGGGCGGCGGGG + Exonic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973613681 4:52659308-52659330 GCGGCGCGGGGAGGGCGGGGAGG + Exonic
973797251 4:54440084-54440106 GGGGGGGGGGGAGGGCGGGGGGG + Intergenic
975050070 4:69851973-69851995 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
976184171 4:82429201-82429223 GTGCGGCGCGCTGGGGGAGGGGG + Intronic
976390063 4:84497869-84497891 GGGCGAGGCGGAGGGCAGGGCGG + Exonic
976791243 4:88880775-88880797 GTGGGGGGCGGGGGGGGGGGGGG + Intronic
978037094 4:104008678-104008700 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
978778348 4:112524066-112524088 GTGGGGCACGGAGGTCGAGGGGG + Intergenic
979547109 4:121951402-121951424 GTGCCGGGCGGGGGGCGGGAAGG - Intronic
979674691 4:123398406-123398428 CCGCGGCGGGGAGGGCGAGGCGG - Intronic
979829502 4:125281886-125281908 GTGGGGCGCGGGGGGGGGGCGGG + Intergenic
980321929 4:131290696-131290718 GTGGGGCGGGGGGGGGGGGGGGG + Intergenic
981033878 4:140151677-140151699 GGGCGGCGCGGTGCGGGGGGGGG + Intronic
982033614 4:151325216-151325238 GAGAGGCGCGGGGGACGGGGCGG - Intronic
982257639 4:153466263-153466285 GTGCGGCGCGGGGCGGGGCGGGG + Intergenic
983362953 4:166749486-166749508 GTGCGGTGGGGGGAGCGGGGAGG + Intronic
983649776 4:170026457-170026479 GTGCGGCTCGCCGGGCGGCGCGG + Intronic
984296717 4:177862560-177862582 GTGGTGAGCGGAGGGTGGGGGGG - Intronic
984771025 4:183436320-183436342 GTGGGGCGGGGGGGGGGGGGCGG + Intergenic
984999653 4:185471201-185471223 GGGGGGCGGGGAGGGCGGGGAGG + Intronic
984999658 4:185471210-185471232 GGAGGGCGGGGAGGGCGGGGCGG + Intronic
985005965 4:185535556-185535578 GGGCGGGGAGGACGGCGGGGCGG - Intronic
985550142 5:528668-528690 GAGCGGGGCGCGGGGCGGGGCGG - Intergenic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985652187 5:1112334-1112356 GGGGGCCGGGGAGGGCGGGGAGG - Intergenic
985716067 5:1462514-1462536 GTGCGGTGCGGAGGGTGATGAGG - Exonic
985773599 5:1828059-1828081 GAGCCGCGCGCAGGGAGGGGCGG + Intergenic
985773606 5:1828081-1828103 GAGCCGCGCGCAGGGAGGGGCGG + Intergenic
986152492 5:5140299-5140321 GTGCGGCGCGGGGGGCGGAGTGG - Intergenic
986263384 5:6168623-6168645 GTGCGGTGGGGTGGGCGGGGAGG + Intergenic
986330706 5:6714216-6714238 GGGCAGCGCGGCGGGCGCGGTGG - Intergenic
987084634 5:14457374-14457396 GGGCGGGGCGGGGGGGGGGGGGG - Intronic
987132482 5:14872053-14872075 CGGCGGCGCTGAGGGCGCGGCGG + Intergenic
987303429 5:16617032-16617054 GGGTGCCGCCGAGGGCGGGGCGG + Exonic
988075788 5:26352505-26352527 GTGGGGGGCGGGGGGTGGGGTGG - Intergenic
988509699 5:31854897-31854919 CCGCGGCGCGGAGGGAGGAGGGG + Intronic
989475707 5:41870473-41870495 GTGCGGCTCGAAAGGCCGGGAGG - Exonic
990446210 5:55896629-55896651 GTGAGGCGGGGAGGGGAGGGAGG - Intronic
991585024 5:68193286-68193308 GTGGGGTGAGGAGGGCTGGGAGG - Intronic
992320916 5:75612321-75612343 GGGCGGGGCGGAGGGCGGGGGGG - Intronic
992627576 5:78648922-78648944 GCGCGGCGCGCGGGGCGGGACGG + Intronic
992828631 5:80572776-80572798 GTGGGGAGAGGAGGGCAGGGAGG - Intergenic
992833550 5:80618634-80618656 GTTTGGCGAGGAGGGCGGGCTGG - Intergenic
992910794 5:81394172-81394194 GCTGGGCGGGGAGGGCGGGGCGG - Intronic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
993467674 5:88268665-88268687 GTGGGGCGAAAAGGGCGGGGAGG - Intronic
994072960 5:95621409-95621431 GGGAGGCGCGGAGGACGAGGAGG + Exonic
994092604 5:95822318-95822340 GTGCGGGGCGGGGGGTGTGGGGG - Intronic
994208822 5:97065047-97065069 GTGGGGGGGGGGGGGCGGGGGGG + Intergenic
995975846 5:118034059-118034081 GGGGGGCGAGGAGGGCGAGGCGG - Intergenic
996082200 5:119268704-119268726 GTGTGGCGGGCAGGCCGGGGAGG - Intronic
997485357 5:134226277-134226299 GTGGCTCCCGGAGGGCGGGGTGG + Intergenic
997899901 5:137754608-137754630 GTGGTGCGCGGAGGGCAGGGAGG - Intergenic
997903880 5:137794983-137795005 GGGAGGGGCGGGGGGCGGGGCGG + Intergenic
998369496 5:141651569-141651591 GGGTGGCGGGGCGGGCGGGGCGG + Intergenic
998583502 5:143403829-143403851 GGCCCGCGCGGAGGGCGTGGGGG - Intronic
998583530 5:143403902-143403924 GCGCGGCGCACCGGGCGGGGCGG - Intronic
999009555 5:148021052-148021074 GTGCGGTGGGGGGAGCGGGGAGG - Intergenic
999197320 5:149791197-149791219 GTCTGGGGCGGGGGGCGGGGTGG + Intronic
1000296389 5:159916599-159916621 GAGCGGCGGGGAGGAGGGGGCGG - Intergenic
1000303024 5:159972538-159972560 GGGGGGAGGGGAGGGCGGGGCGG + Exonic
1000303032 5:159972550-159972572 GGGCGGGGCGGAGGGGGGAGGGG + Intergenic
1000384711 5:160663638-160663660 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1001314710 5:170633737-170633759 GGGGGGGGCGGGGGGCGGGGCGG + Intronic
1001503773 5:172260053-172260075 GTGCGGCGGGGAGGGGGTGGGGG - Intronic
1001529928 5:172454554-172454576 GGGCGGTGCGGGGGGCGGGCCGG - Intergenic
1001529935 5:172454566-172454588 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529941 5:172454578-172454600 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1001566147 5:172700739-172700761 GTGGGGCGGGGAGCGGGGGGCGG - Intergenic
1001915932 5:175559991-175560013 GTGCGGGGCGGCGGGGTGGGGGG + Intergenic
1002059209 5:176616579-176616601 GTGCTGGGCAGAGGGAGGGGTGG + Intergenic
1002455962 5:179345460-179345482 GCGAGGCGCGGAGGGGCGGGCGG + Intergenic
1002505739 5:179678185-179678207 GTGTGGTGCGGAGGGAGCGGAGG - Intergenic
1002600676 5:180352721-180352743 GGGCTGCGGGGACGGCGGGGCGG + Intronic
1002712514 5:181203995-181204017 GTGCAGGGGTGAGGGCGGGGCGG - Intronic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002771342 6:292672-292694 GACGGGCGCGGAGGGAGGGGCGG + Intronic
1002888067 6:1312968-1312990 GGAGGGCGCGGAGGCCGGGGCGG + Exonic
1002888081 6:1313004-1313026 GGGCGGCGCGGGGAGCGGCGAGG + Exonic
1002926968 6:1610403-1610425 GTGGGGGGCGGCGGGCGGCGCGG + Exonic
1004044630 6:12012254-12012276 GAGCGGGCCGGGGGGCGGGGGGG - Intronic
1004044747 6:12012611-12012633 CGGCGGGGCGGAGGGGGGGGGGG + Intronic
1004123155 6:12845437-12845459 GCCCAGCACGGAGGGCGGGGGGG - Intronic
1004409388 6:15366503-15366525 GGGGGGCGGGGGGGGCGGGGGGG + Intronic
1004529374 6:16439358-16439380 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1005385287 6:25279413-25279435 GTGCGGCGCGGAGGCTGGGCGGG + Exonic
1005421109 6:25652147-25652169 GGACAGCGCGCAGGGCGGGGCGG + Intergenic
1005997951 6:30942899-30942921 GGGCGGCATGGAGGGAGGGGTGG + Intronic
1006170119 6:32087610-32087632 GTGGGGCGGGGGTGGCGGGGCGG + Intronic
1006404381 6:33835725-33835747 TTGCGGGGGGGGGGGCGGGGGGG + Intergenic
1006404388 6:33835734-33835756 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1006599704 6:35217242-35217264 GGGAGGCGCGGCGGGGGGGGGGG + Intronic
1007550738 6:42727869-42727891 GGGCGGCGTGGGGGGTGGGGTGG - Intergenic
1007598563 6:43067099-43067121 GTGCGGGGCGTGGGGTGGGGAGG - Intronic
1007656839 6:43455636-43455658 GTGCGTCGCGGGGGGGGGGATGG - Intronic
1007673387 6:43575600-43575622 GAGAGGCGCGGAGGGCCGCGAGG + Intronic
1010187301 6:73158141-73158163 GTGCGGGGGAGGGGGCGGGGCGG + Intronic
1010229440 6:73521621-73521643 GAGGGGCGCGGAAGCCGGGGCGG - Intronic
1010597172 6:77778132-77778154 GTGCGGGGCGGGGGGTGGTGGGG + Intronic
1010854948 6:80825986-80826008 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1011650763 6:89504126-89504148 GTGGGGGGCGGGGGGTGGGGGGG + Intronic
1012410127 6:98947643-98947665 GCGCGGGGCCGCGGGCGGGGAGG + Intronic
1013004021 6:106053822-106053844 GTGGGGGGTGGAGGGCTGGGGGG - Intergenic
1013057476 6:106597837-106597859 GTGGGGTGCGGGGAGCGGGGAGG - Intronic
1013099464 6:106974834-106974856 GCGGGGCGGGGAAGGCGGGGAGG - Intronic
1014632515 6:123803825-123803847 GAGCGGCGCGGAGAGCGGCAGGG + Intergenic
1015328540 6:131951185-131951207 GGGCGGAGCGGAGGGCGCGGTGG + Exonic
1015773603 6:136792532-136792554 GCGCGGCGCGGCGGGTGGCGAGG - Intergenic
1016330256 6:142946518-142946540 GTGCGGCGCGCGGGGCGACGGGG + Intergenic
1016438898 6:144064157-144064179 GCGCTGGGCGGAGGGCGGGCCGG - Intronic
1017021420 6:150143148-150143170 GTGCGGCCCGGAGGAGGGGCGGG - Exonic
1017103136 6:150865874-150865896 AGGCGGCGCGGAGGGCCCGGGGG - Exonic
1017478736 6:154827826-154827848 GGGCGGGGCGGGGGGGGGGGCGG + Intronic
1017705973 6:157123224-157123246 GGGGGGGGCGGGGGGCGGGGGGG - Intronic
1017877643 6:158537215-158537237 GGGCGGCGAGGCGGGCGCGGGGG - Intronic
1018020909 6:159761866-159761888 GCGGGGCGCGGGGCGCGGGGCGG - Exonic
1018694839 6:166383105-166383127 GTGCGCCACCGAGGGCGGGAAGG - Intergenic
1018778997 6:167045352-167045374 GGGCCGCGGGGGGGGCGGGGAGG - Exonic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1019112107 6:169724538-169724560 GGGCGGGCCGGAGGGCGGGCGGG - Intronic
1019335736 7:481656-481678 GTGGGGAGGGGAGGGTGGGGAGG - Intergenic
1019521917 7:1464749-1464771 GGGGGGGGGGGAGGGCGGGGTGG - Intergenic
1019597935 7:1866960-1866982 GTGCAGCTCGGAGGTAGGGGAGG + Intronic
1019828309 7:3301552-3301574 GTCCGGCGCGGCGCTCGGGGTGG + Exonic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020243017 7:6410103-6410125 GTGCGGCGTGGTGGGTGTGGTGG - Intronic
1020274377 7:6615704-6615726 GGGCCGCGCGGGGGCCGGGGCGG - Exonic
1020767973 7:12349075-12349097 GTGCGGTGCGGGGAGAGGGGAGG + Intronic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1021649411 7:22819006-22819028 GGACGGGGTGGAGGGCGGGGGGG + Intronic
1021969287 7:25951117-25951139 GAGCGGAGCGGAGCGCGAGGGGG - Intergenic
1022207705 7:28180094-28180116 GCGCGGGGCGGAGGGCGCGGCGG - Intronic
1022973495 7:35537309-35537331 GGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1023259272 7:38341812-38341834 GTGTGTGGCGGGGGGCGGGGGGG + Intergenic
1023532563 7:41173673-41173695 GTGGGGAGGGGAGGGTGGGGAGG - Intergenic
1023638591 7:42237121-42237143 GTGCGGCGCGGGCGGCCGCGGGG + Intronic
1025198663 7:56949306-56949328 GGGCGGGGCCGAGCGCGGGGAGG - Intergenic
1025673289 7:63627630-63627652 GGGCGGGGCCGAGCGCGGGGAGG + Intergenic
1025829827 7:65038817-65038839 GTGCAGCCGGGAGGCCGGGGCGG + Intergenic
1025917082 7:65873817-65873839 GTGCAGCCGGGAGGCCGGGGCGG + Intronic
1026227174 7:68452652-68452674 GTGTGGGGCGGCGGGCGTGGGGG + Intergenic
1026475521 7:70731798-70731820 GTGCGGGGGGGATGGCGGAGGGG - Intronic
1026732785 7:72925672-72925694 GGTCGGCGGGGAGGGCGGGGGGG - Intronic
1027189459 7:75988831-75988853 GTGTGGAGGGGAAGGCGGGGAGG + Intronic
1027232610 7:76281560-76281582 AGGCCGCGCGGCGGGCGGGGCGG + Exonic
1027283539 7:76626779-76626801 GGTCGGCGGGGAGGGCGGTGTGG + Exonic
1027623538 7:80521555-80521577 GTGGGGGGTGGGGGGCGGGGGGG - Intronic
1028382224 7:90212015-90212037 GCCCGGCGTGGAGGGCGCGGGGG + Exonic
1028759466 7:94479507-94479529 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1029068041 7:97872175-97872197 CTGCGGTAGGGAGGGCGGGGCGG - Intronic
1029188297 7:98754940-98754962 GTGCGGGGGGGGGGGCGGGGGGG - Intergenic
1029444163 7:100603608-100603630 GTGCGGGGGGGACGGGGGGGGGG - Intronic
1030033312 7:105388480-105388502 GGGCGGCCCGGGGGGAGGGGCGG - Intronic
1030600157 7:111583400-111583422 GGGCGGGGTGGGGGGCGGGGGGG + Intergenic
1031025154 7:116672080-116672102 GCGCGGCGCGGACGGCAGGAAGG + Intergenic
1031340857 7:120598564-120598586 GTGGGGCAGGGGGGGCGGGGCGG + Intronic
1031406255 7:121390845-121390867 GTGTGGGGCGGGGGGGGGGGGGG + Intronic
1031406257 7:121390847-121390869 GTGGGGCGGGGGGGGGGGGGGGG + Intronic
1033705571 7:143882644-143882666 CTGCGGGGGGGAGGGCAGGGCGG - Intronic
1033870979 7:145752607-145752629 GGGCGGGGCGGAGTGGGGGGGGG + Intergenic
1034251296 7:149692832-149692854 GTGCGGAGGCGAGGGCGGGCTGG - Intergenic
1034256993 7:149730153-149730175 GTGCAGCGGGGAGGGCTTGGGGG - Exonic
1034560670 7:151877483-151877505 GCGCGGCGACGAGGGCGGCGTGG - Intergenic
1034618070 7:152436022-152436044 GCGGGGGGCGGCGGGCGGGGCGG + Intergenic
1034911832 7:155003433-155003455 GCGCGCGGCGGAGGGGGGGGTGG + Intergenic
1034957750 7:155345022-155345044 GTGCGGCGCGGCGGGGGCGAAGG - Intergenic
1034963087 7:155374352-155374374 GGGCGGCCCGGCGGGCGGGCCGG + Intergenic
1034967074 7:155398240-155398262 GCGGGGGGCGGGGGGCGGGGGGG + Intergenic
1034967079 7:155398249-155398271 GGGGGGCGGGGGGGGCGGGGAGG + Intergenic
1035021788 7:155804781-155804803 GGCCGGGGAGGAGGGCGGGGAGG + Intronic
1035167460 7:157000085-157000107 GCGGGGCGCGGGGGGCGGAGCGG + Intronic
1035167549 7:157000487-157000509 GTGCGGCGCGGAGGGGCGCTGGG - Intronic
1035206902 7:157299909-157299931 GTGCTGGGTGCAGGGCGGGGCGG - Intergenic
1035580932 8:738615-738637 GCCCTGCGCGGAGGGCTGGGGGG + Intergenic
1035717065 8:1763378-1763400 GCGCGGCGCGGCGGGCGCTGTGG - Intronic
1035720933 8:1791400-1791422 GGGCGGGGCGGGGGGAGGGGGGG - Intergenic
1035892173 8:3357042-3357064 GTGGGGCTAGGAGGGTGGGGAGG + Intronic
1036195408 8:6709018-6709040 ATGCGGAGAGGAAGGCGGGGAGG - Intronic
1036294106 8:7521572-7521594 ATGCGCCCCGGAGGGCGGGACGG - Intergenic
1036328456 8:7799419-7799441 ATGCGCCCCGGAGGGCGGGACGG + Intergenic
1036454179 8:8893361-8893383 GCGCCGCGCGGCGGGCGGAGAGG - Exonic
1036733298 8:11284767-11284789 GTGGGGCGGGGCGGGCCGGGCGG - Exonic
1036739430 8:11347595-11347617 GTGCGCCGGGCGGGGCGGGGCGG + Intergenic
1036761388 8:11511292-11511314 GTGGGGTGGGGAGAGCGGGGAGG + Intronic
1037832793 8:22199106-22199128 GTGCAGGGCTGAGGGTGGGGCGG - Intronic
1038002321 8:23402962-23402984 GTGCGGGGCGGAGCGGGGCGAGG - Intronic
1038404502 8:27311378-27311400 GTGCGGGGGGGATGGCGAGGGGG + Intergenic
1038509563 8:28118877-28118899 ATGGGGCGTGGGGGGCGGGGCGG - Intronic
1038644384 8:29350501-29350523 GGGCGGCGCGCAGAGCGGAGGGG + Exonic
1038945625 8:32356478-32356500 GTGGGGCCCGGCGGGTGGGGGGG - Intronic
1039062280 8:33581353-33581375 GTGCAGCGCAGAGGTCGGTGGGG - Intergenic
1040415212 8:47189100-47189122 GCGCGGGGCGGAGGTCGGGTGGG + Intergenic
1041029738 8:53724585-53724607 GTGGGGCGGGGAGGAGGGGGAGG - Intronic
1041068188 8:54102015-54102037 GTGAGGTGCCGAGGGAGGGGCGG - Exonic
1041693701 8:60714414-60714436 GTGCGGGGCGGGGGGGGGGGGGG - Intronic
1042052150 8:64722737-64722759 TTGCGGCGGGGGGGGGGGGGCGG + Intronic
1042998899 8:74733223-74733245 GTGGGGTGGGGAGAGCGGGGAGG - Intronic
1043346239 8:79301182-79301204 GTGGGGCGGGGGGAGCGGGGAGG + Intergenic
1043388067 8:79767691-79767713 GGTCGGCGCGGCGGGCAGGGAGG + Exonic
1044335996 8:90985267-90985289 GCGAGGGGCGGGGGGCGGGGCGG + Intergenic
1045122484 8:99053282-99053304 GTGGGGTGCGGGGAGCGGGGAGG - Intronic
1045299555 8:100899479-100899501 GTGCGGGGCTGCGGGAGGGGAGG - Intergenic
1046274473 8:111939268-111939290 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1046776255 8:118167178-118167200 GGGGGGCGCGGGGGGCTGGGGGG - Intergenic
1046912101 8:119639601-119639623 GGGCGGGGCGGAGGAGGGGGCGG + Intronic
1047361324 8:124172002-124172024 GGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1047579102 8:126193051-126193073 GGGTGGCGGGGAGGGGGGGGGGG + Intergenic
1048234347 8:132675333-132675355 CTGCGGTGCGGAGGGCCGGGTGG + Intronic
1048633607 8:136271544-136271566 GTGTGGCGGGGGGGGGGGGGCGG - Intergenic
1049235058 8:141508217-141508239 GTGCGGCGGGGAGGGCGCGTGGG - Intergenic
1049292565 8:141812399-141812421 GGAGGGCGGGGAGGGCGGGGAGG + Intergenic
1049377923 8:142297896-142297918 GCGCGGGACGGAGGGCGGCGGGG - Intronic
1049396386 8:142403038-142403060 GTGGGGCGGCGAGGGCGAGGCGG - Intronic
1049502478 8:142974814-142974836 GCGGGGGGCGGGGGGCGGGGAGG - Intergenic
1049552378 8:143266634-143266656 ACGCGGAGCAGAGGGCGGGGGGG - Intronic
1049611259 8:143556686-143556708 GAGCGGCTGGGAGGGCCGGGTGG + Intronic
1049689322 8:143951863-143951885 GCGGGGCGGGGAGGGGGGGGTGG - Intronic
1049707374 8:144049174-144049196 GTGCAGCGCCGGGGGCGGGAAGG - Intergenic
1049751419 8:144286077-144286099 GAGGGGCGCGGAGGGCAGGCAGG + Intronic
1050151257 9:2621727-2621749 GGGAGGCGCGGCGGGCGGGCGGG - Intergenic
1050651845 9:7785309-7785331 GTGGGGCGGGGGGGGGGGGGGGG - Intergenic
1050651847 9:7785311-7785333 GTGTGGGGCGGGGGGGGGGGGGG - Intergenic
1052552664 9:29970332-29970354 GGGGGGCGGGGAGGGCGGGGCGG + Intergenic
1053530162 9:38873147-38873169 GTGGGGGGCGGAGGGGGGGCGGG + Intergenic
1053649066 9:40144897-40144919 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1053756677 9:41318994-41319016 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1054330041 9:63742803-63742825 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1054535515 9:66231276-66231298 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1054635971 9:67490786-67490808 GTGGGGGGCGGAGGGGGGGCGGG - Intergenic
1056585339 9:87924278-87924300 GTGGGGGGCGGGGGGCTGGGGGG + Intergenic
1056611542 9:88128662-88128684 GTGGGGGGCGGGGGGCTGGGGGG - Intergenic
1056643417 9:88389003-88389025 GGGCGGGGCGGGGGGAGGGGCGG + Intronic
1056921464 9:90793031-90793053 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1056925140 9:90828233-90828255 GGGCGGGGCGGGGGGGGGGGCGG - Intronic
1056992364 9:91423764-91423786 GCGCGGCGCGGGAGGCGGGCGGG + Exonic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057298083 9:93860956-93860978 GAGCCTAGCGGAGGGCGGGGCGG + Intergenic
1057489232 9:95508742-95508764 GCGCGGGGCGGGGGGCGGGTAGG - Intronic
1057623310 9:96655346-96655368 GTTGGGCGCGGGGGGCGGGGCGG + Intergenic
1057665242 9:97039352-97039374 GGGCTGCGCGGAGGAGGGGGAGG + Intronic
1057794576 9:98146179-98146201 GTGAGGTGTGGAGGGTGGGGAGG - Intronic
1060208985 9:121699096-121699118 GGGCGACGTGGCGGGCGGGGTGG + Intronic
1060280755 9:122214072-122214094 GCGGGGCGGGGAGGGCGGTGAGG + Intronic
1060760344 9:126242155-126242177 GTGCGGCGGGGTGGTGGGGGGGG - Intergenic
1060945862 9:127569079-127569101 GTGCAGGGCCGAGGGCAGGGAGG - Exonic
1060945916 9:127569204-127569226 GTGCAGGACCGAGGGCGGGGCGG - Intronic
1061108811 9:128552612-128552634 GTGTGGAGCGGAGGCCGCGGAGG + Exonic
1061494419 9:130963529-130963551 GTGCGGGGCGGGGGGGCGGGGGG + Intergenic
1061571243 9:131478620-131478642 GTGAGGGGCGGAGGGTGGGGGGG + Intronic
1061737409 9:132670676-132670698 GGGCGGCGAGGCGGGCGGGAAGG + Exonic
1061975886 9:134067895-134067917 GCGCGGGGCGGCGGGCGGCGCGG - Intronic
1062041730 9:134407524-134407546 GTGCGGGCCGGCGGGTGGGGCGG + Intronic
1062306042 9:135907586-135907608 GGGCGGGGTCGAGGGCGGGGTGG - Intergenic
1062342449 9:136099742-136099764 GTGCGGGTCGGCGGGGGGGGGGG + Intergenic
1062393352 9:136342723-136342745 GGCAGGTGCGGAGGGCGGGGTGG + Intronic
1062443735 9:136584700-136584722 GTGGGAAGCGGAGGGCGAGGTGG - Intergenic
1062461878 9:136665721-136665743 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1062483613 9:136763581-136763603 GAGGGGCGGGGAGGGCGGGCAGG + Intronic
1062489944 9:136800178-136800200 GCGGGGCTGGGAGGGCGGGGCGG + Intronic
1062533351 9:137011151-137011173 GTGGGGCGGGGAAGGCGGTGGGG - Intronic
1062565508 9:137162379-137162401 GCGGGGCGCAGAGGGCGGGCGGG - Intronic
1062628753 9:137454358-137454380 GTGCGGCGGGGGTGGGGGGGCGG - Intronic
1062629890 9:137458890-137458912 GGGAGGCGCGGGGCGCGGGGAGG + Intronic
1062686063 9:137814065-137814087 TTGTGGGGCGGGGGGCGGGGGGG - Intronic
1062696347 9:137877999-137878021 GGGCGGCGGGGCCGGCGGGGCGG + Exonic
1203468202 Un_GL000220v1:105629-105651 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203470806 Un_GL000220v1:114499-114521 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1203476023 Un_GL000220v1:149601-149623 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203478627 Un_GL000220v1:158471-158493 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1185534600 X:850845-850867 GTGCGGTGCTGGGGGCAGGGTGG - Intergenic
1185610800 X:1392737-1392759 GCCGGGCGCGGAGGGCGGCGCGG - Intergenic
1186802372 X:13106114-13106136 GGGGGGCGGGGGGGGCGGGGGGG - Intergenic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1187419589 X:19122653-19122675 GCGGGGCGCGGAGGGAGGAGGGG + Intergenic
1188292119 X:28402040-28402062 GTGGGGTGGGGAGAGCGGGGAGG + Intergenic
1188451176 X:30309216-30309238 GTGCGGCGATGAGCCCGGGGTGG - Exonic
1189044024 X:37572008-37572030 GGGCGGCGCGGAGGCCCGAGGGG + Exonic
1189281221 X:39821245-39821267 GCCGGGCGGGGAGGGCGGGGCGG + Intergenic
1189331360 X:40146680-40146702 GGCGGGCGCGGCGGGCGGGGAGG - Intronic
1189446629 X:41086168-41086190 GTGAGGGGAGGAGGGCGAGGGGG + Intronic
1189961278 X:46327082-46327104 GTGTGGCGGCGGGGGCGGGGTGG + Intergenic
1190324887 X:49200221-49200243 GGGCGGCGCGGGGCGCGGCGGGG + Exonic
1190522762 X:51297020-51297042 GTGGGGGGAGGAGGGGGGGGAGG + Intergenic
1190708230 X:53048377-53048399 GGGCGGGGCGGGGAGCGGGGGGG - Intergenic
1192393269 X:70753207-70753229 GGGCGGCGAGGGGGGCGGGGAGG + Intronic
1192609603 X:72554495-72554517 GGGGAGCGGGGAGGGCGGGGAGG + Intronic
1194646119 X:96460419-96460441 GTGCAGCGCAGAGGCCAGGGTGG - Intergenic
1195275433 X:103276293-103276315 GTGCGGGGCGGGGAGGGGGGAGG - Intronic
1196297995 X:114021273-114021295 GTGGGGTGGGGAGAGCGGGGAGG - Intergenic
1196697819 X:118632958-118632980 GTGGGGGGCGGTGGGGGGGGGGG + Intronic
1196819585 X:119692587-119692609 GAGTGGCGAGGGGGGCGGGGAGG - Intronic
1196918242 X:120561103-120561125 ACGCGGCGCCGAGGGAGGGGCGG + Intronic
1197021110 X:121690506-121690528 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
1197147337 X:123184782-123184804 GTGCGGGGCGGGGGGCGGGGCGG + Intronic
1197241697 X:124128548-124128570 GTGCGGGGCGGCTGGCCGGGCGG + Intronic
1197774552 X:130110775-130110797 GAGCGGGGCGGACGCCGGGGAGG + Intergenic
1198099895 X:133414709-133414731 GTCCGGCGCAGGGGGCGGCGGGG + Intronic
1198158616 X:133985750-133985772 GCGCGGCGTGGAGCGCGGCGGGG + Intronic
1198369246 X:135974345-135974367 GTGGGGCGTAGGGGGCGGGGCGG + Intergenic
1199500373 X:148500687-148500709 GCGCGGCGCGGCAGCCGGGGCGG - Exonic
1199832984 X:151562866-151562888 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1200100591 X:153687796-153687818 GTGTGACGAGGAGGGCGGGAGGG + Intronic
1200218342 X:154378664-154378686 GTGCGGCGGGGTGAGAGGGGCGG - Intergenic
1200229449 X:154436866-154436888 GCGGGGCGCGGCGGGTGGGGCGG + Intergenic
1200229466 X:154436945-154436967 GCGGGGCGGGGCGGGCGGGGCGG - Exonic
1201288816 Y:12402420-12402442 GTGGGGCGGGGAGAGGGGGGAGG - Intergenic
1201676161 Y:16586943-16586965 GTGTGGCGGGGTGGGGGGGGCGG - Intergenic