ID: 1150125160

View in Genome Browser
Species Human (GRCh38)
Location 17:62630468-62630490
Sequence CTGTCTGGAGAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 0, 2: 13, 3: 85, 4: 719}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150125155_1150125160 -6 Left 1150125155 17:62630451-62630473 CCAAAGGGTGGCCAAGGCTGTCT 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG 0: 1
1: 0
2: 13
3: 85
4: 719
1150125147_1150125160 30 Left 1150125147 17:62630415-62630437 CCGTCTGGAGATTGGAGGCAGGA 0: 1
1: 0
2: 4
3: 41
4: 313
Right 1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG 0: 1
1: 0
2: 13
3: 85
4: 719
1150125153_1150125160 3 Left 1150125153 17:62630442-62630464 CCGTATGGGCCAAAGGGTGGCCA 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG 0: 1
1: 0
2: 13
3: 85
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150125160 Original CRISPR CTGTCTGGAGAGAGGCAGGA AGG Intronic
900089265 1:912577-912599 CTGACTGGAGGGATCCAGGAAGG + Intergenic
900838235 1:5023585-5023607 CTGCCTGGTGAGGGGCAGGTGGG - Intergenic
900941328 1:5800448-5800470 CTGGTAGGAGAGGGGCAGGAAGG - Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901234729 1:7661703-7661725 CTGTGAAGAGAGAGGCAGGGGGG - Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
901946356 1:12707118-12707140 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902489935 1:16774058-16774080 CTTACAGGAGGGAGGCAGGAGGG + Intronic
902579768 1:17401122-17401144 CTGACCGCAGAGAGGCAGGTGGG + Intronic
902602525 1:17550026-17550048 CTGGCTGTAGAGAGCCAGGGTGG + Intronic
902814283 1:18907409-18907431 CTGGCAGGAGAGAAGCAGGGTGG - Exonic
903033931 1:20482302-20482324 CTGGCTGCAGACAGGAAGGAGGG - Intergenic
903065476 1:20697006-20697028 CTGTTTGGGGAGAGGCTCGATGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903810168 1:26030922-26030944 CTGTCATGAGTGAGGAAGGAAGG + Intronic
903939074 1:26916351-26916373 CTGTCTAGAGCAAGGCAGGAGGG - Intronic
904734629 1:32621543-32621565 CTCTCTGGGGTGAGGCTGGAGGG + Exonic
905278289 1:36833256-36833278 AACTCTGGAGAGAGGCAGGCAGG - Intronic
905295305 1:36950907-36950929 GGGTCTGGAGTGGGGCAGGAGGG + Intronic
905336993 1:37251578-37251600 CTGTCTGGAGAGAGGGATCCAGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906076711 1:43057255-43057277 ATGTCTGGAGGGAGGTGGGAGGG + Intergenic
906249281 1:44299025-44299047 CTGACTGGGAAGAGGCACGAGGG + Intronic
906495727 1:46302852-46302874 CGGTCTGGAGCGAAGCAGGCTGG - Intronic
907904616 1:58773093-58773115 ATGGCTGGAGAGTGGCAGCATGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
911037459 1:93565991-93566013 CTGTGTGGAGGAAGGCTGGAAGG - Intronic
911063125 1:93764666-93764688 CACTGAGGAGAGAGGCAGGAGGG - Intronic
911097104 1:94063753-94063775 GTGTTTGGAGAGAGCCAGAAAGG - Intronic
911570872 1:99515261-99515283 GAGTCTGAAGAGAGTCAGGAAGG - Intergenic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
912553972 1:110502795-110502817 CTGTCTCAGGAGAGCCAGGATGG - Intergenic
912650770 1:111436771-111436793 TAGTCTAGAGAGAGACAGGATGG - Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
913051798 1:115123098-115123120 CTAACTGGAGAGGGGCAGGATGG + Intergenic
914756300 1:150563303-150563325 CTGGCTGGAGAGAATCTGGAGGG - Intergenic
915215892 1:154340627-154340649 TTGTCTGGAGAGCATCAGGAGGG + Intronic
915497826 1:156293989-156294011 CTTCCTGGAGAGAGGCAGATGGG - Intronic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
916164487 1:161953591-161953613 CTGACAGGAGAGATTCAGGATGG - Intronic
916890287 1:169106721-169106743 CTGCCTGCAGAGAGCCAGGCCGG + Exonic
917306856 1:173635604-173635626 CTGTCTGGACAAAGGTTGGATGG + Intronic
917670834 1:177271889-177271911 CAGTCGGGAGAGAGGCAGGAAGG - Intronic
917838394 1:178958655-178958677 CTGGCTGGAGTGATGCAGGTTGG + Intergenic
918177972 1:182061750-182061772 CTCTCTGGATGCAGGCAGGAAGG - Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919705393 1:200670227-200670249 CCGTCCGGAAAGAAGCAGGAGGG + Intergenic
920180533 1:204129503-204129525 CTGTCTCATGAGAGGCAGGATGG + Intergenic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920284704 1:204871057-204871079 CCTTCAGGAGAGAGGTAGGATGG + Intronic
920425233 1:205869699-205869721 CTTTCTGGAGAGACTCAGGAAGG - Intergenic
920554602 1:206895526-206895548 CTGTCTGCAGATAGGCGGGGAGG - Intergenic
920609840 1:207425348-207425370 CTGTCTTGAGATGGACAGGAGGG - Intergenic
920668817 1:207987306-207987328 ATTTCTGGTGGGAGGCAGGAAGG - Intergenic
920840679 1:209551366-209551388 CACTCTGGAGACAGGCAGAAGGG - Intergenic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
922450537 1:225733699-225733721 TTGACTAGAGAGAGGCAGAAAGG - Intergenic
922466289 1:225847275-225847297 CTGTTGGGAGAAGGGCAGGAGGG - Intronic
922721550 1:227902605-227902627 CTGTCTTGAGAGTTCCAGGATGG - Intergenic
923530504 1:234808470-234808492 CTTACGGGAGGGAGGCAGGAGGG - Intergenic
924258106 1:242202562-242202584 CTAACTCGAGAGAGGCTGGATGG + Intronic
924553526 1:245099553-245099575 CTGTCTGGAGAGAGCAGGTAGGG - Intronic
1062895372 10:1098880-1098902 CTGTCTGTTGAAAGGAAGGATGG - Intronic
1062921842 10:1286101-1286123 CTCACTGGAGAGAGCCAAGAGGG + Intronic
1063001855 10:1932235-1932257 CTATCTGTAGAGAGGGAGGGAGG + Intergenic
1063689203 10:8268241-8268263 CTGTCAGGAGCGAGGAGGGATGG - Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1063894098 10:10661151-10661173 ATGGCTGGAAAGGGGCAGGAAGG - Intergenic
1065248064 10:23779356-23779378 TTGTCTGGAGTTAGTCAGGATGG + Intronic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1067047051 10:42990771-42990793 GTGTCTGGAGGGCCGCAGGAGGG - Intergenic
1067349832 10:45465596-45465618 CAGCCTGGAGAGAGCCAGGATGG + Intronic
1067480412 10:46593160-46593182 ATGACAGGAGGGAGGCAGGAAGG + Intronic
1067689674 10:48493697-48493719 CTGTCTGGGGCGGGGCAAGAAGG + Intronic
1067752773 10:48983027-48983049 CTGTCCTGAGAAAGGCAGGAAGG + Intergenic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069920196 10:71811694-71811716 GTGTCTGGAGAGAAGCAGAGAGG - Exonic
1070109453 10:73469535-73469557 CTGTCTAGAGAGAGAAAGAATGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070711647 10:78687334-78687356 CTCTCTGGAGAGAGACAGGAGGG + Intergenic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070987878 10:80703650-80703672 CAGTGTGGTGAGAGACAGGATGG + Intergenic
1071492114 10:86143286-86143308 ATTCCTGGAGAGTGGCAGGAGGG - Intronic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1072913445 10:99522889-99522911 AGGTCAGGACAGAGGCAGGAGGG + Intergenic
1074699932 10:116083897-116083919 ATGTTTGCAGAGTGGCAGGAGGG - Intronic
1074839027 10:117329939-117329961 CTGTCTCAAGAAAGGAAGGAGGG + Intronic
1075232366 10:120691339-120691361 CAGTCTGCAAAGGGGCAGGAAGG - Intergenic
1075392664 10:122103787-122103809 CTTGCAGGAGAGAGGAAGGATGG + Intronic
1075449539 10:122540175-122540197 AAGTCTGCAGAGAGGCAGGTGGG + Intergenic
1075454758 10:122577914-122577936 GTATCTGCAGAGAAGCAGGAGGG - Intronic
1075585572 10:123655580-123655602 CTGCCTGGAAAGGGGCATGAGGG + Intergenic
1075597650 10:123743803-123743825 AGGACTGGAGAGAAGCAGGAGGG + Intronic
1075598601 10:123750353-123750375 GTGGCTGGAGAGAGGCCGGCTGG - Intronic
1075623399 10:123944527-123944549 CTGTCTAGGGAGAGTCAAGAGGG - Intergenic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076379787 10:130017166-130017188 CTGCCTGGAGAGAGGCAGGCCGG - Intergenic
1076570446 10:131429331-131429353 CTGTCTGGAGAGTGAGAAGAGGG - Intergenic
1077148243 11:1055436-1055458 CTGTCTGGTTAGAGGCTGAAGGG + Intergenic
1077269677 11:1669791-1669813 CCTGCTGGAGAGAGGAAGGAGGG + Intergenic
1077347743 11:2071914-2071936 CTGTGTGGAGAGTGGTTGGAAGG - Intergenic
1077426417 11:2480903-2480925 AAGTCTGGAGAGGGACAGGATGG + Intronic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078147333 11:8730721-8730743 ATGTGTGGAGAGAAGCGGGAGGG - Exonic
1079265434 11:18927194-18927216 CTGTCAGGAGGTGGGCAGGAAGG + Intergenic
1081400666 11:42638454-42638476 TTGTCTGTAAAGAGGCATGAGGG - Intergenic
1081517947 11:43851843-43851865 ATGTGTGAAGAGTGGCAGGAGGG - Intronic
1081741929 11:45447008-45447030 GTGGCTGCAGAGGGGCAGGAGGG + Intergenic
1082887019 11:58096352-58096374 TTGTCTGGACAGGGACAGGAAGG - Intronic
1083015120 11:59445157-59445179 CTGTCAGGAGGCAGGGAGGAGGG - Intergenic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083430999 11:62613433-62613455 CTGACAGGAGGGAGCCAGGAAGG - Exonic
1083623889 11:64062134-64062156 CTGTCTGGGGAAATCCAGGAAGG - Intronic
1083719700 11:64598212-64598234 GGGTCTGGAGGGAGGCAGGAAGG + Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1085278087 11:75312693-75312715 CTGACAAGAGGGAGGCAGGAGGG + Intronic
1085442485 11:76577370-76577392 CTGTCTGGGGAGTGTCAGGAAGG - Intergenic
1086289973 11:85297469-85297491 TTGTCTGGAAACAGGCAGAATGG - Intronic
1086900825 11:92365997-92366019 CTCTCTGGGGTGAGGGAGGAAGG + Intronic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088365610 11:109036982-109037004 TTTTCTTGAGACAGGCAGGAAGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089169795 11:116504052-116504074 CTGCCTGGATGGAGGCAGGCGGG - Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089330059 11:117682808-117682830 CTGGCTGGAGGGAGGAAGGAAGG + Intronic
1089402489 11:118172400-118172422 CAGTCTGGAGCCAGGCAGGCTGG - Intronic
1090375654 11:126286984-126287006 CTTTCAAGAGGGAGGCAGGAAGG - Intronic
1091064329 11:132494498-132494520 CAATCTGGAAAGAGGCAGGAAGG - Intronic
1091450003 12:566437-566459 CTGGCTGGAGAAAGCCGGGAGGG + Intronic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG + Intronic
1092128647 12:6093139-6093161 CTCTCTGGATAAGGGCAGGAAGG + Intronic
1092244436 12:6855736-6855758 CTTTCTGTAAAGAAGCAGGAAGG - Exonic
1093066185 12:14660930-14660952 CGGTATCCAGAGAGGCAGGAAGG - Intronic
1093504964 12:19854554-19854576 GTGGCTGGAGAGAAGCAGAAAGG - Intergenic
1096230762 12:49895617-49895639 CTGTCTGCAGGCAGGCAGGGAGG - Intronic
1096523750 12:52198639-52198661 CTGGGTGGAGAGGAGCAGGAAGG + Intergenic
1096618021 12:52845366-52845388 CTGTCTGAGGAAATGCAGGAAGG - Intronic
1097167395 12:57093162-57093184 CTGTCTGGGGAGAGTCTGGATGG + Exonic
1097346374 12:58498039-58498061 CTCTCTGGAGAGTGGAATGAGGG + Intergenic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1099761498 12:86926129-86926151 CTATCTGGAGAGAGCCAGGACGG - Intergenic
1100783526 12:98054960-98054982 GTGACTGGAGAGAGGCAAGAAGG - Intergenic
1101559934 12:105847230-105847252 CTGCCTGGAGACAGTCAGGATGG + Intergenic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102049542 12:109852734-109852756 CTGCCTTGAGACAGGCAAGAAGG + Exonic
1102481282 12:113225430-113225452 CTGTCTGGAGAGTGACATTAGGG - Intronic
1103740081 12:123085163-123085185 CTGTCTGGAGAGATGCAAACAGG + Intronic
1103763655 12:123267784-123267806 CTGGCTGGAGACAGGCACGCTGG + Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104653625 12:130556795-130556817 CAGTGTGGAGAGGAGCAGGAAGG + Intronic
1104723349 12:131059238-131059260 CTGGCTGCAGTGAGCCAGGATGG - Intronic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1105936654 13:25106714-25106736 TTGACTGGAAAGAGGCAAGAAGG + Intergenic
1106307106 13:28522453-28522475 CTGGCAGGATAGAGGCTGGAAGG + Intergenic
1106403957 13:29457288-29457310 TTGGCTGGAAAGAGGCATGAGGG - Intronic
1106528121 13:30561443-30561465 CTGTCATGAGAGAGGTAGGATGG + Intronic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107803155 13:44129577-44129599 CTTTCTGGAGAGAGGCTGCCAGG - Intergenic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1109018548 13:57053279-57053301 ATGACTGGAAAGAGACAGGAGGG + Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1109931729 13:69225184-69225206 CTTTCTGGAGAGAGTAAGGGAGG + Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110810543 13:79807443-79807465 CTGACTGCAGAGACCCAGGAGGG - Intergenic
1110811276 13:79813013-79813035 TTGTCTGGAGATAGGAGGGATGG - Intergenic
1111665833 13:91266954-91266976 CTGTCTGGTCACAAGCAGGAGGG + Intergenic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959754 13:114119935-114119957 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959775 13:114120005-114120027 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959833 13:114120179-114120201 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959853 13:114120249-114120271 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959875 13:114120319-114120341 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959912 13:114120429-114120451 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959932 13:114120499-114120521 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959954 13:114120569-114120591 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1114169251 14:20255081-20255103 CTTATTAGAGAGAGGCAGGAGGG - Intergenic
1114173500 14:20297952-20297974 TTGTGGGGAGAGTGGCAGGAGGG + Intronic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1114657691 14:24325884-24325906 CTGTCTGGTGGGAGGTGGGAGGG + Exonic
1114745768 14:25145024-25145046 TTGACTGGAAAGGGGCAGGAGGG - Intergenic
1115909610 14:38240902-38240924 ATGGCTGGAGAGAGGGAGAATGG + Intergenic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1119534504 14:75392034-75392056 CAGTCTGGACAGAGGCAGCCTGG + Intergenic
1119768205 14:77204002-77204024 CAGTCAGGGGAGAGGCTGGAGGG + Intronic
1119979274 14:79061384-79061406 CTGGCTAGAGATAGGAAGGAGGG + Intronic
1120202439 14:81552626-81552648 TTGACTGGAAAGGGGCAGGAGGG + Intergenic
1120303389 14:82736710-82736732 GTATCTGGAGAGAGGAAGGAGGG - Intergenic
1121117413 14:91353419-91353441 CAGTCTGGGTTGAGGCAGGAAGG - Intronic
1121683571 14:95814844-95814866 TTGTCTTGGCAGAGGCAGGAGGG - Intergenic
1121763089 14:96462138-96462160 CTGTCAGGAGAGATGTAAGAGGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122370969 14:101228755-101228777 CTTTCTGCAGAGAGCAAGGAAGG - Intergenic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1122795025 14:104201714-104201736 CTGTCCTCAGAGAAGCAGGAGGG + Intergenic
1122838950 14:104445285-104445307 CAGTGTGGAGAGAGGCAGAGCGG - Intergenic
1123164133 14:106309344-106309366 ATCTCTGCAGAGAGACAGGAGGG - Intergenic
1123196201 14:106618847-106618869 ATCTCTGCAGAGAGACAGGAGGG - Intergenic
1124348097 15:28935656-28935678 GTGTCTGGAGAGAGGCTGAGGGG - Intronic
1124411397 15:29440653-29440675 CCCTGTGGTGAGAGGCAGGACGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125690305 15:41590905-41590927 CAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1126711186 15:51457998-51458020 GAGTCTGGAGAAAAGCAGGAGGG + Intronic
1127271231 15:57403692-57403714 CTGGCTGGCTAGAGGCAGGCTGG + Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128054861 15:64691969-64691991 TTGTTTAGAGAGAGCCAGGATGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128819203 15:70636952-70636974 ATGGCAGGAGAGAGCCAGGAAGG - Intergenic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129121400 15:73399042-73399064 CAGTCTGGAGTGTGGGAGGAGGG + Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129234268 15:74214345-74214367 GTGAGTGGAGGGAGGCAGGAAGG - Intergenic
1129261452 15:74370316-74370338 CTGTCTTGAGAGAGCCAAGAAGG - Intergenic
1129312456 15:74722247-74722269 CAGTCTGGGGAAAGGCAGGTGGG - Intronic
1130207656 15:81892561-81892583 CTGTCTGTAAATGGGCAGGATGG - Intergenic
1130554900 15:84915749-84915771 CGGCCAGAAGAGAGGCAGGATGG - Intronic
1130730931 15:86491415-86491437 CTCTCTGGATAGAGTCAGAAAGG - Intronic
1130936688 15:88476970-88476992 CTCTCTGGAGAGAAGCAGAGTGG - Exonic
1131000067 15:88932810-88932832 CTGTTTGGAGACAGGCAGCTGGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131364314 15:91825273-91825295 AAGTCTAGAGAGAGGAAGGATGG - Intergenic
1132701740 16:1225010-1225032 CGTGCTGGGGAGAGGCAGGAGGG - Intronic
1132710260 16:1263211-1263233 CTGGCTGGAAAGAGCCAGGAGGG + Intergenic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1133251112 16:4481876-4481898 CAGTCTGGAGGAGGGCAGGAGGG + Intronic
1133881783 16:9789050-9789072 CTGTCTGGAGACAGATAAGAAGG - Intronic
1134766805 16:16766343-16766365 ATGTATAGAGAGAGGCAGCAAGG + Intergenic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136417946 16:30114677-30114699 CTGGCGGGAGAGGGGCAGGCAGG + Exonic
1136579021 16:31140927-31140949 CTGTCTGGGGTGGGGCATGAGGG - Intronic
1137558810 16:49490032-49490054 AGGTCTGGAGTGAGGCAGGCAGG - Exonic
1137677669 16:50311764-50311786 CTGTCTGGAGAGTGTAAGCAGGG - Exonic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1138207967 16:55138921-55138943 CTGCCTGGAGGGATGCAGGGAGG - Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139476361 16:67204454-67204476 TTCTCTGGTGAGAGGCATGAAGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139647866 16:68344919-68344941 GTGTGTGTAGAGATGCAGGAAGG - Intronic
1140219978 16:73036633-73036655 CCGGCAGGAGAGAGGGAGGAGGG + Intronic
1140258046 16:73353633-73353655 CTCTCTGCAGAGGGGCAGGATGG - Intergenic
1140415960 16:74774289-74774311 GTTCCTGGAGAGAGGAAGGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141187860 16:81800878-81800900 CTTGCAGGAGGGAGGCAGGAGGG + Intronic
1141557109 16:84843483-84843505 CTGGCTGGACGGAGGCAGGCTGG - Intronic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142000181 16:87659926-87659948 CTGTCTGGAGAGGGATAGCATGG + Intronic
1142138538 16:88462368-88462390 GTGTCTGGAGAAGGGCAGAACGG - Intronic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1142325818 16:89413869-89413891 CAGACTGGGGGGAGGCAGGAGGG + Intronic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1142620110 17:1160056-1160078 CTGCCTGGAGACAGGGAGGTAGG + Intronic
1142747741 17:1968385-1968407 CTGTCAGGAGAGAGGACGGCCGG - Intronic
1142903845 17:3029483-3029505 GAGTCTGGGGAGAGGCAGGGTGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143964375 17:10746231-10746253 CTCTCTGAAGAAAGGAAGGAAGG + Intergenic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1144567701 17:16373622-16373644 CTGTCTGGAGTAGGGCCGGAGGG - Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147244448 17:39110906-39110928 CTGTCTGGAGGCAGGAAGGGAGG - Intronic
1147256725 17:39186115-39186137 GAGTCAGGAGAGAGGGAGGAGGG + Intronic
1147657270 17:42098113-42098135 CTTTCTGGAGTGGGGCAGGTTGG - Intergenic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1148074816 17:44929148-44929170 CTGTCTGGGGTGAGGCAGGAGGG - Intronic
1148443236 17:47722487-47722509 CCCTCTGGAGAAAGGCAAGATGG - Intergenic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085530 17:52710649-52710671 CTGCCTATAGAGAGGCAGGTGGG + Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149220931 17:54414655-54414677 CGGACTGTAGAGAGGTAGGAAGG - Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1151352700 17:73541169-73541191 CTGGCTGGGGAGAGGCAGCTGGG + Intronic
1151653023 17:75481591-75481613 ATGTGTGGAGACAGGCAGGAAGG + Intronic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153919241 18:9773522-9773544 CTGTTCTGAGACAGGCAGGAAGG - Intronic
1153982606 18:10323118-10323140 CTGTCTGGGGAGAGCCGTGATGG + Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1155311500 18:24528868-24528890 TTGTGTGAAGAGAGGCAGGTAGG + Intergenic
1155441769 18:25869860-25869882 CTTGCTGGAGAGAGGCGGGGTGG - Intergenic
1156015857 18:32546638-32546660 CGTTTTGGAGAAAGGCAGGAGGG + Intergenic
1156401694 18:36745458-36745480 GTGTCTGGTGTGAGGCAGGGAGG - Intronic
1156461066 18:37321619-37321641 TGGTGTGGAGAGAGACAGGAGGG - Intronic
1156812906 18:41274082-41274104 CTGCCTGGACATAGGCAGGCTGG - Intergenic
1157121686 18:44917338-44917360 CTGCCTGGGGAGAGGCAGTTTGG + Intronic
1157403505 18:47405134-47405156 CTCCCTGGAGAGAGGCAGGTGGG + Intergenic
1157500874 18:48189829-48189851 ATGGCTGGAAAGGGGCAGGAGGG + Intronic
1157674744 18:49560892-49560914 CCGGCTGGAGCGAGGCTGGATGG + Intronic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1159069731 18:63610532-63610554 CAGGCTTGAGAGAGTCAGGAGGG + Intergenic
1159998775 18:74995308-74995330 CTGTGTGGAGAGTGGCCAGAGGG + Intronic
1160017375 18:75155028-75155050 TTTTCTGGAGACAGGCGGGAAGG + Intergenic
1160589362 18:79934311-79934333 CTCTCGGGAGAAAGGCAGCATGG + Intronic
1160744130 19:702716-702738 CATTCAGCAGAGAGGCAGGAAGG + Intergenic
1160883130 19:1331584-1331606 CTGCCTGGGGAGGGGCTGGAAGG + Intergenic
1161326787 19:3667978-3668000 CACTCTGGAGAGGGGCAGGGAGG - Intronic
1161424252 19:4193830-4193852 CCGTCGGGAGGGAGGGAGGAAGG + Intronic
1161435447 19:4260041-4260063 CTGTCTGGATGGAGCCTGGAGGG - Intronic
1161474553 19:4477018-4477040 CTGAGTGGAGCAAGGCAGGAGGG + Intronic
1161627358 19:5335114-5335136 CTGTGGGGAGAGAGGCTGGGAGG - Intronic
1161660335 19:5541836-5541858 CTTTCTGCAGAGAGGAAGGGAGG + Intergenic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1162267829 19:9590272-9590294 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1162740493 19:12771053-12771075 CAGGCTGGAGAGTGGCAGGGAGG - Exonic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1163112420 19:15169819-15169841 CTGGCTGGGGAGGGGCAGGATGG + Intronic
1163276369 19:16286762-16286784 CAGGATGGAGAGAGGCAGGCAGG - Intergenic
1163445080 19:17341264-17341286 CTGACGGGAGAGGGGCTGGACGG + Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164157027 19:22603198-22603220 ATCTTTGGAGAGAGGGAGGAGGG - Intergenic
1165893786 19:39129859-39129881 CTCTCAGGAGGGAGGCAGGGAGG + Intronic
1166109825 19:40614962-40614984 CTGTCTAGAGAGACCAAGGAAGG - Intronic
1166145054 19:40828372-40828394 CTTTTTAGAGGGAGGCAGGAGGG + Intronic
1166258408 19:41621385-41621407 CTGCCTGGAGGGAGGAAGGGAGG - Intronic
1166303473 19:41924832-41924854 GTTTCTGGAGAGAAGCAGGTTGG + Intronic
1166517310 19:43457070-43457092 CTGTCTGGAAGGAGGTTGGAGGG + Intergenic
1166617619 19:44265079-44265101 CTGACTTGAAAGAGACAGGAGGG - Intronic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167218657 19:48182771-48182793 GGGTCTCGAGAGAGGCAGGCCGG + Intronic
1167311532 19:48740257-48740279 CTGTCTGGTGAACGGAAGGAGGG - Exonic
1168028232 19:53659427-53659449 CTGTCTTGAGATAAGCAGGGAGG + Intergenic
1168683922 19:58336509-58336531 GTTTCTGGATAGAGGAAGGAAGG + Intronic
1168687152 19:58355920-58355942 CTGTCTGGGGACATGTAGGATGG - Exonic
925986813 2:9223062-9223084 GTGACTTGAGAGATGCAGGAAGG - Intronic
926146864 2:10401633-10401655 TTGTTTGACGAGAGGCAGGAAGG - Intronic
926314671 2:11700568-11700590 CTGCCTCCAGAGAGGCAGGGAGG - Intronic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928123153 2:28598518-28598540 CTTCCTGGGGAGAGGCAGGGAGG - Intronic
928314363 2:30234293-30234315 CTGTCTGGAGACAGGAAGAGAGG - Intronic
928453921 2:31402497-31402519 CAGTCTTGAGAGATCCAGGATGG + Intronic
928462131 2:31485013-31485035 CTGTCTGGAGACAAGCAGTAGGG + Intergenic
928666923 2:33558819-33558841 CTGTCTGGTCAGAGGCTGGCTGG + Exonic
928795977 2:35019576-35019598 CTGGCTGGAGAGAGGTGGGGTGG - Intergenic
929220201 2:39456104-39456126 CTGTCTGGAGAGAACCAGACAGG + Intergenic
929801697 2:45110084-45110106 GTGTCAGGAGAGAGGGAGAAAGG + Intergenic
929878251 2:45814793-45814815 CTCTCTGGAGGGAGGAGGGAGGG + Intronic
929924213 2:46195843-46195865 TTGTCCTGAGAAAGGCAGGAAGG + Intergenic
930165377 2:48198900-48198922 TGGTCTGGAAAGAGCCAGGAAGG - Intergenic
933220270 2:79679748-79679770 CTGTTTGGAGGAAGACAGGAGGG + Intronic
933389486 2:81652178-81652200 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
934473991 2:94580630-94580652 TTGACTGCAGAGGGGCAGGAGGG - Intergenic
934573013 2:95383979-95384001 CTGCATGGAGAGAGGAAGGGAGG - Intronic
934887288 2:98035967-98035989 CTGACTGCAGAGAGGCTAGAGGG + Intergenic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935141112 2:100353869-100353891 CTGGCTGGAGGGTGGCTGGAGGG + Intergenic
935591678 2:104851157-104851179 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
935953100 2:108349051-108349073 CTGTCTGGAGGGAGGCAAATGGG - Intergenic
936397004 2:112138739-112138761 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397012 2:112138766-112138788 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397020 2:112138793-112138815 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397064 2:112138940-112138962 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397072 2:112138967-112138989 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397087 2:112139021-112139043 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397102 2:112139075-112139097 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397110 2:112139102-112139124 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397126 2:112139160-112139182 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397134 2:112139187-112139209 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397146 2:112139241-112139263 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397161 2:112139295-112139317 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397183 2:112139376-112139398 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397191 2:112139403-112139425 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397204 2:112139457-112139479 TAGCCTGGAGAGAGGCGGGAGGG - Intronic
936397211 2:112139484-112139506 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397226 2:112139538-112139560 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397241 2:112139592-112139614 TAGCCTGGAGAGAGGCGGGAGGG - Intronic
936397248 2:112139619-112139641 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397263 2:112139673-112139695 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397292 2:112139781-112139803 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397300 2:112139808-112139830 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397315 2:112139862-112139884 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397343 2:112139965-112139987 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397358 2:112140019-112140041 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397394 2:112140154-112140176 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397402 2:112140181-112140203 TGGCCTGGAGAGAGGCGGGAGGG - Intronic
936397437 2:112140311-112140333 TGGCCTGGAGAGAGGCAGGAGGG - Intronic
936563395 2:113561859-113561881 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
937080950 2:119139331-119139353 CTGTCATGAGTGAGGAAGGAGGG + Intergenic
937231674 2:120401527-120401549 AGGTCTGGAAAGAAGCAGGAAGG + Intergenic
937427832 2:121814637-121814659 CGCTCAGGAGAGAGGAAGGAAGG - Intergenic
937481767 2:122268993-122269015 TAGTCTGGAGAGAGGGTGGAAGG - Intergenic
937883491 2:126885375-126885397 CTATCTGGAGAGAGGGAGAGAGG - Intergenic
938036754 2:128041048-128041070 CAATCTGAAGAGAGCCAGGAAGG - Intergenic
938099624 2:128489823-128489845 CTGCCAGGAGAAAGGGAGGAAGG - Intergenic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
938841398 2:135168324-135168346 CGGGCTGGAGACAGACAGGAGGG - Intronic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
939175832 2:138746434-138746456 CTGGCTGGAGCCAGGCACGAGGG - Intronic
939972833 2:148681369-148681391 CTGTGTGGAGAATGGCAGGTAGG + Intronic
940788960 2:158011661-158011683 TTGTCTGGAGGGAGGGAGGGAGG + Intronic
940807525 2:158204937-158204959 CAGTCTGGAGAGGAGTAGGAGGG + Intronic
942222791 2:173787893-173787915 CAGTCTGGAGAGAGTCTGGGTGG - Intergenic
942672523 2:178391148-178391170 CTGTTTGGAAAGTGGCATGAAGG + Exonic
942875931 2:180797534-180797556 AGGGGTGGAGAGAGGCAGGAGGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944495948 2:200307132-200307154 CCGGCTGGAGAAAGGAAGGACGG - Intronic
945225514 2:207529155-207529177 TTGTCTGGAGAAAGGCGGGGAGG + Intergenic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946984138 2:225252611-225252633 TTGTCAGGAAAGAGGCATGAGGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947599030 2:231433614-231433636 CTCTCTGGGGCGAGGCTGGAGGG + Intergenic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948300530 2:236903440-236903462 CTGTCGGGAGAGTTACAGGAGGG + Intergenic
948690909 2:239704572-239704594 GTGTCTGGAGAGATGAAAGAGGG + Intergenic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
948861199 2:240753349-240753371 CCTTGTGGAGAGAGCCAGGATGG - Intronic
948864241 2:240767410-240767432 GTGCCTGGAGAGAGGTTGGAGGG - Intronic
1168822725 20:786544-786566 CAGTCTGAGGAGAGCCAGGAAGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1169787890 20:9379896-9379918 CTTTAAGGAGAAAGGCAGGAAGG + Intronic
1169858898 20:10131769-10131791 CTCTCTAGAGAGAGGCAGGCTGG - Intergenic
1170459469 20:16563959-16563981 CTGGCTGGAAAGAGAAAGGAGGG - Intronic
1170899245 20:20444560-20444582 GTGTCTGGAAAGCAGCAGGAAGG - Intronic
1171481387 20:25458222-25458244 CTGTAGGGAGAGAGGCAGTGTGG - Intronic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172109972 20:32538826-32538848 CTGTCTGGAGGAGGGCAGGGGGG + Intronic
1172110959 20:32544602-32544624 CTGGAAGGAGAGAGGCAGGGAGG + Intronic
1172161499 20:32871943-32871965 CTGTCTGGAAGGAGGCCGCAGGG + Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173486647 20:43446151-43446173 TTGACTGTCGAGAGGCAGGAAGG - Intergenic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1175239610 20:57537284-57537306 GTCTCTGGTGAGGGGCAGGATGG + Intergenic
1175411881 20:58775901-58775923 GTCAATGGAGAGAGGCAGGATGG - Intergenic
1175501168 20:59452258-59452280 AGGTCTGGAGAGAGACAGGAAGG - Intergenic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1175872354 20:62214478-62214500 CTGGCTGGAGCTAGGCTGGAGGG - Intergenic
1175942413 20:62543585-62543607 CAGTTGGGAGAGAGGCAGGGTGG - Intergenic
1175984169 20:62755752-62755774 ATGGCTGGAGGGAGGGAGGATGG - Intronic
1178155354 21:29847229-29847251 ATGGCAGGAGAGAGGCAGGAAGG - Intronic
1178826219 21:36019097-36019119 TTGCTTGGAGAGAGGCAGGGTGG - Intergenic
1178890205 21:36514655-36514677 GTGTGTGTAGAGAGACAGGAGGG + Intronic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1179143729 21:38749779-38749801 CTGTCTGGAGAGGTGCAGCTGGG - Intergenic
1179377745 21:40866321-40866343 CTACCTTGAGAGAGGCATGACGG + Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1180606991 22:17066307-17066329 CCATCTGGAGAGCTGCAGGATGG + Intergenic
1180701339 22:17782992-17783014 CTTCCTGGAGAGAGGGATGAAGG + Intergenic
1180757301 22:18170944-18170966 GCATCTGGGGAGAGGCAGGATGG - Intronic
1180953804 22:19732424-19732446 CTGTCTGGAGAGAGAAAGTGAGG - Intergenic
1181074478 22:20366521-20366543 GCATCTGGGGAGAGGCAGGATGG + Intronic
1182039295 22:27224027-27224049 CTGGTTGGAGTAAGGCAGGAGGG + Intergenic
1182059761 22:27388524-27388546 CTCTCTGAACAGAGACAGGAAGG + Intergenic
1182176560 22:28295630-28295652 CTGTCTGCAGAGTGGAAAGAAGG - Intronic
1182294070 22:29302911-29302933 CTGTCAGGAGTGGGGTAGGAGGG - Intergenic
1182420956 22:30248345-30248367 GTGTGGGGTGAGAGGCAGGAAGG - Intergenic
1182443416 22:30376965-30376987 CTGTCGGGAGGGAAGCAGGAAGG - Intronic
1182557758 22:31138240-31138262 CTGTCTGGAAAGGGACATGAGGG + Intronic
1183413742 22:37671115-37671137 CTGTCTGGACAAAGGCTGGGAGG + Intergenic
1183748512 22:39705881-39705903 ACGTCTGGGGAGCGGCAGGATGG - Intergenic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184644069 22:45886578-45886600 CTGCCGGGAGAGGGGCGGGAAGG - Intergenic
1184753595 22:46503229-46503251 CTGGCTGGAGCGAGGCAGGTTGG - Intronic
1185006327 22:48278911-48278933 CTGAGAGGTGAGAGGCAGGATGG + Intergenic
1185089342 22:48757124-48757146 CTCTTTGGAGAGAGGCAAGGAGG + Intronic
1185310889 22:50153620-50153642 CTGTCAGGAGAGAGCCCGGCAGG + Intronic
949225922 3:1695911-1695933 CTATGGGGAGAGAGACAGGAAGG - Intergenic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950227755 3:11249834-11249856 CAGTCTGAGGAGAGCCAGGAAGG + Intronic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
953334258 3:42080445-42080467 CTGCCTAGAGAGCTGCAGGAAGG - Intronic
953407174 3:42665230-42665252 CTGTGTGGAGTGGGGCAGGCAGG + Exonic
953699898 3:45187425-45187447 GGGTCTGCAGGGAGGCAGGAGGG + Intergenic
953752311 3:45618162-45618184 GTGGTTGGAGGGAGGCAGGAGGG + Intronic
953837494 3:46359548-46359570 CTAAGTGGAGAGAGCCAGGAAGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954304457 3:49718079-49718101 CTTTCTGGAGCCAGGCCGGAGGG - Exonic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954498689 3:50989114-50989136 CTGTCTGGTGACAAGCAGTAGGG - Intronic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
959234344 3:103699539-103699561 ATGTCTGGAGAGAGGAAATAAGG - Intergenic
959357304 3:105348509-105348531 CTGTCTTTTGAGAGGAAGGAAGG - Intergenic
960048662 3:113220725-113220747 TTGTCTGGAGGGATCCAGGAGGG - Intronic
960287168 3:115842662-115842684 CTGATTAGAGAGAGGCAGGAAGG + Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
960944764 3:122958401-122958423 CTGTCTGCAGTTTGGCAGGAAGG + Intronic
961005699 3:123403890-123403912 CTGTCTGGAGAGAGCAGAGAAGG - Intronic
961034076 3:123630054-123630076 GTGTGTGGAGAGAGGTGGGAAGG - Intronic
961481527 3:127183772-127183794 CTGTCTTGAAAGAGAAAGGAAGG - Intergenic
961614544 3:128168464-128168486 CTTTCTGGGGAGAGAGAGGAAGG + Intronic
961911759 3:130324629-130324651 CTGGCTGAAGAGGGGCATGAGGG + Intergenic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
963757482 3:149250738-149250760 GTGTCTGGAGGGAGGGAGCAAGG + Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
966277847 3:178197267-178197289 CTGTTTGGGGAGATGCAGGAGGG - Intergenic
966499960 3:180628000-180628022 CTGTGTGAAGAGACACAGGAAGG + Intronic
966504502 3:180684523-180684545 CTGACTGGAAAGAGGCATGAGGG - Intronic
966931350 3:184677790-184677812 CGGTCTGTGGAGGGGCAGGAGGG - Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967348822 3:188489355-188489377 GTGACTGGAGAGAGGCAAGAAGG + Intronic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
967828497 3:193898112-193898134 GTGCCAGGAGAGAGGAAGGAAGG + Intergenic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969522619 4:7687343-7687365 CTATCTGGGGTGGGGCAGGAGGG + Intronic
969719438 4:8885182-8885204 CTGGCAGGAGGCAGGCAGGAAGG + Intergenic
969921120 4:10540605-10540627 CTGTGTGGAGAGTCGCAGTAGGG + Intronic
970408142 4:15783216-15783238 GTGTCTGGTGATAGTCAGGACGG + Intronic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972607424 4:40626693-40626715 CTGTATGGGGAGAGGCAGTGGGG - Intronic
972741687 4:41893216-41893238 GTGTCTGGAGGGAGGGAGGTGGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973710852 4:53629256-53629278 GTGGCTGGAGACAGGGAGGAGGG - Intronic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
974115775 4:57577601-57577623 CTGTCTCTAGAGAGACAGGCAGG - Intergenic
975120143 4:70719295-70719317 CTACCTGGAGAGAGGCAGGGTGG + Intronic
975168456 4:71205149-71205171 CTCTCTGGAGAGATGCAGGATGG + Intronic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
975996659 4:80322921-80322943 CTGTCTGGGGAGACTCAGGCAGG + Intronic
976472670 4:85447814-85447836 CTGCCAGGAGAAAGGGAGGAAGG + Intergenic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977178288 4:93841028-93841050 CTGTCAGGAGAGAGAGGGGAGGG - Intergenic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
978615070 4:110586207-110586229 CTTTCTTGGGAGAGGCAGAATGG - Intergenic
978824016 4:112999469-112999491 CTGTCAGGTGAGAGGCAGAATGG - Intronic
979394133 4:120165221-120165243 CTCTCTTGAGAGAGGCAACAAGG - Intergenic
979670977 4:123359928-123359950 CAGACTGCAGAGAGGCAGGTAGG - Intergenic
979993943 4:127408624-127408646 CTGTCTGTAGTGAGGTAGGGAGG - Intergenic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
981470623 4:145130502-145130524 ATGTCTGGTGAGAGGCAGAAAGG + Intronic
981566549 4:146107555-146107577 ATGTCAGGAGAGTGGCAGCATGG - Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984456673 4:179977739-179977761 ATGTGAGGAGAGAAGCAGGAAGG - Intergenic
985682072 5:1261092-1261114 GTGTCTCCAGAGGGGCAGGATGG + Intronic
987088214 5:14488292-14488314 CTGGCGGGACAGAGGCAGGGGGG - Intronic
987226859 5:15850988-15851010 CTGTCTGGAAAGAGGCAAAGCGG - Intronic
989035375 5:37165378-37165400 CTCTGTGGAGGGAGGCAGCAGGG + Intronic
990124827 5:52501371-52501393 CTGTCTGGAAAGAATCAGGATGG + Intergenic
990837111 5:60034495-60034517 CTTTTAAGAGAGAGGCAGGAAGG - Intronic
991049424 5:62256495-62256517 CTCTCTTGAGAGAGTCAGAAAGG + Intergenic
991564010 5:67985777-67985799 TTGGCTGGAATGAGGCAGGATGG - Intergenic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
992278217 5:75143465-75143487 CTGTCTGTTAAGAGGTAGGAAGG - Intronic
992379235 5:76220716-76220738 CAGTCTGGATAGAGGCAGTCCGG + Intronic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
992955299 5:81901882-81901904 CGGACAGGAGGGAGGCAGGAAGG + Intergenic
993776395 5:92003499-92003521 CTATTTGTAGAGAGGAAGGAAGG + Intergenic
994028677 5:95114942-95114964 CTGTTTGGAGAAAGTAAGGAAGG + Intronic
994624803 5:102205234-102205256 CTGTCTGGAGGGTGGGAGAAGGG + Intergenic
994678953 5:102861515-102861537 CTGTCTGGAGTGAAGCAGACTGG + Intronic
994767289 5:103934954-103934976 GTATCTGCAGTGAGGCAGGAGGG - Intergenic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
996234767 5:121111909-121111931 CTTTCTGGAGAAAGGCAATAGGG + Intergenic
996284553 5:121773328-121773350 GTGTTTGGAAAGAGGCATGAGGG - Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997511727 5:134459067-134459089 CTTTCTGGAGAGGGTCAGGTTGG + Intergenic
997610349 5:135211549-135211571 CTGTCTCCAGGGAGACAGGAGGG + Intronic
997638405 5:135432323-135432345 CTGGCTGGAGAAATGCAGGGCGG - Intergenic
997717488 5:136052966-136052988 CTGTCTGTAGAGACCCTGGAGGG + Exonic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
998505724 5:142670434-142670456 CTGACTGGAGAGACCAAGGAAGG - Intronic
998714648 5:144868940-144868962 GTGTCAGGAGAGAGGAAGAATGG + Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999369384 5:151044670-151044692 CTGTGTGGAGAGGGGCTAGACGG + Intronic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1000684064 5:164224949-164224971 CTGATTGGAGAGATGCAGAAAGG - Intergenic
1000687476 5:164270212-164270234 CTGGCAGGAGAGAGGGAGGGAGG - Intergenic
1001240627 5:170067324-170067346 CTCTCTGGGGAGAGACAGGCTGG - Intronic
1001558455 5:172652680-172652702 CAGTCTGAAGAAAGTCAGGAGGG + Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1001820436 5:174705952-174705974 ATGTGTGGAGAGAGGCAGGGAGG - Intergenic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002213247 5:177610630-177610652 AGGACTGGAGAGAGGCAGGCAGG + Intergenic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005298065 6:24446028-24446050 CTGTCAGTTGGGAGGCAGGATGG - Intronic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1006133518 6:31882571-31882593 CTGGCTGGAGAGTGGCCAGATGG + Intronic
1006261314 6:32873940-32873962 CTGTCTGGGGCGAGGTTGGAGGG - Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006547579 6:34792378-34792400 CGGGCTGGAGAGAGGCAGACTGG - Intronic
1006895170 6:37463583-37463605 GTGTTTGGAGATAGGCTGGAGGG + Intronic
1006913463 6:37579206-37579228 GGGTCTGGAGAGGGGCAGGCTGG - Intergenic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1008547435 6:52595736-52595758 CAGGCGGGTGAGAGGCAGGATGG - Intergenic
1008579229 6:52890684-52890706 ATGGCTGGAGAGAGGCAGTGGGG - Intronic
1009303006 6:62051120-62051142 CTGGCTGGAAAGCGGCATGAAGG + Intronic
1009596721 6:65745711-65745733 CTGTCTGGTGACAAGCAGTAAGG - Intergenic
1010593818 6:77741029-77741051 TTGTCTGGAGAGAGCAGGGATGG + Intronic
1011570368 6:88728322-88728344 CAGTCTGACGAGAGTCAGGAGGG - Intronic
1013182740 6:107731866-107731888 CTGCGAGGAGAGGGGCAGGAGGG + Intronic
1013488346 6:110619463-110619485 TTGTCTGCAAAGAGGCTGGAGGG + Intronic
1013797910 6:113906489-113906511 CTGTCTAGAAGGAGGCAGGTGGG + Intergenic
1014529832 6:122545636-122545658 CTTTGTGGAGGGTGGCAGGAGGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014871832 6:126605569-126605591 CTGTCTGAAGACTGGCAGGCTGG - Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016343270 6:143084698-143084720 CTTTCTGGAGAGACTAAGGAAGG - Intronic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017122711 6:151039338-151039360 TTGACTGCAGAGGGGCAGGAGGG + Intronic
1017445664 6:154505148-154505170 CTGTCTGGACGGTGGCAGGAAGG + Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017683911 6:156892668-156892690 CTGGCTGGAAAGAGACATGAAGG - Intronic
1018070972 6:160164126-160164148 CCGTCTGTAGAGAGGAAGGGTGG - Intergenic
1018492425 6:164307694-164307716 TTGTCTGGGGAGAGAGAGGAGGG + Intergenic
1018756509 6:166853870-166853892 CCTGCAGGAGAGAGGCAGGATGG + Intronic
1018862270 6:167719849-167719871 CTGCCAGGCGACAGGCAGGAAGG - Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019921723 7:4167534-4167556 CTGTGTGGAGAGAAGCTTGAAGG - Intronic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1021021026 7:15599225-15599247 CTGGCTGCAGTGAGGCAGGCTGG + Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1022942795 7:35255825-35255847 GTGTCTGGGGAGAGACAGGTTGG - Intergenic
1023725343 7:43137405-43137427 CATTTTAGAGAGAGGCAGGAAGG - Intronic
1024167253 7:46747253-46747275 GTGTCTAGAGGGAGGAAGGAGGG - Intronic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1026543093 7:71297909-71297931 TTGCCTGGAAAGAGTCAGGAAGG + Intronic
1026739175 7:72967950-72967972 ATGACTGGAAGGAGGCAGGAGGG - Intronic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1026931039 7:74223123-74223145 GTGGCTGGAGAGAGGGAGGGAGG - Intronic
1027104556 7:75397123-75397145 ATGACTGGAAGGAGGCAGGAGGG + Intronic
1027587970 7:80081612-80081634 CTGGCTGGAGAGAGAAAGAAGGG + Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028881617 7:95886587-95886609 CTGTCTGGTTTGAGGCAGAATGG - Intronic
1029447709 7:100623432-100623454 ATGTCTTGAGAGTGGCAGGTGGG - Intronic
1029572500 7:101379481-101379503 CTGGAGGGTGAGAGGCAGGAAGG - Intronic
1029698044 7:102227547-102227569 GTGTCCGGAGAGAGGCAGCGGGG - Exonic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1029891081 7:103931164-103931186 ATGGCAGGTGAGAGGCAGGATGG - Intronic
1029950419 7:104578390-104578412 CTGGCTGGAGAGGGGAAGTATGG - Intronic
1031296505 7:120010444-120010466 GGGACTGGGGAGAGGCAGGAGGG - Intergenic
1031922454 7:127612056-127612078 GAGTGTGGTGAGAGGCAGGAAGG + Intronic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1033157911 7:138972182-138972204 TTGCCTGGAGAGAGGAAGAAAGG - Intronic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1034395627 7:150822525-150822547 ATTTCTGGAGAGAGGGAGAAAGG + Intergenic
1034905672 7:154943412-154943434 GGGTCTGGAAAGAAGCAGGATGG + Intronic
1035332028 7:158102628-158102650 ATATATGGAGAGAGGCAGAAGGG + Intronic
1036544326 8:9751723-9751745 CTGGCAGCCGAGAGGCAGGAGGG - Exonic
1036692405 8:10952095-10952117 AAGCCTGGAGAGGGGCAGGAGGG - Intronic
1036731350 8:11268313-11268335 CTGTCTGGAGCCAGGCATGGTGG - Intergenic
1037135744 8:15458129-15458151 ATGTCTAGTGAGAGGAAGGAAGG + Intronic
1037748265 8:21663295-21663317 CTGCCTGGGGAGGGCCAGGAAGG + Intergenic
1037752886 8:21694194-21694216 CTGTCTTAAGAGAGTAAGGAAGG + Intronic
1037883305 8:22583254-22583276 TTGTCTGGAAGGAGGCAGGCGGG + Intronic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1038410541 8:27355248-27355270 CTTTTAAGAGAGAGGCAGGAAGG + Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1038560725 8:28576930-28576952 CTTTCTGGAGACATTCAGGAAGG - Intergenic
1038699461 8:29836334-29836356 CTGTGAGGCTAGAGGCAGGATGG - Intergenic
1039421575 8:37447761-37447783 CTGACTGCAAAGAGGCATGAAGG + Intergenic
1039787954 8:40850132-40850154 ATGTCTGGATGAAGGCAGGAAGG - Intronic
1040683697 8:49844357-49844379 CTCTCTGGAGAGAAGCAGAATGG - Intergenic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041758479 8:61338917-61338939 CTGACCTGAGAGAGCCAGGAAGG - Intronic
1043256481 8:78144391-78144413 CTGCCTGGAGAGAGAGAGGGGGG - Intergenic
1044184602 8:89236505-89236527 CAGTCTGGGGAGAGTCAGGAGGG + Intergenic
1046004744 8:108464977-108464999 GAGTCTGGAGTGAGGCAGGGGGG + Intronic
1046538428 8:115547624-115547646 CTCTCTAGAGGGAGGCAGGTTGG - Intronic
1047307934 8:123668309-123668331 TTGGCTGGAGAAAGGGAGGAAGG + Intergenic
1047322261 8:123797808-123797830 CTGGATGGAGAGAGGAAGTACGG + Intronic
1047727271 8:127694792-127694814 CTGTCTGGAGAGAAACATAAGGG + Intergenic
1048580737 8:135728305-135728327 GTGCCTGGAGAGAGGCATCAGGG - Intergenic
1048674393 8:136761778-136761800 CTGTCTGGAGATGGGGAGCAAGG - Intergenic
1049050456 8:140190718-140190740 CTTTCTAGAGTGAGGAAGGAGGG - Intronic
1049155280 8:141062486-141062508 CTGGATGGAGAGAGGATGGAAGG + Intergenic
1049227805 8:141466027-141466049 TGGTCTGTAGAGGGGCAGGAAGG + Intergenic
1049856940 8:144868120-144868142 CTGCCTGGAAAGGGGAAGGAAGG + Intergenic
1049889335 9:53866-53888 CTGTCTGAAGGAAGGAAGGAAGG + Intergenic
1050010373 9:1179668-1179690 GTGTCTGGTGAAAAGCAGGAAGG + Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051157037 9:14159564-14159586 CTGCCTGCAGAGATGCATGAAGG - Intronic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1052564179 9:30125962-30125984 CTGTCTGCAGAAAGCCAGTAGGG - Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1052998357 9:34563869-34563891 CTGAGTGGAGGGAGGCAGGTTGG - Intronic
1053684085 9:40505502-40505524 TTGACTGCAGAGGGGCAGGAGGG + Intergenic
1053934059 9:43133787-43133809 TTGACTGCAGAGGGGCAGGAGGG + Intergenic
1054279636 9:63119451-63119473 TTGACTGCAGAGGGGCAGGAGGG - Intergenic
1054297180 9:63340966-63340988 TTGACTGCAGAGGGGCAGGAGGG + Intergenic
1054395200 9:64645474-64645496 TTGACTGCAGAGGGGCAGGAGGG + Intergenic
1054429847 9:65150674-65150696 TTGACTGCAGAGGGGCAGGAGGG + Intergenic
1054500536 9:65870858-65870880 TTGACTGCAGAGGGGCAGGAGGG - Intergenic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1054947596 9:70812287-70812309 CTGGCTGGTGAGAGGCATGTAGG + Intronic
1055900115 9:81224500-81224522 CTCTTTCGAGAGTGGCAGGATGG + Intergenic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1056515613 9:87346413-87346435 CCGTCTGGGGACATGCAGGAGGG - Intergenic
1057108844 9:92447757-92447779 TTGTCCGTAGAGATGCAGGAAGG + Intronic
1057201817 9:93144547-93144569 CTGGAGGGAGAGAGGCAGGGAGG + Intergenic
1057446824 9:95122182-95122204 CTGGAGGGAGAGAGGCAGGGAGG + Intronic
1057815548 9:98291461-98291483 CAGACGGGAGAGAGGAAGGATGG - Intronic
1058886616 9:109326560-109326582 GTATCTGGAGAGAAACAGGAGGG + Intergenic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1059670647 9:116488759-116488781 CTGTCTGGAGAGTGACATAATGG + Intronic
1060103391 9:120858702-120858724 CAGTCTGGTGAGAGGCAAGGTGG - Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060577400 9:124709202-124709224 CAGTCAGGAAATAGGCAGGATGG - Intronic
1060667281 9:125439452-125439474 CTGGCTGGTGGGAGGCTGGATGG - Intronic
1060726356 9:126008533-126008555 CTATCAGGAGAGAGGGAGGGAGG + Intergenic
1060824644 9:126680987-126681009 CTGTCTCGACAATGGCAGGAGGG + Intronic
1060838390 9:126775572-126775594 CTGGATGGAGAGAAGCATGAAGG + Intergenic
1061245976 9:129401495-129401517 CTGTCTGGAGCGGGCCTGGAAGG + Intergenic
1061919177 9:133772764-133772786 CTGTCCTGAGAGATGCAGGCAGG + Intronic
1062352119 9:136144320-136144342 AGGTCTGGAGAGAGGCTGGCAGG + Intergenic
1062392377 9:136338979-136339001 CTCTCTGGAGAGAGACAGGCTGG + Intronic
1062453276 9:136624387-136624409 CTCTCTGGAGAGTGGGATGACGG + Intergenic
1062660707 9:137630969-137630991 CTGTGTGGAGAGCGGAAGTAGGG + Intronic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1186694056 X:12010684-12010706 CTATCTGATTAGAGGCAGGATGG - Intergenic
1186719795 X:12291135-12291157 CATTCAGGAGAGAGGCAGCAAGG - Intronic
1187242941 X:17530214-17530236 CTGGCTGGAGAGGGAGAGGAGGG - Intronic
1187419944 X:19125364-19125386 CTATCTGGAGATATGAAGGAAGG + Intergenic
1187988141 X:24837232-24837254 CTGACTGGGAAGAGGCACGAGGG - Intronic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190117640 X:47636768-47636790 CTGGCTGGAGAGAGCATGGATGG + Exonic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1192468027 X:71371655-71371677 CTGTTGAGTGAGAGGCAGGATGG + Intronic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1195726424 X:107922158-107922180 CAGAATGGAGAAAGGCAGGAAGG - Intronic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1198135102 X:133741470-133741492 TTGTCTGGAATGAGGCAGGATGG - Intronic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1198962433 X:142196209-142196231 CTGTCTGGACAGAAGAGGGAGGG - Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200162361 X:154016094-154016116 CTACCTGGAGAGAGGGAAGAGGG + Exonic
1200244852 X:154517439-154517461 CTGTCTGGAGAGCAGCAGCAGGG + Intergenic
1200763281 Y:7059162-7059184 CGGTCTGAGGAGAGTCAGGAGGG + Intronic
1200769227 Y:7108264-7108286 CGGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200841156 Y:7783006-7783028 CAGTCTGCAGTGAGGCCGGATGG + Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1201438620 Y:13985553-13985575 GTGTCAGGAGGGAGGCAGGCGGG - Intergenic
1201445953 Y:14057155-14057177 GTGTCAGGAGGGAGGCAGGCGGG + Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1201944287 Y:19495466-19495488 GTGTGTGTAGACAGGCAGGAGGG - Intergenic