ID: 1150124010

View in Genome Browser
Species Human (GRCh38)
Location 17:62625150-62625172
Sequence GAAGGTCTGGGTGTTGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150124005_1150124010 -5 Left 1150124005 17:62625132-62625154 CCTTCTTTGGAAGCAGATGAAGG No data
Right 1150124010 17:62625150-62625172 GAAGGTCTGGGTGTTGATGAGGG No data
1150124004_1150124010 -4 Left 1150124004 17:62625131-62625153 CCCTTCTTTGGAAGCAGATGAAG No data
Right 1150124010 17:62625150-62625172 GAAGGTCTGGGTGTTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150124010 Original CRISPR GAAGGTCTGGGTGTTGATGA GGG Intergenic
No off target data available for this crispr