ID: 1150128697

View in Genome Browser
Species Human (GRCh38)
Location 17:62654543-62654565
Sequence CCATCCACAGAGGCAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150128697_1150128705 11 Left 1150128697 17:62654543-62654565 CCTCTGGCTGCCTCTGTGGATGG 0: 1
1: 0
2: 7
3: 43
4: 341
Right 1150128705 17:62654577-62654599 GGAAACTGCAGCAACAGCTGAGG 0: 1
1: 0
2: 3
3: 33
4: 321
1150128697_1150128703 -10 Left 1150128697 17:62654543-62654565 CCTCTGGCTGCCTCTGTGGATGG 0: 1
1: 0
2: 7
3: 43
4: 341
Right 1150128703 17:62654556-62654578 CTGTGGATGGGCTGAGTCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 174
1150128697_1150128706 12 Left 1150128697 17:62654543-62654565 CCTCTGGCTGCCTCTGTGGATGG 0: 1
1: 0
2: 7
3: 43
4: 341
Right 1150128706 17:62654578-62654600 GAAACTGCAGCAACAGCTGAGGG 0: 1
1: 0
2: 2
3: 33
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150128697 Original CRISPR CCATCCACAGAGGCAGCCAG AGG (reversed) Intronic