ID: 1150119346

View in Genome Browser
Species Human (GRCh38)
Location 17:62586907-62586929
Sequence ATTTCCTTCTAGAAGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150119343_1150119346 18 Left 1150119343 17:62586866-62586888 CCCTAGGGAGCTGCTGGTGGGCT 0: 1
1: 0
2: 0
3: 19
4: 220
Right 1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG 0: 1
1: 0
2: 0
3: 20
4: 348
1150119344_1150119346 17 Left 1150119344 17:62586867-62586889 CCTAGGGAGCTGCTGGTGGGCTG 0: 1
1: 0
2: 4
3: 40
4: 413
Right 1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG 0: 1
1: 0
2: 0
3: 20
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150119346 Original CRISPR ATTTCCTTCTAGAAGAGACT GGG Intronic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
901338739 1:8475503-8475525 ATTTCTTTTTAGTAGAGACAGGG - Intronic
901570170 1:10153645-10153667 TTTTACTTTTAGTAGAGACTAGG - Intronic
903932835 1:26873670-26873692 ATTTCTTTTTAGTAGAGACGGGG - Intergenic
903987506 1:27239343-27239365 ATTTTCTTTTTGTAGAGACTGGG - Intronic
904516911 1:31063139-31063161 ATTTCCTTTTAGAACAGAATGGG - Intronic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
904935266 1:34125794-34125816 AATTCCTTCCAGAAGACAGTGGG - Intronic
906078089 1:43066923-43066945 ACTTCGTTCTAGAAGGGCCTGGG - Intergenic
907427867 1:54392259-54392281 ATTTCCTTCTAGTACAGATCTGG + Intronic
908808822 1:67958461-67958483 TTTTTCTTTTAGTAGAGACTGGG + Intergenic
909074078 1:71031991-71032013 ATTTTCTCCAAGAATAGACTAGG - Intronic
909246821 1:73297152-73297174 ATTGGCTTCTAAAAGTGACTTGG - Intergenic
909540398 1:76785112-76785134 ATTTCTTTCTTTAAGAGATTGGG - Intergenic
909754271 1:79203920-79203942 TTGTCCTTCTATAAGAAACTTGG + Intergenic
909804753 1:79859871-79859893 ATTTACTTCTTGAAGAACCTAGG - Intergenic
911472048 1:98331158-98331180 CTTTCCTTCTATAACAGACTTGG + Intergenic
911950610 1:104169574-104169596 ATTTCCTTCTTGTAAAAACTTGG - Intergenic
911986965 1:104638984-104639006 ATTTCCTTTTAGAAATCACTAGG + Intergenic
913065430 1:115248439-115248461 ATTTCCTTCGAAAAGATACCAGG + Intergenic
917268289 1:173244924-173244946 ATGTCCTTCTAAAATAGAATGGG - Intergenic
917809331 1:178642285-178642307 ATTTCCTAATGGAAGAGCCTAGG + Intergenic
917883180 1:179359501-179359523 AGTTACTTTTAAAAGAGACTTGG - Intergenic
918385292 1:184001005-184001027 ATTTCTTTTTAGTAGAGACGGGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920680406 1:208068205-208068227 ATTTCCTTTTAACAGAGAATTGG - Intronic
922317375 1:224454704-224454726 CTTGCTTTCTAGAAGAGAATCGG + Intronic
923387972 1:233484365-233484387 ATTTCCTTCTAGCAGGGCTTTGG + Intergenic
923535684 1:234849750-234849772 ATTGCATTCTAGAAGAGACCTGG + Intergenic
924944508 1:248837637-248837659 ATTTCCTAGTAGAAGACATTAGG + Intergenic
1064342974 10:14503081-14503103 ATTTCCTTCTGAAAGGGACTTGG - Intergenic
1064819671 10:19312809-19312831 ATTTCCTTTCAGAAGAATCTGGG + Intronic
1066758340 10:38731870-38731892 ATTTACTTATTTAAGAGACTGGG - Intergenic
1066963316 10:42240819-42240841 ATTTACTTATTTAAGAGACTGGG + Intergenic
1067671298 10:48324532-48324554 ATTGGCTTCTTGAAGAGACCAGG + Intronic
1068835768 10:61551745-61551767 ATTTTCTGCTAAAAGAAACTAGG - Intergenic
1069086478 10:64145616-64145638 ATTTCCTTTTAGAAGAATTTAGG + Intergenic
1069095961 10:64259890-64259912 ATTTCCTCCTAGAGGACACAGGG + Intergenic
1071729656 10:88234823-88234845 ATCTGCTTTTAGAAGAGACCAGG + Intergenic
1072340462 10:94443313-94443335 ATTTCTTTTTTCAAGAGACTTGG + Intronic
1074647139 10:115469862-115469884 ATTTACTTCTAGGAAAGAATTGG + Intronic
1075258380 10:120943343-120943365 ATTCCCTCCTAGACGAGAATTGG + Intergenic
1077275879 11:1707654-1707676 AGTTCCTTTTGGGAGAGACTAGG - Intergenic
1078204949 11:9220718-9220740 TTTTATTTTTAGAAGAGACTGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079219910 11:18551252-18551274 ATTTCTTTTTAGTAGAGACAGGG - Intronic
1079641708 11:22813887-22813909 TTTTCCTTCCTGAAGAGTCTAGG + Intronic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1082212274 11:49519728-49519750 ATTTCCTGCTAGGAGAAATTTGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082889609 11:58124930-58124952 ATTTTGTCCTGGAAGAGACTAGG + Intronic
1085947593 11:81290631-81290653 ATTCTCTTCTAGTAGACACTGGG - Intergenic
1086637315 11:89104786-89104808 ATTTCCTGCTAGGAGAAATTTGG + Intergenic
1086940491 11:92792781-92792803 GTTTCCTTATCGAAGAAACTTGG + Exonic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087480660 11:98696199-98696221 ATCTCTTTTTAGAGGAGACTGGG + Intergenic
1089437657 11:118484023-118484045 ATTTTTTTTTAAAAGAGACTGGG - Intronic
1089922902 11:122227767-122227789 TTTTCTTTTTAGTAGAGACTGGG + Intergenic
1090222314 11:125038630-125038652 TTTTGGCTCTAGAAGAGACTTGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090638024 11:128704971-128704993 ATTTCCATTTTGAAGAGATTGGG + Intronic
1091859876 12:3771387-3771409 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
1092268625 12:7003472-7003494 ATTTTATTTTAGTAGAGACTGGG + Intronic
1093028888 12:14270020-14270042 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1093616835 12:21235873-21235895 ATTACAAGCTAGAAGAGACTGGG - Intronic
1095550900 12:43438362-43438384 ATATCCTTTTAGAAGATAATTGG - Intronic
1096816390 12:54204392-54204414 CTTTCCTTGGAGAAGAAACTTGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098321119 12:69244568-69244590 ATTTTATTTTAGAAGAGACAAGG + Intronic
1099654022 12:85466699-85466721 ATTTCCTTTTAGAAGACACAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101675267 12:106911596-106911618 ATTTCCTACTGGGAGAGAATGGG - Intergenic
1102596710 12:113998440-113998462 ATTTTTTTCTAGTAGAGACAGGG - Intergenic
1102971994 12:117176052-117176074 ATTTCCTTTTGGATGATACTAGG + Intronic
1103640419 12:122346925-122346947 ATTTCCTTCTCCAAGAGGCCAGG + Intronic
1103645448 12:122388745-122388767 ATTTCTTTTTTGTAGAGACTGGG + Intronic
1104229113 12:126866388-126866410 ATTTCCTTCCATGGGAGACTGGG - Intergenic
1105302453 13:19148608-19148630 ATTTCCTTAAAGCAGAGTCTGGG + Intergenic
1106148739 13:27076888-27076910 ATTGCTTTCTAGGAGTGACTAGG - Intronic
1106315465 13:28589622-28589644 AATTTCTTCTAGTAGAGACGGGG + Intergenic
1106382526 13:29253979-29254001 AATTCCTTCAAGATGAGATTTGG + Intronic
1106453162 13:29902958-29902980 ACTTCCTTCTGGAAGCCACTTGG + Intergenic
1106881733 13:34139100-34139122 ATGACCTCCTAGCAGAGACTTGG - Intergenic
1107677834 13:42815431-42815453 ATTTCAATCTAGAAGAAAATTGG - Intergenic
1109674464 13:65656412-65656434 ACGTTCTTCTAGAAGATACTTGG + Intergenic
1110074470 13:71221439-71221461 ATTTCTTCCTAGATGTGACTTGG + Intergenic
1110584585 13:77173576-77173598 CTTTCCTTCATGAAGAGTCTAGG - Intronic
1111326291 13:86700842-86700864 ATTTCCTTCAATAAGTGAATGGG + Intergenic
1111817521 13:93172449-93172471 ATTTCTTCCTAAAAGACACTTGG - Intergenic
1111887542 13:94041411-94041433 ATTGCCTTCTAGAAGGCATTAGG + Intronic
1112107898 13:96261925-96261947 AGTTCCTTCCATAAGAGCCTTGG - Intronic
1112266663 13:97930534-97930556 AATTCCTTCCTGAAGACACTGGG + Intergenic
1112773378 13:102817204-102817226 ATTGACTTATTGAAGAGACTTGG + Intronic
1112873997 13:104012868-104012890 ATTTACCTCTAGAAGCTACTGGG - Intergenic
1114312913 14:21484289-21484311 ATTTCCAGCTAGCAGAAACTAGG - Intronic
1115104398 14:29743244-29743266 ATTGTATTCTAGAAGAAACTGGG + Intronic
1116468728 14:45263028-45263050 ATTTTTTCCTAGAAGAGACTGGG + Intergenic
1117131760 14:52694670-52694692 ATTTCCTTCTGTAAGAGATGTGG - Intronic
1119078862 14:71673169-71673191 TTTCCCTTCTGGAAAAGACTAGG - Intronic
1119235104 14:73013102-73013124 ATTTCCTTCTACTTGAGACTAGG - Intronic
1119283466 14:73430765-73430787 ATTTTTTTCTAGTAGAGACGGGG - Intronic
1119558507 14:75571556-75571578 ATTCCCTTCTAGGACAGACTTGG + Intergenic
1120266882 14:82262317-82262339 ATTTCCAACTGGAAGAGAATGGG - Intergenic
1120800509 14:88682990-88683012 AGTTCCTTTGAGAAGAGATTAGG - Intronic
1121804511 14:96804829-96804851 ACTGCCTTCTAGAAAATACTAGG - Intronic
1121834923 14:97083523-97083545 ATTTTTTTATAGTAGAGACTGGG + Intergenic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1123441744 15:20296588-20296610 ATTTACTTATTTAAGAGACTGGG - Intergenic
1124682442 15:31746291-31746313 ATGTCCATCAAGAAGAGAATGGG + Intronic
1125661466 15:41398184-41398206 TTTTCTTTTTATAAGAGACTGGG + Intronic
1125685507 15:41561044-41561066 GCTACCTTCTAGAAGAGAATGGG + Intronic
1126418568 15:48445934-48445956 ATCTCCTTCTAAAACATACTAGG - Intronic
1126828973 15:52579785-52579807 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1128948871 15:71853493-71853515 GGTTCCGTCTACAAGAGACTTGG - Intronic
1129383697 15:75184114-75184136 ATTTTTTTCTAGTAGAGACGGGG + Intergenic
1132773534 16:1578705-1578727 ATTTCTTTTTAGTAGAGACGGGG - Intronic
1133128931 16:3664452-3664474 ATGTCCTCCTAGAAGGGACGGGG + Exonic
1133891539 16:9883877-9883899 ATTTCCTTCAGGAAGACACAAGG + Intronic
1134454926 16:14388172-14388194 ACTGACTTCTAGAAGAGTCTAGG - Intergenic
1135583979 16:23653227-23653249 ATTTCCTTCTAGAGTAGCCAAGG + Intronic
1135829485 16:25760854-25760876 AGTGACCTCTAGAAGAGACTTGG + Intronic
1136719457 16:32308924-32308946 ATTTACTTATTTAAGAGACTGGG + Intergenic
1136724485 16:32347325-32347347 ATTTACTTATTTAAGAGACTGGG + Intergenic
1136837829 16:33515204-33515226 ATTTACTTATTTAAGAGACTGGG + Intergenic
1136842812 16:33553365-33553387 ATTTACTTATTTAAGAGACTGGG + Intergenic
1137279822 16:46966266-46966288 ATTTCCTTCCTGGAGAGTCTTGG - Intronic
1137378667 16:47977204-47977226 ATTTCTCTGTAGAAGAGACCAGG + Intergenic
1137959911 16:52872134-52872156 ATTCTCTTCTGGAAGAGACATGG - Intergenic
1138202909 16:55103245-55103267 ATCTTCCTCTAGATGAGACTTGG - Intergenic
1138218022 16:55222614-55222636 ATTTCCTTCGAGAAGTGATGGGG + Intergenic
1142442616 16:90109594-90109616 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1203001945 16_KI270728v1_random:170430-170452 ATTTACTTATTTAAGAGACTGGG - Intergenic
1203006974 16_KI270728v1_random:208845-208867 ATTTACTTATTTAAGAGACTGGG - Intergenic
1203133549 16_KI270728v1_random:1706836-1706858 ATTTACTTATTTAAGAGACTGGG - Intergenic
1203152977 16_KI270728v1_random:1853663-1853685 ATTTACTTATTTAAGAGACTGGG + Intergenic
1143131933 17:4684151-4684173 ATCTCCTGCTAGACGAGACGAGG + Intronic
1146970967 17:37072104-37072126 ATTTACTTTTAGTAGAGACGGGG + Intergenic
1147532177 17:41289707-41289729 ATTTCATTCTAATAGACACTGGG + Intergenic
1148228882 17:45918883-45918905 ATTTTATTTTAGAAGAGACAGGG - Intronic
1149813671 17:59703019-59703041 ATTTCCTTTTCTAAGAGACAGGG + Intronic
1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG + Intronic
1151017595 17:70575002-70575024 ATTTTATTCTAGAAGAAAATAGG + Intergenic
1152141055 17:78536999-78537021 ATTTTTTTTTAGTAGAGACTGGG - Intronic
1152731477 17:81973659-81973681 ATTTCCTTGTAAAAGGGATTGGG + Intergenic
1153166471 18:2267329-2267351 ATTTCCTTGGAGAAGAGATCCGG + Intergenic
1153608929 18:6862223-6862245 CCCTCCTTCTAGAAGAGACTGGG - Intronic
1154011918 18:10581510-10581532 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
1155869965 18:31015097-31015119 ATTTCCTTCATGTAGAAACTAGG + Intronic
1157612547 18:48967170-48967192 ATTTCTTTTTAGTAGAGACAGGG - Intergenic
1157903479 18:51543418-51543440 AGTCACTTCTACAAGAGACTAGG - Intergenic
1159746169 18:72237816-72237838 ATATCCTTCAAGGAGAGACAAGG + Intergenic
1160322458 18:77908707-77908729 ATTTCATTTTACAAGATACTGGG - Intergenic
1164188082 19:22889695-22889717 ATTTTATTTTAGAAGAGACAGGG - Intergenic
1164700256 19:30279882-30279904 CTTTCCTTCCAGAAAAGAGTTGG - Intronic
1164710848 19:30356240-30356262 CTTTCCTTCTGGAAGTCACTGGG - Intronic
1165566023 19:36728391-36728413 ATTTCCTGCTAAAAGAAACCAGG + Intronic
1167254729 19:48420252-48420274 ATGTACTTTTAGAAGAGACGGGG - Intronic
1167405775 19:49307491-49307513 ATTTTCTTCTAGAAGATGCCTGG - Intronic
1167572273 19:50296300-50296322 GTTTCCCTCTAAAAGAAACTGGG + Intronic
1168359235 19:55724732-55724754 ATATCTTTCATGAAGAGACTGGG - Intronic
925764063 2:7214068-7214090 TCTTCCTTCTAGAGGACACTGGG + Intergenic
926032393 2:9603445-9603467 ATTTTTTTTTAGAAGAGACGGGG + Intronic
926043517 2:9693163-9693185 AATACCTTCTAAAAGAGATTTGG + Intergenic
926126062 2:10272557-10272579 ATGTCCTTTAAGAAGAGATTAGG + Intergenic
926752455 2:16208989-16209011 ATTACCTTCTAGGAGAAGCTGGG + Intergenic
927675819 2:25105321-25105343 ATTTGTTTTTAGAAGAGACGGGG + Intronic
928318601 2:30265624-30265646 ATTTCCTTCTAGCATAGAAGTGG - Intronic
928908817 2:36397530-36397552 TTTTCCCTCAAGAAGAAACTGGG - Intronic
929080386 2:38116553-38116575 ATTTCTTTCTAGAAGTCCCTAGG - Intergenic
929160339 2:38825750-38825772 TTTTACTTCTAGAAGATATTTGG - Intronic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
929911476 2:46093159-46093181 ATTTCCTTCCATTAGAGACTCGG - Intronic
931596740 2:63954116-63954138 ATTTCCTACTAAAAGAAAGTAGG + Intronic
931814555 2:65887984-65888006 TTCTCCATCTGGAAGAGACTGGG - Intergenic
933303149 2:80565562-80565584 AGTTCTTTCCAAAAGAGACTAGG + Intronic
933370461 2:81408676-81408698 ATTTTTTTCTAGTAGAGACGGGG + Intergenic
933537545 2:83595543-83595565 ATTGCTTACTACAAGAGACTGGG - Intergenic
934321657 2:91976310-91976332 ATTTACTTATTTAAGAGACTGGG - Intergenic
935274630 2:101465330-101465352 ATTTTATTTTAGTAGAGACTGGG - Intronic
936493433 2:112996007-112996029 ATTTCATTGTAGAAGACAGTTGG + Intergenic
937556432 2:123163720-123163742 ATTTCTTTCTTGAGGACACTTGG - Intergenic
937644847 2:124255076-124255098 ATTTTGTACTAGAAGAGAATAGG + Intronic
938413879 2:131088386-131088408 ATTGCCTTATTGAAGAAACTGGG - Intronic
939320357 2:140612140-140612162 TTTTTCTTCTAGTATAGACTAGG - Intronic
939452779 2:142395456-142395478 ATTTCTTACCAGAAGAGATTGGG - Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
941035846 2:160568324-160568346 ATTGACTTCTTAAAGAGACTAGG + Intergenic
941081654 2:161068326-161068348 ATTTCCTTCTAGAGAAGAAAGGG - Intergenic
942027774 2:171927565-171927587 ATTTCCTACTAAAAGAAACCAGG - Intronic
942628557 2:177930591-177930613 ATTTCCAGATAGAAGAGGCTTGG - Intronic
943239019 2:185361104-185361126 ACTTCATTCCAGAAGGGACTGGG + Intergenic
946939535 2:224756612-224756634 ATTACCTTCTCCAAAAGACTTGG + Intergenic
947532048 2:230915437-230915459 ACTTCCTTCTGGAGGAGGCTGGG - Intronic
948292154 2:236833609-236833631 AATTCCTTTTAGATGAGAATGGG - Intergenic
1168915426 20:1481607-1481629 ATTTCCTTCTAAGAGGGTCTAGG + Intronic
1169562863 20:6820748-6820770 ATTTTCTTCCAAAGGAGACTTGG - Intergenic
1171115681 20:22523030-22523052 CTTTCTTTCTAGAAAAGCCTTGG + Intergenic
1171792370 20:29538945-29538967 ATTTAATTTTAGAAGAGACTGGG - Intergenic
1172765309 20:37347555-37347577 AGTTCATTCTAGAAGAGGATGGG + Intronic
1172792091 20:37512745-37512767 CTTTCCTTCTAGGAAAGACTGGG + Intronic
1174785730 20:53430655-53430677 TTTTCCTTTTAGAAGAGATGGGG - Intronic
1175917694 20:62434550-62434572 ATTTCCTTCTGGAAAGGGCTTGG - Intergenic
1176984909 21:15424670-15424692 ACTTCCTTCTAACAAAGACTAGG - Intergenic
1177041127 21:16112824-16112846 ATTTCCTGCTAGTACAGATTTGG + Intergenic
1178092966 21:29183730-29183752 ATTTTTTTCTAGCAGAGACAGGG + Intergenic
1178250709 21:31000753-31000775 ATTTCATTCAAGAAGAGCATTGG - Intergenic
1179912804 21:44459335-44459357 ATTTCCTTCCAGAGGACACGTGG + Exonic
1180791221 22:18576773-18576795 AACTCCTACTAGAAAAGACTAGG + Intergenic
1181016099 22:20069808-20069830 AGTGCCTTCTAGAAGAGCTTTGG + Intergenic
1181230517 22:21418541-21418563 AACTCCTACTAGAAAAGACTAGG - Intronic
1181248133 22:21516328-21516350 AACTCCTACTAGAAAAGACTAGG + Intergenic
1182016866 22:27047728-27047750 ATTTCCCTAAAGTAGAGACTAGG - Intergenic
1182211058 22:28678219-28678241 ATTTACTTATTTAAGAGACTGGG + Intronic
1183223185 22:36530366-36530388 TTTTCCTTTTAGTAGAGACGGGG + Intergenic
1183539371 22:38420768-38420790 ATTGCCTTCTGGAAGGGATTTGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183993493 22:41615122-41615144 ATTTTTTTTTAGAAGAGACGGGG - Intronic
950762700 3:15247406-15247428 AATTCCATATAGAAAAGACTGGG + Exonic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952584227 3:34871996-34872018 CTTTCCTTCTACAGGAGAGTGGG - Intergenic
953524491 3:43677374-43677396 TTGTACTTTTAGAAGAGACTGGG - Intronic
953769376 3:45766963-45766985 ATTTACTTTTAGTAGAGACAAGG - Intronic
954824625 3:53361823-53361845 ATGCCCTTCTAAAAGATACTTGG - Intergenic
955568264 3:60273260-60273282 AATTTCCTCTAGAAGAGAATTGG - Intronic
955998036 3:64698066-64698088 ATTTCCTTCTAGATCAGTTTTGG - Intergenic
957005155 3:74936801-74936823 ATATCCTTCTAGGAAAGATTGGG - Intergenic
959978306 3:112486160-112486182 ATTTCATTATATAAGAGCCTGGG - Intronic
961709279 3:128814822-128814844 TTTTCCTTCTTCAAGAGCCTTGG + Intergenic
962763503 3:138540320-138540342 ATTTACTTTTAGTAGAGAGTGGG - Intronic
963145117 3:141985874-141985896 ATTTCCATCTAGAATATACAAGG + Intronic
966000013 3:174937495-174937517 ATTTCCTTCTATAACAAAATTGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967521390 3:190436763-190436785 ATTTGCTTCCAGAAGTTACTAGG + Intronic
968325177 3:197807393-197807415 ATTTCTTTTTAGTAGAGACGGGG + Intronic
968362888 3:198160554-198160576 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
969210671 4:5684832-5684854 GTGTCCTTATAGAAGAGGCTAGG + Intronic
969730396 4:8952925-8952947 TTGTATTTCTAGAAGAGACTGGG + Intergenic
970634115 4:17988443-17988465 ATTTTATTTTAGTAGAGACTAGG + Intronic
972078078 4:35111661-35111683 ATCCCATTCTAGAAGAGAGTTGG + Intergenic
972092957 4:35311572-35311594 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
972204064 4:36749472-36749494 CCTTCCATCTAGCAGAGACTGGG + Intergenic
974317981 4:60306700-60306722 ATTTCCTTCTATCACAGACCTGG - Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
975251373 4:72182828-72182850 ATTTTTTCCTTGAAGAGACTAGG - Intergenic
975525561 4:75345482-75345504 ATTTCCTTCAGCAAGAGAGTTGG - Intergenic
975936760 4:79590964-79590986 ATTTGCTTCTTTATGAGACTTGG + Intergenic
976015212 4:80544018-80544040 ATTACCAGCTAGAAAAGACTGGG + Intronic
976140904 4:81990582-81990604 ATTTACTACTAGCAGAGAATGGG - Intronic
976916258 4:90378960-90378982 TTATTTTTCTAGAAGAGACTAGG - Intronic
979994446 4:127413749-127413771 ATTCCATTCTGGAAAAGACTGGG + Intergenic
980680219 4:136151159-136151181 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
980747229 4:137034452-137034474 ATTTCTTTTTGGAAGAGACGGGG - Intergenic
980913214 4:139011855-139011877 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
980913231 4:139011974-139011996 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
981614592 4:146633747-146633769 ATTTCTTTCTAGAAGGGCCTGGG + Intergenic
981816643 4:148838364-148838386 ATGTCTTTCTTTAAGAGACTGGG - Intergenic
981922370 4:150099229-150099251 ATTTCTTTTTAGTAGAGACATGG + Intronic
982043895 4:151422561-151422583 ATTTCTTTTTAGTAGAGACGGGG + Intronic
982863641 4:160483916-160483938 AATACCTTCTTGAAGAGAGTGGG + Intergenic
983195964 4:164807005-164807027 TTTTCCTTTATGAAGAGACTTGG - Intergenic
983564419 4:169134137-169134159 AGTTATTTCTAGAAGAGGCTGGG - Intronic
983620752 4:169758370-169758392 ATTTCCTTCTTGGAGACAATCGG - Intergenic
985304103 4:188520568-188520590 AATTCATTCAAGAAGAGATTTGG - Intergenic
986488970 5:8270031-8270053 ATTTCTTCCTAGCAGAGACTGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990689776 5:58350625-58350647 ATTTCCCTGCAGAAGAGGCTAGG - Intergenic
991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG + Intergenic
991653165 5:68876776-68876798 TTTTCCTTTTAAAAGAGACAGGG - Intergenic
992843387 5:80719023-80719045 ATTTCCTACTAAAAGAAACTAGG - Intronic
993771487 5:91933334-91933356 ATGCCCTTCTAAAAGAAACTTGG - Intergenic
995033009 5:107500520-107500542 ATTTTTTTCTAGAAGAGAGCAGG + Intronic
995772095 5:115681871-115681893 ATTTCGTTTTAGAAAAAACTAGG - Intergenic
995773273 5:115696044-115696066 ATTTACTTGTAGAAGAGCATGGG + Intergenic
995900356 5:117058724-117058746 AATTCCTTGTAGGTGAGACTAGG - Intergenic
996301287 5:121989238-121989260 ATTTCTTTTTAGTAGAGACGGGG + Intronic
996878406 5:128265144-128265166 ATTTCTATATACAAGAGACTTGG + Intronic
997261237 5:132466861-132466883 ATTTCCTTTGAGAAAAGATTCGG - Intronic
997860713 5:137412868-137412890 ATTTCCTTCAACAGAAGACTTGG + Intronic
998865231 5:146492579-146492601 ATTTCTTTCTAAAAGGGATTTGG + Intronic
999935370 5:156480433-156480455 TTTTTATTCAAGAAGAGACTGGG - Intronic
1001968661 5:175936011-175936033 ATTTACTTGTTGAAGACACTGGG - Intronic
1004409811 6:15370513-15370535 ATTTTCTTTTAGTAGAGACAGGG + Intronic
1004907930 6:20253932-20253954 ATTTCCCTCTAAAAGAAACCAGG - Intergenic
1005858962 6:29887286-29887308 GTTTTCTTCTAGAAGAGTCCAGG + Intergenic
1005866514 6:29942067-29942089 TTTTTCTTCTAGAAGAGTCCAGG + Exonic
1005998427 6:30946686-30946708 CTTTCCTTCTTTAAAAGACTGGG + Intronic
1006862558 6:37182681-37182703 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1009523127 6:64710054-64710076 ATTTCCTTTTAGAAAAGAGGGGG + Intronic
1011335455 6:86254764-86254786 ATTTCCTCCCAGCAGGGACTCGG - Intergenic
1012487499 6:99738490-99738512 ATTACCTTCTATAATAGAGTGGG + Intergenic
1014130035 6:117820432-117820454 ATTGACTTCTATAATAGACTTGG + Intergenic
1014684706 6:124482106-124482128 ATTTGCTTTGGGAAGAGACTTGG - Intronic
1015859394 6:137659803-137659825 ATTTCCTTCTATAACATACCTGG - Intergenic
1016050295 6:139523596-139523618 CTTTCATTGTAGAAGAGACAAGG + Intergenic
1019252793 7:28157-28179 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
1020805143 7:12780507-12780529 ATTTACTTCTTAAAGAGTCTGGG - Intergenic
1020999929 7:15316210-15316232 ATTTACATATTGAAGAGACTAGG + Intronic
1021900720 7:25282450-25282472 ATTTCCTTATAGATAAGAGTAGG - Intergenic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023246497 7:38210519-38210541 TTTTCCTTCTAGAAGATCTTAGG + Intronic
1023573806 7:41602877-41602899 ATTTTCTTAAAGAAGAGACTAGG - Intergenic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1023855662 7:44182085-44182107 ATTGCATTCTGGAGGAGACTGGG - Intronic
1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG + Intronic
1023915370 7:44584574-44584596 ATTTACTTATTGAAGAAACTGGG + Intergenic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1024505630 7:50159041-50159063 ATTTCTTTCTGGAAGACGCTGGG - Exonic
1024952515 7:54879525-54879547 AATTCCTTCTAGGAGATACCAGG + Intergenic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1026183527 7:68063011-68063033 ATTTCTTTTTAGTAGAGACGGGG - Intergenic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1026799455 7:73390241-73390263 AGTTCCTTTGGGAAGAGACTTGG + Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027150411 7:75729611-75729633 TTGTACTTTTAGAAGAGACTAGG - Intronic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027941292 7:84684272-84684294 ATCTCATCCTAGATGAGACTTGG + Intergenic
1027968128 7:85040150-85040172 ATTTACTTTTTGTAGAGACTGGG + Intronic
1028108002 7:86902908-86902930 ATATTCTTGTAGAAGACACTGGG - Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029978820 7:104859088-104859110 ATTTTTTTTTAGTAGAGACTGGG - Intronic
1030590297 7:111472921-111472943 TTTTTCTTTTAGTAGAGACTTGG - Intronic
1032007318 7:128313485-128313507 ATTTCGTTGTAGTAGAGACGGGG - Intronic
1033415803 7:141160407-141160429 ATCTCCTCCCAGAAGAGACTTGG + Intronic
1033722239 7:144074199-144074221 ATTTCCCTGTAGAAGAAACAAGG - Exonic
1036500428 8:9309191-9309213 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1038079775 8:24120971-24120993 ATTTCCTTCAAGAGGAAAGTAGG + Intergenic
1038348662 8:26756357-26756379 ATTTACTTATTGAAGAAACTGGG + Intronic
1039498368 8:37998237-37998259 TTTTACTTCTTGTAGAGACTGGG - Intergenic
1041331412 8:56729478-56729500 GTTTCCTTCTAAATAAGACTAGG + Intergenic
1042724653 8:71860615-71860637 ATTGCTTTCTGGAAGAGATTGGG + Intronic
1042803757 8:72749291-72749313 TTTTCTTTTTAGAAGAGACGAGG + Intronic
1045788511 8:105954845-105954867 ATTGACTTCTATAAGAGAGTAGG - Intergenic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046935102 8:119878185-119878207 ATTTATTTTTAGAAGAGACGAGG + Intronic
1047361572 8:124174127-124174149 CTTTCCCTCTAGGAGACACTAGG - Intergenic
1047795038 8:128246824-128246846 ATTTCCTTTTAAAAGCCACTTGG + Intergenic
1048095475 8:131287600-131287622 ATTGACTTCTGGAAGAGTCTAGG - Intergenic
1048641953 8:136373354-136373376 TTTACCTTTTAGAAGAGTCTAGG - Intergenic
1050518380 9:6470198-6470220 TTTTCCTTTTAGTAGAGACATGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1053119586 9:35536638-35536660 TTTTACTTTTAGAAGAGACGGGG - Intronic
1055174012 9:73295803-73295825 GTTTCCTTCTAGAAAATATTTGG + Intergenic
1055804986 9:80082757-80082779 ATTTCCTTCTAGAATATTTTAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058345775 9:103959834-103959856 AAGTCCTTCCAGAAGAGACCAGG + Intergenic
1059556849 9:115289924-115289946 ATTTGCTTCTAGAAAATTCTAGG - Intronic
1061323302 9:129846101-129846123 ATTTTCTTTTAGTAGAGACGGGG + Intronic
1061655873 9:132089622-132089644 TTGTCCTTTTAGTAGAGACTGGG + Intergenic
1062659624 9:137622729-137622751 TTTTACTTCTAGTAGAGACAAGG - Intronic
1062747576 9:138224217-138224239 ATTTTTTTTTAGTAGAGACTGGG + Intergenic
1186515172 X:10161408-10161430 ATTACCTTGTTGAAGAGACAAGG - Intronic
1186800742 X:13090127-13090149 ATTTCCTTCTAGAACAACCCTGG - Intergenic
1187152211 X:16691680-16691702 ATTTCTTTTTACAAGAAACTTGG + Intronic
1189499900 X:41546648-41546670 TTTTCCTTTTAGTAGAGACGGGG + Intronic
1192385995 X:70670569-70670591 ATTTGTTTCTAGAGGTGACTTGG - Intronic
1193552787 X:82918879-82918901 ATTTCCATCAAGAGTAGACTGGG - Intergenic
1195716206 X:107820698-107820720 TTTTCCTTCTGGAACAGTCTGGG + Intergenic
1195716358 X:107822236-107822258 TTTTCCTTCTGGAACAGAATGGG + Intergenic
1196249617 X:113445473-113445495 ATTTTTTTTTAGTAGAGACTGGG - Intergenic
1196539151 X:116884318-116884340 GTTTCCTTTTAGCAAAGACTGGG - Intergenic
1199231187 X:145437683-145437705 ATTTTCTTCTAGAAGATGCCTGG - Intergenic
1201189146 Y:11431436-11431458 ATTTACTTATTTAAGAGACTGGG - Intergenic
1201456976 Y:14178707-14178729 ATCTCCTGCTCGAAGAAACTTGG + Intergenic
1202086233 Y:21139747-21139769 ATATCCCTCTATTAGAGACTAGG + Intergenic