ID: 1150121653

View in Genome Browser
Species Human (GRCh38)
Location 17:62608465-62608487
Sequence CCCTGAATACAGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150121653_1150121656 -7 Left 1150121653 17:62608465-62608487 CCCAGCTTCATCTGTATTCAGGG 0: 1
1: 0
2: 3
3: 23
4: 175
Right 1150121656 17:62608481-62608503 TTCAGGGATTATGATTAATTTGG 0: 1
1: 0
2: 1
3: 18
4: 275
1150121653_1150121659 13 Left 1150121653 17:62608465-62608487 CCCAGCTTCATCTGTATTCAGGG 0: 1
1: 0
2: 3
3: 23
4: 175
Right 1150121659 17:62608501-62608523 TGGGGAGCTAATGCCCATGTAGG 0: 1
1: 0
2: 0
3: 9
4: 87
1150121653_1150121657 -6 Left 1150121653 17:62608465-62608487 CCCAGCTTCATCTGTATTCAGGG 0: 1
1: 0
2: 3
3: 23
4: 175
Right 1150121657 17:62608482-62608504 TCAGGGATTATGATTAATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 250
1150121653_1150121658 -5 Left 1150121653 17:62608465-62608487 CCCAGCTTCATCTGTATTCAGGG 0: 1
1: 0
2: 3
3: 23
4: 175
Right 1150121658 17:62608483-62608505 CAGGGATTATGATTAATTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150121653 Original CRISPR CCCTGAATACAGATGAAGCT GGG (reversed) Intronic
901738071 1:11324845-11324867 CCCTGCATACTGATGAAGCCGGG - Intergenic
901964693 1:12856813-12856835 CCCCAAATACTGATGAAGTTTGG - Intronic
901980095 1:13027287-13027309 CCCCAAATACTGATGAAGTTTGG - Intronic
902001989 1:13201644-13201666 CCCCAAATACTGATGAAGTTTGG + Intergenic
902021214 1:13347369-13347391 CCCGAAATACTGATGAAGTTTGG + Intergenic
904541855 1:31238940-31238962 CCCAGAACACAGATGAACATGGG + Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905991288 1:42339000-42339022 TTCAGAATTCAGATGAAGCTAGG - Intergenic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
906327017 1:44852941-44852963 AGCTGAATGCAGATGAAGGTTGG + Intronic
907747546 1:57228472-57228494 CCCTGAATACATCTGAGGTTAGG - Intronic
910887300 1:91978552-91978574 CCCTGCATACAAAGGAAACTGGG + Intronic
915722854 1:157996599-157996621 CCCTGAGTACAGCTGAATCCTGG + Intronic
916407162 1:164508906-164508928 TCTTAAATTCAGATGAAGCTGGG - Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917896413 1:179492493-179492515 CACTGAATAAAGATGAAGTCTGG + Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920779206 1:208971605-208971627 CCCAGAATGCAGACAAAGCTAGG + Intergenic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
924165079 1:241272560-241272582 GCCTGGATACAGATGGGGCTAGG - Intronic
924404634 1:243730234-243730256 CCTTGAGTCCAGCTGAAGCTGGG - Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1063841600 10:10078543-10078565 CCCTGAAGAATGATGAAGCCTGG + Intergenic
1067730569 10:48807937-48807959 CTCAGAGGACAGATGAAGCTGGG - Exonic
1068595095 10:58894754-58894776 CCAAGAATACAGATGAATTTGGG + Intergenic
1069070617 10:63987638-63987660 ACTAGAATACAGATGAAGGTTGG + Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1071552879 10:86580770-86580792 ACCTGAAGAGAGAGGAAGCTGGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075673225 10:124278444-124278466 CCCTAAATCCAGGTGTAGCTTGG + Intergenic
1075684584 10:124354599-124354621 CACTGAGGACAGGTGAAGCTGGG + Intergenic
1078000751 11:7493547-7493569 CCCTGAATACCGAAATAGCTGGG - Intronic
1078546066 11:12247893-12247915 CCCTGAATTCAGGTGAACTTGGG - Intronic
1078652136 11:13205805-13205827 GCCTGAAAACAGGAGAAGCTGGG - Intergenic
1079333087 11:19549513-19549535 CCCTGACTACAGAGGAAGGAGGG + Intronic
1080415135 11:32062805-32062827 CCCTGAATGCAGTGAAAGCTGGG - Intronic
1082745089 11:56952273-56952295 CCCTTAATACATTTGAAGATGGG + Intergenic
1083337003 11:61928371-61928393 CCCTCAAAATACATGAAGCTAGG + Intergenic
1083337020 11:61928491-61928513 CCCTCAAAATACATGAAGCTAGG + Intergenic
1083404901 11:62449789-62449811 CCCACATTACAGATGAGGCTAGG - Intronic
1083414217 11:62514851-62514873 CGGTGAGGACAGATGAAGCTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084879333 11:72159096-72159118 CCCTGAATAGAACTGGAGCTGGG - Intergenic
1092548573 12:9472951-9472973 TCCTTTATACAGAGGAAGCTTGG - Intergenic
1094007165 12:25767209-25767231 CACACAATATAGATGAAGCTCGG - Intergenic
1094297379 12:28922936-28922958 CCCTGAAGACAGTAGAAACTTGG - Intergenic
1094504428 12:31049498-31049520 TCCTTTATACAGAGGAAGCTTGG + Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1096317968 12:50585371-50585393 CCTTGTAGACAGATGAAGCGTGG + Intronic
1098597651 12:72293412-72293434 CCCAGATTACAGATGGACCTAGG + Intronic
1099577898 12:84403957-84403979 CCCTGAATAAAGGGGATGCTGGG + Intergenic
1100612150 12:96200298-96200320 CTCTTAAGACTGATGAAGCTAGG + Intronic
1101812532 12:108120216-108120238 CCCTGAATGTAGATGTAGATGGG - Intergenic
1101962631 12:109261358-109261380 CCCTGAATGCAGGACAAGCTTGG - Intronic
1102164588 12:110796242-110796264 CCCTGAGGTCAGATGAAGCCTGG + Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1104322069 12:127761285-127761307 CCCTGAAGTCAGATGGCGCTGGG - Intergenic
1105811409 13:23999561-23999583 CCCTGACTCCAGATGGAGTTGGG - Intronic
1106424741 13:29615786-29615808 CCCTGAAGACAGCAGAAACTTGG - Intergenic
1108889015 13:55229563-55229585 CCTTGAATACAGAGGAGGTTGGG + Intergenic
1111646675 13:91040213-91040235 CCCCCAATACAGATGCAGGTTGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118755817 14:68843258-68843280 CCCTGGTCACAGATGAGGCTGGG - Intergenic
1118919130 14:70133777-70133799 CCAGGAATACAGAAGAAGATGGG + Intronic
1121691494 14:95880675-95880697 CCTTGAACTCAGCTGAAGCTGGG + Intergenic
1126577338 15:50210040-50210062 CTTTGAATACAGCTGAAGGTGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1128523742 15:68393151-68393173 CCCTGAAGACAGATGAATAGAGG + Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1129123214 15:73415993-73416015 TTCTGAATACAGGAGAAGCTAGG + Intergenic
1133154762 16:3865491-3865513 GCCTGAATACAGATAAACCCTGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134277932 16:12793027-12793049 CCCTGTAGGCAGATGCAGCTTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1139283345 16:65788546-65788568 CCCTGAATGCACATGGACCTGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147142500 17:38467196-38467218 CCCGCAAGACAGATGAACCTTGG + Exonic
1147675991 17:42206018-42206040 CCCTGAAGACAAATAAAGCAAGG - Intronic
1148489652 17:48014781-48014803 GCCTGAAAACAGTTGAATCTGGG - Intergenic
1148489686 17:48014953-48014975 GCCTGAAAACAGCTGAATCTGGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153939212 18:9962891-9962913 CCCTGTTTACAGAGGAAGCTGGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445693 18:25910976-25910998 CCATAAATACAGATCAAGGTGGG + Intergenic
1158696692 18:59709948-59709970 CACTCCATACAGATGAAGCAGGG + Intergenic
1159453336 18:68630196-68630218 CACTGAATACATATGCAGGTGGG - Intergenic
1159714173 18:71800358-71800380 CCTTGAAGATAGATGATGCTGGG + Intergenic
1160333522 18:78016876-78016898 ACCTGAATATACCTGAAGCTTGG + Intergenic
1160333542 18:78017052-78017074 ACCTGGATACACCTGAAGCTTGG + Intergenic
1161261486 19:3340256-3340278 CCCAGAAAACAGAAGCAGCTTGG + Intergenic
1162334307 19:10050858-10050880 CCCTGAATAAACATAGAGCTGGG + Intergenic
1164770398 19:30803988-30804010 CCCTGAATTCAGCTGAGGTTAGG - Intergenic
929574072 2:43041358-43041380 CCCTGAATGGAGATGGGGCTGGG - Intergenic
929911393 2:46092478-46092500 TCCTGAGTACAGAAGAATCTAGG - Intronic
931709178 2:64973043-64973065 CCAGGGATCCAGATGAAGCTGGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933311430 2:80666094-80666116 CCCTCAATGAAGATGAAGCTGGG - Intergenic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
945401128 2:209384587-209384609 CTCTGAATAAAGATGAATATAGG + Intergenic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
947370634 2:229442014-229442036 CCCTTGCTACAGATGCAGCTGGG + Intronic
947948444 2:234126734-234126756 CCCTGAGTACAGAGGAATCCCGG - Intergenic
948329638 2:237155010-237155032 ACCTGAGGCCAGATGAAGCTGGG - Intergenic
948884241 2:240874966-240874988 CCCTGAGCACAAATGCAGCTGGG + Intronic
1169686470 20:8279322-8279344 CCTAGAAGACAGATGAAGCTTGG + Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175390550 20:58624600-58624622 CTCTGAAAACACATGAAGCACGG - Intergenic
1176069747 20:63219896-63219918 CCCTGAATTCAGATGATCCCTGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179467578 21:41587334-41587356 TCCTGAAGACAGAAGAAACTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183390329 22:37542037-37542059 TCCTGATTACAAATGAAACTAGG + Intergenic
1183852629 22:40603912-40603934 CCCTGAATACTGTTGAAACTGGG + Intronic
951262050 3:20521864-20521886 TCCTGAATACAGTAGAAACTTGG + Intergenic
952321084 3:32278241-32278263 ATCTGACTGCAGATGAAGCTGGG + Intronic
958638004 3:96770278-96770300 CTCTGAATTCAGATGAACCCAGG + Intergenic
958885083 3:99716963-99716985 CCTTGATTCCATATGAAGCTGGG - Intronic
959079107 3:101780923-101780945 CCTTGAAAAAAGATGAAGCAGGG - Intronic
960398078 3:117161569-117161591 CACACAATACAGATGATGCTGGG - Intergenic
962632413 3:137292194-137292216 CACTGAATACTGATGATGTTAGG - Intergenic
963522330 3:146371217-146371239 TCCTGAAGACAGAGGAAACTTGG + Intergenic
964419625 3:156487705-156487727 CCCTTAATACAGAAGAATATTGG - Intronic
966780611 3:183581014-183581036 CCCTCAATGCAGAGGAGGCTGGG - Intergenic
967918040 3:194593506-194593528 CACTGACTACAAATGAATCTTGG - Intronic
969684837 4:8665625-8665647 CTCTGTATCCAGATGAAGCCCGG + Intergenic
971802871 4:31315728-31315750 GCATGAATACAGAGGAAGGTGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973544325 4:51965706-51965728 CACTCAATGCAGATGTAGCTGGG - Intergenic
973633205 4:52838684-52838706 CCATGAAGCCAGATGAAACTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
976818157 4:89174447-89174469 TCCTGAACACAGAAGCAGCTAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978263737 4:106795838-106795860 ACATGAATACTGATAAAGCTTGG + Intergenic
979059794 4:116043486-116043508 TCCTGGTTACAGATGAAGATCGG + Intergenic
980269712 4:130568337-130568359 CCCTGAAGACAAATCATGCTAGG + Intergenic
980552750 4:134361426-134361448 ACCTGTATACAGATAAAGCAGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
984545964 4:181102934-181102956 CGCTTTATACACATGAAGCTAGG + Intergenic
986457419 5:7933298-7933320 TTCTGAATACAGTTGAAGATTGG + Intergenic
988166121 5:27591119-27591141 AGCTGAATAGAGAGGAAGCTGGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
992739527 5:79759335-79759357 ACCTGAATGCAAATGAAGCATGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995614752 5:113949307-113949329 CCCTGAGTTCACATGAAGTTAGG - Intergenic
996672756 5:126137583-126137605 CCATGAATCCAGATTAAGCCTGG + Intergenic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
998149369 5:139748096-139748118 ACGTGAATACAGATGTGGCTCGG - Intergenic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
1000155447 5:158546950-158546972 TGCTGGATTCAGATGAAGCTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1012858317 6:104528760-104528782 TCCTAGATAAAGATGAAGCTAGG - Intergenic
1013269760 6:108534815-108534837 GTCTGAATCCAAATGAAGCTGGG - Intergenic
1015318404 6:131843730-131843752 CCATGATTTCAGATTAAGCTGGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017549281 6:155487999-155488021 CCTTGAAAAGAGATGAAACTTGG + Intergenic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1021930456 7:25576302-25576324 CCTTTAAGACAGATGTAGCTTGG + Intergenic
1022263692 7:28732374-28732396 GCCTGAATTCAGATGCATCTGGG + Intronic
1022513808 7:30962872-30962894 CCCTAAATCCAGATGTAGCGGGG + Intronic
1025017305 7:55449588-55449610 CCCTGAAGGCAGCTGAAGGTTGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1031572604 7:123377545-123377567 CCCGGAACCCAGATGAAGGTTGG - Intergenic
1032552466 7:132797196-132797218 CCCTGCACACAGCTGAAGCCTGG + Intronic
1032935829 7:136730203-136730225 TCCTGAAAACAGCAGAAGCTTGG - Intergenic
1035816473 8:2546725-2546747 CCGTGAATACAGAGGCATCTCGG - Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1040434805 8:47380023-47380045 CCTTGAATAAAAATAAAGCTTGG + Intronic
1041163930 8:55072640-55072662 CTCTGAGGACAGATAAAGCTGGG - Intergenic
1042515209 8:69652103-69652125 CCCAGAAAACAGAGGAAGGTGGG - Intronic
1042879643 8:73472787-73472809 CCCTTAATACAGCCGAAGGTGGG - Intronic
1044774567 8:95674890-95674912 CCCTGAATAAGGAGGAAACTGGG + Intergenic
1046739881 8:117816581-117816603 GCCTGAATATAGATGCAGCTGGG + Intronic
1049230025 8:141477129-141477151 GCCTGAAGGCAGATGGAGCTGGG - Intergenic
1049484480 8:142846926-142846948 CCCTGAATACAGAGCAAGGGAGG - Intronic
1051260703 9:15261563-15261585 CCCTGGACACAAATGAAGTTGGG - Intronic
1051729686 9:20127529-20127551 CCCTGGAAAGAGATGAAACTGGG - Intergenic
1052617491 9:30860214-30860236 ACTTGAAAACAGATGATGCTAGG + Intergenic
1055154811 9:73048537-73048559 CCTTGAAAAAAGATGAAGTTTGG + Intronic
1055511549 9:77000240-77000262 CACTGCCTACAGAGGAAGCTTGG + Intergenic
1057296607 9:93848357-93848379 AGCTGAATAGAGAGGAAGCTGGG + Intergenic
1059926693 9:119216871-119216893 AACTGAAAACAGATGAAGTTTGG + Intronic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188764328 X:34073768-34073790 CCTGGATTAAAGATGAAGCTGGG + Intergenic
1189555351 X:42139093-42139115 ACATGATTACAAATGAAGCTGGG - Intergenic
1194287313 X:92025894-92025916 GCAGGAATATAGATGAAGCTGGG + Intronic
1195759257 X:108228322-108228344 CCTTGAAAACAGATGATGCATGG + Intronic
1196817670 X:119677935-119677957 CCCTGAAGACACCTGAGGCTGGG + Intronic
1197599945 X:128517327-128517349 TACTGAAGACAGAGGAAGCTGGG + Intergenic
1200604849 Y:5250460-5250482 GCAGGAATATAGATGAAGCTGGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic