ID: 1150124004

View in Genome Browser
Species Human (GRCh38)
Location 17:62625131-62625153
Sequence CTTCATCTGCTTCCAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150124004_1150124011 -3 Left 1150124004 17:62625131-62625153 CCCTTCTTTGGAAGCAGATGAAG No data
Right 1150124011 17:62625151-62625173 AAGGTCTGGGTGTTGATGAGGGG No data
1150124004_1150124009 -5 Left 1150124004 17:62625131-62625153 CCCTTCTTTGGAAGCAGATGAAG No data
Right 1150124009 17:62625149-62625171 TGAAGGTCTGGGTGTTGATGAGG No data
1150124004_1150124010 -4 Left 1150124004 17:62625131-62625153 CCCTTCTTTGGAAGCAGATGAAG No data
Right 1150124010 17:62625150-62625172 GAAGGTCTGGGTGTTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150124004 Original CRISPR CTTCATCTGCTTCCAAAGAA GGG (reversed) Intergenic
No off target data available for this crispr