ID: 1150129135

View in Genome Browser
Species Human (GRCh38)
Location 17:62657549-62657571
Sequence AAGGTGCAGGGCCCCTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150129135 Original CRISPR AAGGTGCAGGGCCCCTCACA AGG (reversed) Intronic
900246703 1:1639630-1639652 AAGGGGCAGAGGCGCTCACAAGG + Intronic
900257924 1:1706762-1706784 AAGGGGCAGAGGCGCTCACAAGG + Intronic
900566934 1:3338189-3338211 AAGTTGCAAGGACCCTCGCAAGG + Intronic
900660105 1:3777920-3777942 AAGATGCTGGGCCCCTGCCAGGG - Intergenic
900919095 1:5659459-5659481 AAGGTCCAGACCCCCACACAGGG - Intergenic
902043794 1:13510996-13511018 CAGCTCCAGGGCACCTCACAGGG - Intronic
903664025 1:24995847-24995869 AAGATGCAGGGCCCCTTTCCTGG - Intergenic
904451088 1:30612079-30612101 AAGGGTCAGGCCCCGTCACAGGG - Intergenic
904947558 1:34210603-34210625 AATGTGCCCGGCCCTTCACATGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
912429462 1:109621328-109621350 AAGGTGCTGGTCCCCTCAGAGGG + Intronic
912711642 1:111954086-111954108 AAGATGGAAGGCCCCTCAGATGG + Intronic
917595145 1:176521707-176521729 AAGAGGCAGGCACCCTCACAAGG + Intronic
917930676 1:179820640-179820662 AGGCAGCAGGGCCCCCCACAGGG + Intergenic
917931089 1:179823400-179823422 AGGCAGCAGGGCCCCCCACAGGG + Intergenic
919729024 1:200901172-200901194 AAGGAGCATGGCCCCCCTCAGGG - Intronic
921041339 1:211435880-211435902 AAGCTTCAGGGCCCCTGCCAAGG + Intergenic
924099183 1:240585775-240585797 CAGGTGGAGGGCCCCTCAAAAGG + Intronic
924558991 1:245142249-245142271 AGGGTGCAATGCCACTCACAAGG - Intergenic
1062938241 10:1403602-1403624 CAGCTGCCGGGCCCCTCACGTGG - Intronic
1064315894 10:14255861-14255883 AAGGTGCAGGCCACCACACCCGG - Intronic
1066291184 10:34015729-34015751 CAGGAGCAGGGCACATCACATGG - Intergenic
1067175384 10:43942340-43942362 GAACTGCAGGGCCTCTCACAGGG - Intergenic
1071606019 10:86990535-86990557 AAGGTGGAGTGCTCCTCAAATGG + Intergenic
1073216431 10:101839432-101839454 GAGGGGCAGGGCGCCTCCCAGGG - Intronic
1073615667 10:104992188-104992210 CAGGCTCAGGGCCTCTCACATGG - Intronic
1075911688 10:126130658-126130680 AAGGTGCAGGGCAACTGTCAGGG - Intronic
1076462088 10:130654698-130654720 AACTTGCAGGGGCCCTCAGAGGG + Intergenic
1076775111 10:132691072-132691094 GACGTGCAGGGCACTTCACATGG - Intronic
1076798032 10:132808229-132808251 CACGTGCAGGGCCCCTCAGAAGG - Intergenic
1081549949 11:44101640-44101662 AAGATGCAGGTCCCCTCACTGGG - Intronic
1082788505 11:57330926-57330948 ATGGTGCATGTCCCCTCACAGGG - Exonic
1083732679 11:64661220-64661242 AAGGTGGAGGGGCCCACACAAGG - Intronic
1084651848 11:70494145-70494167 AAGGTTGAGGGGCCATCACAGGG - Intronic
1084899774 11:72300857-72300879 ATGGAGCAGGGCCCCTGAAAAGG + Intronic
1092541069 12:9420037-9420059 GAGGAGCAGGGCCCCTGTCACGG + Intergenic
1098071950 12:66685170-66685192 GAGGTTCTGGGCCCCACACATGG + Intronic
1098358961 12:69636701-69636723 AAGGTGCACGCCACCACACACGG + Intergenic
1098688720 12:73459389-73459411 AAGGTCAAGGGGCCCTCACCTGG + Intergenic
1099525645 12:83716185-83716207 AAGGTGTAGGCCCCCTCAGATGG - Intergenic
1100333169 12:93604799-93604821 CAGGTGCACGGCCCCACACCTGG + Intergenic
1102240623 12:111322418-111322440 CAGGTGCTGGGCCTGTCACAGGG + Exonic
1102863663 12:116357402-116357424 GAGGTGCAGGGCTCCTCCAATGG - Intergenic
1105491040 13:20888491-20888513 CAGGTGCAGGCCTCCACACATGG + Intronic
1106583754 13:31039173-31039195 AAGGAGCAGGGCTGCTCACCTGG + Intergenic
1106938520 13:34750476-34750498 ACTGTGCAGGGCCCCTCCCTTGG + Intergenic
1114367621 14:22046744-22046766 AAGGACCAGGGCCCCTCTGAAGG + Intergenic
1116962669 14:50982381-50982403 AAGGTGCAAGTCCCTTCACCTGG + Intronic
1118743572 14:68758449-68758471 TTGGTGCAGGGCAGCTCACAGGG - Intergenic
1124365565 15:29068776-29068798 TAGGTGAAGGGGCTCTCACAGGG + Intronic
1124963417 15:34414991-34415013 TAGGTGAAGGGGCTCTCACAGGG + Intronic
1124980038 15:34561217-34561239 TAGGTGAAGGGGCTCTCACAGGG + Intronic
1126413576 15:48395924-48395946 AGGGTGTGGGGCACCTCACATGG + Intergenic
1127796275 15:62441170-62441192 TAGCTTTAGGGCCCCTCACATGG + Intronic
1128750589 15:70146233-70146255 AAGGTGAAAGGCACATCACATGG + Intergenic
1130068378 15:80626107-80626129 GAAGTGCAGTGCCCATCACAGGG + Intergenic
1130078921 15:80714094-80714116 CAGGTGCAGGGCACCTCACCTGG + Intronic
1130977672 15:88789706-88789728 AAGGTCCAGGGCCCCCATCAGGG + Intergenic
1131103969 15:89717555-89717577 AAATTTCAGGGCCCCTCACTTGG + Intronic
1137565592 16:49530792-49530814 GAGAGGCAGGGCCCCTAACAGGG + Intronic
1143188007 17:5022232-5022254 CAAGCGCAGGGCCCCTCGCAGGG + Exonic
1147157848 17:38553352-38553374 ATGGTGCAGGGCACCTCTTAGGG - Intronic
1147211991 17:38877274-38877296 GAGGTGCAGGGCCCCGCCCAAGG + Intronic
1148046766 17:44749320-44749342 AAGGTGCTTGGCTCTTCACAGGG + Intronic
1150129135 17:62657549-62657571 AAGGTGCAGGGCCCCTCACAAGG - Intronic
1150967163 17:69984547-69984569 AAGGTGCAGGGGCCCACATCTGG + Intergenic
1151815339 17:76468907-76468929 AAGGTGAGTGGCCCCGCACAGGG + Exonic
1154359232 18:13645280-13645302 AGGGTGCAGGGCCCCTGGTAAGG - Exonic
1156154739 18:34288025-34288047 AAGCTGCAGGGCCCCAGACCTGG + Intergenic
1157486366 18:48090202-48090224 CAGGTGCTGGGCCAGTCACAGGG + Intronic
1160722213 19:602777-602799 AAGATGCAGGAGACCTCACAAGG - Intronic
1161459704 19:4389458-4389480 AGAGTACAGGGCCCCACACAGGG + Intronic
1161988974 19:7673196-7673218 AAGGGGCAGGGACACACACAAGG - Intergenic
1163311088 19:16514952-16514974 AAGGGACAGGACCCCTCCCATGG - Intronic
1163418760 19:17202639-17202661 AGGGTGCAGGGCTCCCCACCAGG - Intronic
1163427386 19:17246701-17246723 AAGGGGCAGGCCCCCAGACAGGG - Intronic
1164566424 19:29329140-29329162 AAGCTGCAGGGCACATCTCAGGG + Intergenic
1166634998 19:44443258-44443280 AAGGCACAGGGCCCCTCAGAAGG + Intronic
1166766415 19:45254134-45254156 AAGTTCCAGGGCCCCCCACCAGG + Intronic
1167908901 19:52685236-52685258 AAGTTGCAGGGACGCTCACTGGG + Intronic
1168235352 19:55059527-55059549 CAGGTGCAAGCCCCCTCACCTGG - Intronic
925063103 2:908705-908727 AAGGGGCAGGGCAGCTCTCAGGG - Intergenic
925609337 2:5691400-5691422 AGGGCGCCGGGCCCCTCGCAGGG + Intergenic
926295345 2:11564874-11564896 AAGGTGAAAGGCACATCACATGG + Intronic
926328226 2:11803689-11803711 AGGCTGCAGGGTCCCACACATGG - Intronic
927488869 2:23507305-23507327 AAGGAGCAGGGCCCATTTCAGGG + Intronic
935779988 2:106502537-106502559 CAGGTGCATGGCCACTCCCAGGG - Intergenic
938698029 2:133852292-133852314 AAGGTGAAGGGCACATCTCATGG - Intergenic
940467854 2:154055247-154055269 AAGGTGAAGGAACCCTGACATGG - Intronic
940864649 2:158805955-158805977 AATGGGTAGGGCCCCTCCCAGGG + Intronic
941547907 2:166876928-166876950 AAGTTGAAGGGCCTCCCACATGG - Intergenic
947568560 2:231212664-231212686 AAGGTGAAGGGATCCTCCCAGGG - Intronic
947809823 2:232997351-232997373 AAGGGGCAGCACGCCTCACAGGG + Intronic
947972164 2:234333504-234333526 AAGTTGCAGGGGAACTCACAGGG + Intergenic
948155627 2:235778702-235778724 TTGGAGCAGGGCCCCACACAAGG + Intronic
1169895853 20:10504369-10504391 AAGGTCCAGGGGCTCCCACAAGG - Intronic
1170575197 20:17657309-17657331 AGGGGACAGGGCCTCTCACACGG + Intronic
1170722894 20:18900009-18900031 AAGCTGCAGTGCCCACCACAGGG + Intergenic
1172508220 20:35479867-35479889 AGGGTGCAGGGCCTCTGAGATGG + Intronic
1175597343 20:60246081-60246103 AGAGTGCAGGGCCCTTCAAAGGG + Intergenic
1175990447 20:62785937-62785959 GGGGTGCAGGGGCCCTCACAGGG - Intergenic
1178590988 21:33909924-33909946 AAGAGGCAGGGCCCCTCCAAGGG - Intronic
1179035060 21:37752574-37752596 GAGGTGCTGGGTCCCACACATGG + Intronic
1179504981 21:41834321-41834343 AGGGAGCAGGGCCTCTCACATGG + Intronic
1181407243 22:22693782-22693804 AAGGTGCAGGTCCCACCGCAGGG - Intergenic
1182112157 22:27731487-27731509 ATGGTGAAGGGCTCCTGACATGG - Intergenic
1182403971 22:30108320-30108342 AAAGTTCAGGGTCCTTCACATGG + Intronic
1182664385 22:31946357-31946379 AAGGTTCAGGGTCCCTTCCAAGG - Intronic
1183314537 22:37129600-37129622 GAGGTGCAGGGGCCCTCCCAGGG - Intronic
1183319637 22:37157140-37157162 AAGCTGCAGGGGCCCACAGAGGG + Intronic
1184098670 22:42330080-42330102 AATCTGCAGGGCCACTCAGATGG - Intronic
1184468778 22:44683954-44683976 CAGGGGCTGGGCCCCTCGCAGGG + Intronic
1184781266 22:46650848-46650870 AAGGTTTAGGGACGCTCACAAGG - Intronic
1184839801 22:47046053-47046075 CAGGTCCAGGGTCCCTCATATGG + Intronic
963280831 3:143383611-143383633 GAGTTTCAGGGCCCCTCACTTGG - Intronic
966826208 3:183967116-183967138 AGCGTGCAGGGCCCAGCACACGG - Intronic
967611080 3:191506717-191506739 AAGGTACAGAGGCCCTAACATGG - Intergenic
969584057 4:8081771-8081793 AAGGGAAAGGGCCTCTCACAAGG + Intronic
969888574 4:10238728-10238750 AAGGTCCAGGGACCCACATATGG - Intergenic
970540782 4:17076898-17076920 AAGCTTCAGGGCCCCTTGCATGG + Intergenic
972704928 4:41532929-41532951 CTGGTTCAGGGTCCCTCACAAGG + Intronic
976266401 4:83189622-83189644 AAGATGCAGAGCCACTCTCAAGG + Intergenic
977395877 4:96469767-96469789 AAGGTGAAAGGCACATCACATGG + Intergenic
977731837 4:100363119-100363141 GAGGGGCAGGACTCCTCACATGG + Intergenic
981082931 4:140653063-140653085 AAAGTGCAGGGCTTCACACAAGG + Intronic
983635425 4:169893132-169893154 AAGGTGCACAGCCCCTGCCAAGG - Intergenic
984752827 4:183295487-183295509 ACAGGGCAGGGGCCCTCACATGG - Intronic
985604431 5:850781-850803 TCGGTGCAGGGCCCCGCCCAGGG + Exonic
986416896 5:7537833-7537855 CAGATGCTGGGCTCCTCACAGGG + Intronic
995829700 5:116342009-116342031 AAGGTGCAAGGTCTCACACATGG + Intronic
998034440 5:138902389-138902411 AGGGTGCTGGGCACCTCACCAGG + Intronic
999368227 5:151036832-151036854 AAGGAGCAGGGGCCCTCCTAAGG - Exonic
1001094734 5:168767490-168767512 GAGGTGCTGGGCTCCTCACCTGG - Intronic
1002310954 5:178313488-178313510 ACAGTGCCGGGCTCCTCACACGG - Intronic
1002352118 5:178590421-178590443 AAGGAGCAGGGACCCACCCAGGG + Exonic
1002494168 5:179600394-179600416 TCCGTGCAGGGCTCCTCACATGG + Intronic
1006678223 6:35778737-35778759 AAGCAGCAGGGCCCCTACCATGG + Intronic
1006913801 6:37581777-37581799 AATGTGCAGTGCCCAGCACATGG - Intergenic
1007046350 6:38778861-38778883 AAGGTGCAGGAGCCCTCAGGAGG - Intronic
1010178048 6:73052490-73052512 AAGGGGCAGGCCACCTCCCAAGG + Intronic
1013251759 6:108341509-108341531 TGGGTGCAGGGCCCAGCACAGGG - Intronic
1013472170 6:110475711-110475733 ACGCTGCATGGCCCCTCACCCGG + Intronic
1017502674 6:155039716-155039738 AAGCTTCAGGGCCCCTCCTATGG - Intronic
1018391510 6:163345048-163345070 TAGCTCCAGGGCCCCTCACTGGG - Intergenic
1019463275 7:1172655-1172677 GAGGAGCAGGGCCCCTCCCCGGG - Intergenic
1019916165 7:4134130-4134152 AAGCTCCAGGCCCCCTCTCAGGG - Intronic
1020254845 7:6497375-6497397 AGGGTGTCGGCCCCCTCACAGGG + Intergenic
1020559770 7:9716603-9716625 AAGCTTCAGGGCCCTTCACTTGG + Intergenic
1023235755 7:38084534-38084556 ATGGTACAAGGCCCCTCACCTGG + Intergenic
1023925847 7:44669125-44669147 AAGCTGCCGGGCTCCCCACAGGG - Intronic
1030328470 7:108247340-108247362 AATGTGCAGGTCTCCTTACAAGG + Intronic
1033316265 7:140300221-140300243 CAGGTGCAGGCCACCTCACCTGG + Intronic
1034983611 7:155494235-155494257 AGGCTGCAGGGCTCCTCACTCGG - Intronic
1037540557 8:19866538-19866560 CAGGTGCAGGGCACCACACCTGG + Intergenic
1038095984 8:24310691-24310713 ATGGTGCATGACCCCTCACATGG - Intronic
1040072891 8:43202500-43202522 CAGGTGCATGGCATCTCACAGGG + Exonic
1044524463 8:93236572-93236594 AAGGTGCAGTTTCCCTCAAAAGG - Intergenic
1044712563 8:95071950-95071972 AAGGTTCAGGGCCGGTCACTGGG + Intronic
1045511164 8:102813057-102813079 TAGGTGCAGGGCCCCTTCAAGGG + Intergenic
1046115444 8:109778506-109778528 CATGTGCAGGGCCACTGACAGGG - Intergenic
1050581919 9:7067518-7067540 AAGGTGCAGGGCAACTCCAAAGG + Intronic
1051702694 9:19841467-19841489 TAGGTGAAGTGCCCCTCAAAGGG + Intergenic
1052274232 9:26659564-26659586 AAACTGCAGGTCCCATCACAAGG - Intergenic
1052311352 9:27072700-27072722 AAGGTGAAAGGCATCTCACATGG - Intergenic
1055766328 9:79667320-79667342 AAGGAGAAGGGCCCCTGACGTGG - Intronic
1057696042 9:97323655-97323677 GGGGTGCAGGGCCCTTCACCTGG + Intronic
1057842101 9:98494699-98494721 AAGGTGAAGGGCTCTGCACAGGG + Intronic
1059335522 9:113566288-113566310 CAGGTGCAGGCCCTCTCCCATGG - Intronic
1060223066 9:121774514-121774536 GAGGTGACGGGCCCTTCACAAGG - Intronic
1061775029 9:132956804-132956826 GTGGCTCAGGGCCCCTCACAAGG + Intronic
1062024184 9:134332841-134332863 AGGGTGCAAGGCCATTCACAGGG - Intronic
1189730870 X:44019377-44019399 AAAGTGCAGGGCCCTTCTGAGGG + Intergenic
1191735818 X:64386908-64386930 CAGGAGCATGGCCCCACACATGG - Intronic
1194979221 X:100423278-100423300 AAAGGGCAGGGCCCCTGGCAAGG - Intergenic
1195283445 X:103359175-103359197 AAGGTGCAGGACCCAGCAGAAGG - Intergenic
1201488053 Y:14512512-14512534 AAGTTGTAGTGTCCCTCACAGGG - Intergenic