ID: 1150122438

View in Genome Browser
Species Human (GRCh38)
Location 17:62615505-62615527
Sequence CTAGTTCTCCAGCTTCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150122437_1150122438 -8 Left 1150122437 17:62615490-62615512 CCTCTTGATTTGACTCTAGTTCT No data
Right 1150122438 17:62615505-62615527 CTAGTTCTCCAGCTTCACACAGG No data
1150122435_1150122438 -3 Left 1150122435 17:62615485-62615507 CCCAGCCTCTTGATTTGACTCTA No data
Right 1150122438 17:62615505-62615527 CTAGTTCTCCAGCTTCACACAGG No data
1150122436_1150122438 -4 Left 1150122436 17:62615486-62615508 CCAGCCTCTTGATTTGACTCTAG No data
Right 1150122438 17:62615505-62615527 CTAGTTCTCCAGCTTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150122438 Original CRISPR CTAGTTCTCCAGCTTCACAC AGG Intergenic
No off target data available for this crispr