ID: 1150123618

View in Genome Browser
Species Human (GRCh38)
Location 17:62622534-62622556
Sequence CCTGGCTTGGAGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150123604_1150123618 14 Left 1150123604 17:62622497-62622519 CCACTTGGGCCAGCCCCACATTT No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data
1150123608_1150123618 0 Left 1150123608 17:62622511-62622533 CCCACATTTGGCCAGTCCTCTTC No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data
1150123607_1150123618 1 Left 1150123607 17:62622510-62622532 CCCCACATTTGGCCAGTCCTCTT No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data
1150123609_1150123618 -1 Left 1150123609 17:62622512-62622534 CCACATTTGGCCAGTCCTCTTCC No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data
1150123606_1150123618 5 Left 1150123606 17:62622506-62622528 CCAGCCCCACATTTGGCCAGTCC No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data
1150123603_1150123618 15 Left 1150123603 17:62622496-62622518 CCCACTTGGGCCAGCCCCACATT No data
Right 1150123618 17:62622534-62622556 CCTGGCTTGGAGAAGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150123618 Original CRISPR CCTGGCTTGGAGAAGGTGCA GGG Intergenic
No off target data available for this crispr