ID: 1150129964

View in Genome Browser
Species Human (GRCh38)
Location 17:62663765-62663787
Sequence CAGTGCAAGGGGCAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1263
Summary {0: 1, 1: 0, 2: 7, 3: 102, 4: 1153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150129955_1150129964 1 Left 1150129955 17:62663741-62663763 CCTAGAAGAAGGAAAGGATGGAA 0: 1
1: 0
2: 5
3: 63
4: 594
Right 1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG 0: 1
1: 0
2: 7
3: 102
4: 1153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150129964 Original CRISPR CAGTGCAAGGGGCAGGGGGA AGG Intronic
900296648 1:1955262-1955284 CAGGGCAGGAGGCATGGGGAGGG + Intronic
900354048 1:2251415-2251437 CAGGGGCTGGGGCAGGGGGAGGG - Intronic
900584387 1:3425469-3425491 CTGTGCACGGGGCACGGGGCAGG + Intronic
900755999 1:4435171-4435193 GGGTGCAAGGGGCTCGGGGAAGG - Intergenic
900801577 1:4740349-4740371 CAGGGCCTGGGGGAGGGGGATGG + Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
901034622 1:6328924-6328946 CAGGCCAAGGGGGAGGGAGAAGG - Intronic
901122296 1:6905682-6905704 CAAAGCAGGGGGCAGGGGCACGG - Intronic
901384435 1:8898152-8898174 CAGTGAAAGGGCCAGCGGGTCGG - Intergenic
901824172 1:11849767-11849789 CAGCCCCAGGGGCATGGGGAAGG - Intergenic
901932934 1:12608557-12608579 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
902148338 1:14421831-14421853 AAGTGAAAGAGGCCGGGGGAGGG - Intergenic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902642585 1:17776232-17776254 TGGTGGAAGGGGCAGGGTGAAGG - Intronic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
902906007 1:19557861-19557883 AAGTGAAAGGGGAAGGGGAAGGG - Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903257502 1:22112718-22112740 CAGGGAAAGGGGTGGGGGGAGGG + Intergenic
903273796 1:22208328-22208350 CAGTGGCTGGGGCAGGGGCAGGG + Intergenic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903686331 1:25134970-25134992 CAGGGCAATGGGGATGGGGAGGG - Intergenic
903894547 1:26595385-26595407 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894550 1:26595391-26595413 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894553 1:26595397-26595419 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894556 1:26595403-26595425 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894559 1:26595409-26595431 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
904408053 1:30306609-30306631 CAGTGGAAGGGAGAAGGGGAAGG - Intergenic
904452966 1:30628227-30628249 CAGTGCACGGGGCTGGGGTGTGG + Intergenic
904586261 1:31582593-31582615 CAGGGCAAGGGGCAGATGCATGG + Intronic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904934938 1:34123383-34123405 TAGGGCAAGGTGTAGGGGGAGGG - Intronic
904983177 1:34523763-34523785 CAGGGCAATGGGTAGGGGGGAGG + Intergenic
905002899 1:34687186-34687208 GAATGGAAGGGGCAGGAGGAAGG - Intergenic
905037015 1:34925131-34925153 CAGTGGGAGGGGCAGGGGAGAGG - Intronic
905143059 1:35864401-35864423 AAGTGCAGGGGCCAGGGGGCAGG - Intergenic
905216573 1:36412576-36412598 CAGTGCAAGAGGCAGGCCGCAGG - Intergenic
905305332 1:37013925-37013947 GGGTGCAAGGGGCTGGGGCAAGG - Intronic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905552580 1:38855195-38855217 CAGTCCAGGGGGGAGGTGGAAGG + Intronic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
905884577 1:41484824-41484846 CAGTGAAGGGGGGAGGGAGATGG + Intergenic
905925213 1:41744885-41744907 GAAGGCAGGGGGCAGGGGGAAGG + Intronic
905933008 1:41802986-41803008 CATTGCCAGGGGCAGGGAGTGGG - Intronic
906060716 1:42946725-42946747 CAGTGCTAGGTGTAGGGGGAGGG + Intronic
906118924 1:43374533-43374555 GGGGGCAAGGGGCAGGGGGATGG + Intergenic
906127939 1:43439133-43439155 AAGTGCGTGGGGCAGGGGGCAGG - Intronic
906427777 1:45727433-45727455 AAGGGCAAGGGGAAGGGGAAGGG - Intronic
906680097 1:47720440-47720462 CAGTGGGAGGGACAGGGGGAGGG - Intergenic
906746145 1:48223388-48223410 CAGTGCTAGAGGCAGGGGCCAGG + Intronic
907269077 1:53280120-53280142 CAATGCTGGGGGGAGGGGGACGG - Intronic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907621294 1:55983461-55983483 AAGGGGAAGGGGCAGGGGAAGGG + Intergenic
907806621 1:57826861-57826883 GAGAGCAAGAGACAGGGGGAAGG + Intronic
908140015 1:61174466-61174488 CAGTGCAAGGGGCAGAGAGATGG + Intronic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
909262561 1:73511434-73511456 CAGGGACAGGGGCTGGGGGATGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909467129 1:75984993-75985015 CAGTCCAATGGGCAGGGGTGGGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910396882 1:86802452-86802474 CAGTGGAAGGGCCAGTGGGTTGG + Intergenic
910522189 1:88135423-88135445 CCATGCTAGGGGCAGGGGGCTGG - Intergenic
910576994 1:88776210-88776232 GAGGGCAAGGGGGAGGGGGTAGG - Intronic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911746091 1:101443178-101443200 GAGGGTAGGGGGCAGGGGGATGG + Intergenic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912450786 1:109766340-109766362 AAGTACAAGGGGCAGGGAGTTGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912873259 1:113328929-113328951 CATTGCCAGGGGGATGGGGAAGG + Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913531782 1:119738767-119738789 CAGAGCGAGGGGGTGGGGGAGGG + Intronic
913692181 1:121289554-121289576 CAGTGCAGGGGGGAGGCTGAAGG + Intronic
914145374 1:144990560-144990582 CAGTGCAGGGGGGAGGCTGAAGG - Intronic
915108572 1:153549021-153549043 CAGGGCAGGAGGCAGGGTGAGGG - Intronic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915283568 1:154838820-154838842 CTGTGCAAGGTGCTGGGGGTGGG - Intronic
915461954 1:156075695-156075717 TAGGGGCAGGGGCAGGGGGAAGG + Exonic
915640610 1:157221640-157221662 CATTGCCAGGGGCTGGGGGTTGG - Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916641202 1:166730197-166730219 CAGAGCAGGGGTCAGGGGGAGGG - Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
917284646 1:173411256-173411278 TAGTGTCAGGGGCAGGGGCAGGG + Intergenic
917333022 1:173901939-173901961 CAGTGCCAGGGACAGGTAGATGG - Exonic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918230333 1:182524389-182524411 CAGTGCAAGTGGAAGTGGAAGGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918749759 1:188258147-188258169 CAGTGAAAGGGCCAGTGGGTTGG + Intergenic
919685973 1:200483968-200483990 CAGTGCTAAGGGCAGGTTGATGG - Intergenic
920220192 1:204391762-204391784 CAGCACAAGGGACAGGAGGAAGG + Intergenic
920263761 1:204707094-204707116 CACTGCCAGGGGCAGGAGTAGGG - Intergenic
920286778 1:204885366-204885388 CAGGGCAAAGGGGAGGGTGAAGG - Intronic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
920697409 1:208191852-208191874 CTGGGCACGGGGCAGGGCGAGGG + Intronic
921020251 1:211228692-211228714 CAGTGAAAGGGCCAGTGGGTCGG - Intergenic
921182261 1:212640756-212640778 TAGTGCAGGGGGCAGAGGGCAGG - Intergenic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921238579 1:213153306-213153328 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921238582 1:213153312-213153334 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922818547 1:228468912-228468934 AAGTGCGGGGGGCAGGGGGGAGG - Intergenic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
923290574 1:232541089-232541111 CAATGAGAGGGGCAGGGGAAGGG + Intronic
923672306 1:236051253-236051275 GAGGGGGAGGGGCAGGGGGAGGG - Intronic
924309196 1:242722396-242722418 CGGGGCAGGGGGCAGGGGCAGGG - Intergenic
924551348 1:245080902-245080924 GAGTACAAGGAGCAGGGAGAAGG - Intronic
924561700 1:245161963-245161985 GAATGCAAGGGGCGGGGGGAAGG + Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
1062895746 10:1101863-1101885 CAGGACAAGGGGCAGCTGGATGG - Intronic
1062920401 10:1274814-1274836 CAGTGCAAGGGTCAAGGTCAAGG - Intronic
1062968272 10:1626684-1626706 CAGGGCCATGGGCAGAGGGAAGG + Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064479506 10:15725410-15725432 CAGTGCAAAGGGTGGGGGGTGGG + Intergenic
1064521803 10:16210345-16210367 CACTGCAAGGGGATAGGGGAGGG + Intergenic
1065827822 10:29587970-29587992 CAGTGCAGGGGCCAGGGTGGGGG - Intronic
1066356280 10:34687275-34687297 CAGGGCAAGGGGGCTGGGGAAGG + Intronic
1066383735 10:34923236-34923258 TAGTGAAAGGGTCAGGGGGCTGG + Intergenic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066522304 10:36235329-36235351 GCTTGCCAGGGGCAGGGGGAGGG + Intergenic
1066961323 10:42230542-42230564 CAGGGCCAGGGCCAGGGTGAAGG + Intergenic
1067067732 10:43113126-43113148 CAGGGTCAGGGACAGGGGGAAGG + Intronic
1067757152 10:49013797-49013819 CAGTGCAAGGGGCAGTTTTAGGG + Intergenic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068525563 10:58125538-58125560 AAGGGCAGGGGGCAGGGGGCAGG + Intergenic
1069817585 10:71208413-71208435 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070659339 10:78293550-78293572 CAGTCAAAGGGGGAGGGGGTGGG - Intergenic
1070675639 10:78409675-78409697 GAGTGGAGGGGGCAGGGGCATGG - Intergenic
1070676195 10:78413225-78413247 CAGGGAATAGGGCAGGGGGAAGG + Intergenic
1070735040 10:78857474-78857496 CAGGGCCAGGGGCAGAGGAAGGG - Intergenic
1070808956 10:79287944-79287966 CAGTGCCAGGGTGAGGGGGCAGG + Intronic
1070954607 10:80455523-80455545 AAGGTCAAGGGGCAAGGGGAAGG - Intronic
1071270435 10:84001799-84001821 GAGTGGAAGGGGCATGGAGAAGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071519361 10:86319524-86319546 CGGGGCCTGGGGCAGGGGGAGGG - Intronic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1072344440 10:94489372-94489394 CACTGCCAGGGGTTGGGGGAGGG + Intronic
1073091142 10:100940797-100940819 AAGGGGCAGGGGCAGGGGGAGGG - Intronic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1074190208 10:111128904-111128926 CGGAGCAGGGGGCAGGGGGGAGG - Intergenic
1074501499 10:114028979-114029001 CATTGCAAGGGGCTGGGGGAAGG - Intergenic
1074520340 10:114215153-114215175 CAGTGCAGGGGGCAGCAGCAAGG - Intronic
1074561123 10:114536099-114536121 GAATGCCAGGGGCTGGGGGAAGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1075496244 10:122922102-122922124 CACTGCAAGGGGATAGGGGAGGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076229587 10:128808985-128809007 CAGTGGGTGGAGCAGGGGGAAGG - Intergenic
1076566123 10:131400665-131400687 CAGTGCAAAGGGGAGGGTGGAGG + Intergenic
1076632236 10:131858081-131858103 CAGGGCAAGGGGCGGGGGGGCGG + Intergenic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076859414 10:133133568-133133590 CAGGGGACGGGGTAGGGGGAGGG + Intergenic
1076897319 10:133318989-133319011 CATTGCCAGGGGCAGGCGGCTGG + Intronic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077094994 11:795482-795504 CAGTGCCAGGGGCCGGGGCCAGG + Intronic
1077164795 11:1130175-1130197 CAGATGAAGGGGCCGGGGGAGGG + Intergenic
1077221881 11:1421587-1421609 CAGTGCCAGGTGCAGAGGGAAGG - Intronic
1077235850 11:1481715-1481737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077235853 11:1481721-1481743 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077305118 11:1865487-1865509 CAGTGCAGGTGGGATGGGGAAGG - Intronic
1077368077 11:2169321-2169343 CAGCACAAGAGGCAGGGGCAGGG - Intronic
1077386960 11:2274264-2274286 GGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077438955 11:2559407-2559429 TAGAGCCCGGGGCAGGGGGAGGG + Intronic
1077451861 11:2653247-2653269 CAGGGCAGAGGGCAGGGAGAAGG - Intronic
1077874681 11:6294117-6294139 CAGGGGAAGGGGCAGGGGTGGGG + Intergenic
1078042599 11:7882637-7882659 CAGTGCAAGGGGGAGCAGGGAGG - Intergenic
1078337700 11:10476926-10476948 CAGGACCAGGGGCAAGGGGAAGG + Intronic
1078487942 11:11741169-11741191 GATTGCCAGGGGCTGGGGGAGGG + Intergenic
1078871275 11:15347513-15347535 GAGTGAAAGGGACAGAGGGAAGG - Intergenic
1078881250 11:15450957-15450979 GAGTGCAAGGGGCAGGGAAGTGG + Intergenic
1079133774 11:17764638-17764660 CGGCGCAAGGGGCAGTGGGCGGG - Intronic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080384489 11:31803117-31803139 CAGTACAGTGGGCAGGGGCACGG - Intronic
1081931163 11:46872403-46872425 AAATGCTAAGGGCAGGGGGAAGG - Intronic
1082849582 11:57753312-57753334 GGCTGCAAGAGGCAGGGGGATGG + Intronic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083616401 11:64028649-64028671 CAGCGCCAGCGGCAGGGGGCGGG - Intronic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083647957 11:64184067-64184089 CAGTGCAAAGGGCCTGGGGTGGG - Intergenic
1083692484 11:64418806-64418828 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1083738455 11:64694936-64694958 CAGTGGAAGGGTCTGGGAGAGGG - Intronic
1083880025 11:65543788-65543810 CAGTGAAAGCGGCTGGGGCAGGG - Intronic
1084155790 11:67311777-67311799 CAGGGGCAGGGGCAGGGGCAGGG + Exonic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084539578 11:69777430-69777452 CAGGTCAAGGGCCAGGGGCACGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084608419 11:70185856-70185878 CAGTGCAGGGGGCCTGGGGTCGG - Intronic
1084614989 11:70229825-70229847 AAGTGCAAAGGCCAGGGGCACGG + Intergenic
1084676079 11:70635542-70635564 GGGTGCCAGGGGCCGGGGGAGGG + Intronic
1084891705 11:72239962-72239984 CAGTGCGACGGGCAGCGGGCTGG + Exonic
1084937998 11:72597468-72597490 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1085042479 11:73334755-73334777 CAGACCCAGGAGCAGGGGGAAGG - Intronic
1085194869 11:74663012-74663034 CACTGCAAGGGGATGAGGGAGGG + Intronic
1085297418 11:75438995-75439017 AAGTGCCAGAGGCAGGGGGATGG + Intronic
1085336667 11:75701919-75701941 CAATGCAGGGGGCTGGGGCATGG + Intergenic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085521680 11:77142837-77142859 CAAGGCATGGGGCAGGAGGAGGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085726508 11:78959652-78959674 CAGAGCAAGGGCCTGGGGAAGGG + Intronic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086143383 11:83523823-83523845 CAATGGCAGGGGCAGGGGGCGGG + Intronic
1086365843 11:86109743-86109765 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365846 11:86109749-86109771 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365849 11:86109755-86109777 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087844753 11:102960513-102960535 AAGTAAAAGGGGCAGGGGCACGG + Intergenic
1088541018 11:110913663-110913685 GAATTCAAAGGGCAGGGGGAGGG - Intergenic
1088841578 11:113631802-113631824 CACTGCAAGAGGAAGGGTGAGGG + Intergenic
1089286149 11:117409387-117409409 CAGGGCAAGGTGCTGGGTGAAGG - Intronic
1089346900 11:117796715-117796737 GAGGGCAAGGGGCTGGGGGAGGG + Intronic
1089384011 11:118056292-118056314 CAGGGCAAGGGACAGGGGAGAGG + Intergenic
1089575404 11:119438904-119438926 CAGTGACAGGGCCAGGGTGAGGG - Intergenic
1089610807 11:119667484-119667506 AAGTGCAGGGTGCAGGGGAACGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090111150 11:123910844-123910866 CACTGCCTGGGGCTGGGGGAGGG - Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091336059 11:134767226-134767248 CACTGCCTGGGGCTGGGGGAGGG - Intergenic
1091630074 12:2153479-2153501 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1091791310 12:3273725-3273747 CAGTGCAGCGGGCAGGGAGAGGG - Intronic
1091912338 12:4242655-4242677 CAGTGCAGGAGGCAGGGAAATGG - Intergenic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092030061 12:5276511-5276533 CAGTGCCAGGGCCCGAGGGAGGG - Intergenic
1092540246 12:9416169-9416191 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093281695 12:17203738-17203760 CAGAGCAAGGGGGATGGGGGGGG - Intergenic
1093407796 12:18826332-18826354 GAGTAGCAGGGGCAGGGGGAAGG - Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093624826 12:21332608-21332630 CAGTGCTGGGAGCAGGGGGTGGG + Intronic
1093850924 12:24037122-24037144 TAGTGATAGGGGGAGGGGGAGGG + Intergenic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1096109657 12:49021263-49021285 CAGATCAAGAGGGAGGGGGATGG + Exonic
1096492746 12:52021919-52021941 AATTGCAAGGGGGAGGGGAAGGG - Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096851650 12:54442635-54442657 CAATGCATGGGGCAGGGTAAGGG + Intergenic
1096920161 12:55075646-55075668 CAGGGTATGGGGTAGGGGGAGGG - Intergenic
1097017625 12:55998535-55998557 CCCTGTCAGGGGCAGGGGGAGGG + Intronic
1097057089 12:56256857-56256879 CAGTTCTAGGGGTAGGAGGAAGG + Intronic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097781705 12:63714220-63714242 CATTGCAAAGGGCAGAGAGAAGG - Intergenic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1100070365 12:90709094-90709116 CAGGGCAGGGGGCAGTGGGGTGG + Intergenic
1101111741 12:101493002-101493024 GATTGCTAGGGGCAGGGGGAAGG - Intergenic
1101226379 12:102692027-102692049 CAGTGCATGAGACAAGGGGAGGG - Intergenic
1101705512 12:107217124-107217146 CAGTGAAAGGGCCAGCGGGTCGG - Intergenic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102015638 12:109646121-109646143 CACTTCAAGGGGCTGGGGGCTGG + Intergenic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102884114 12:116508737-116508759 CAGGGCAGGGGGAACGGGGAAGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103316797 12:120062711-120062733 CATTCCAAGGGAAAGGGGGAAGG - Intronic
1103497581 12:121374703-121374725 CAGGGCGGGGGGCAGGGGGTGGG - Intronic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1104653943 12:130559306-130559328 CAGGGCATGGGGTAGGGGGTGGG - Intronic
1104861822 12:131928022-131928044 CAGTGCAAGAGCCAGGAGGCAGG - Intergenic
1104886143 12:132109757-132109779 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1106443226 13:29799208-29799230 CTTTGCCGGGGGCAGGGGGAAGG - Intronic
1107559633 13:41547571-41547593 CAGTGCACAGGGCAGAGGGTTGG - Intergenic
1107567217 13:41617630-41617652 CAGGGCGGGGGGCTGGGGGAGGG - Intronic
1107594143 13:41944331-41944353 CAGAGCTAGGGACATGGGGATGG - Intronic
1107649916 13:42534855-42534877 CAATCCCAGGGGCTGGGGGATGG - Intergenic
1107833958 13:44398695-44398717 CTTTGCAAGGGGCTGGGGGCTGG - Intergenic
1107893650 13:44936955-44936977 CCATGCACAGGGCAGGGGGATGG - Intergenic
1107958183 13:45537847-45537869 CAGGGCTGGGGGCAGGGGCAGGG - Intronic
1108273177 13:48783091-48783113 CATTCCTAGGGGAAGGGGGAGGG - Intergenic
1108425110 13:50291572-50291594 GAGAGCAAGAGGTAGGGGGAAGG + Intronic
1108685721 13:52817483-52817505 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1108692901 13:52875812-52875834 CAGGAGGAGGGGCAGGGGGAAGG - Intergenic
1109311167 13:60695328-60695350 GAGCACAGGGGGCAGGGGGATGG + Intergenic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111011418 13:82320162-82320184 CAGGGGCAGGGGCAGGGGGGAGG - Intergenic
1112441854 13:99430138-99430160 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1112648150 13:101359027-101359049 CGGGGTGAGGGGCAGGGGGAGGG + Intronic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113238893 13:108314596-108314618 CAGAGCAAGTGGCCGGGTGAGGG - Intergenic
1113436582 13:110296936-110296958 CAGAGCAAGGTGTAGGGGAAGGG + Intronic
1113650607 13:112031768-112031790 CAATGCAAGTTGCAGGAGGATGG - Intergenic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1117224967 14:53647226-53647248 CAGTCAAAGGGGCAGGGGCTTGG - Intergenic
1117477732 14:56114235-56114257 GGGTGCCAGGGGCAAGGGGAAGG + Intergenic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1117490193 14:56239697-56239719 AAGTGCACGGGGCTTGGGGAAGG - Intronic
1117599068 14:57354920-57354942 GGTTGCAAGGGGCTGGGGGAAGG + Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1117763840 14:59059702-59059724 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1117763843 14:59059708-59059730 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117763853 14:59059727-59059749 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117870707 14:60197805-60197827 CAGTGCCTGGGGTTGGGGGAAGG - Intergenic
1118096786 14:62546317-62546339 CACTGCCAGGGGTTGGGGGAGGG - Intergenic
1118309480 14:64682009-64682031 GAGGGCCGGGGGCAGGGGGAGGG + Intergenic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1118743659 14:68758887-68758909 GAGGGGAAGGGTCAGGGGGAGGG - Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119034146 14:71215672-71215694 CAGTGCAGTGGCCAGGGAGATGG - Intergenic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120345791 14:83288476-83288498 AAGTGCAGGGGGCAGGAGCAGGG - Intergenic
1120515639 14:85466221-85466243 CAGAGGCTGGGGCAGGGGGAGGG + Intergenic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1120747937 14:88168581-88168603 CAGGGCTGGGGGCAGGGGTAGGG - Intergenic
1121231975 14:92364961-92364983 CAGTGGAAAGGGCAGGGGCAAGG - Intronic
1121617468 14:95322255-95322277 AAGTGCAGGGAGCAGGGGAAGGG - Intergenic
1121702858 14:95969039-95969061 CATTGCAGGGGCCAGAGGGAGGG - Intergenic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122203940 14:100138965-100138987 CAGGCCATGGGGCAGGGGAACGG + Intronic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122414527 14:101542631-101542653 CACTGCAAGGGGGAGGGGAGGGG - Intergenic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1123053711 14:105559750-105559772 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053714 14:105559756-105559778 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053717 14:105559762-105559784 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078289 14:105680155-105680177 CAGGGCCAGGGCCAGGGGCAGGG - Intergenic
1123078296 14:105680173-105680195 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078299 14:105680179-105680201 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078302 14:105680185-105680207 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078314 14:105680209-105680231 CAGGGGCAGGGGCAGGGGCACGG - Intergenic
1202856922 14_GL000225v1_random:57772-57794 AAGAGGAAGGGGCAGGGCGAAGG - Intergenic
1123449098 15:20349326-20349348 GAGTCCCAGGGGGAGGGGGAGGG - Intergenic
1123538486 15:21262275-21262297 CACTGCCAGCGGCAGGGGGTGGG - Intergenic
1124006358 15:25798374-25798396 GACTGCCTGGGGCAGGGGGAGGG - Intronic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124218169 15:27826522-27826544 CAGTGCAGGGAGCTGGGGAAAGG - Intronic
1124630717 15:31335484-31335506 CGGGGCAGGGGGCGGGGGGAGGG + Intronic
1124649937 15:31467083-31467105 GAGGGCAGGGGGCAGTGGGAAGG + Intergenic
1124853639 15:33365391-33365413 CACTGCGAGGGGCAGAGGAAGGG + Intronic
1125335627 15:38623587-38623609 CAGTGCCAGGGGTGTGGGGAGGG - Intergenic
1125766457 15:42139798-42139820 AAGGGCAGGGGGCAGGGGGCAGG - Exonic
1126104354 15:45137898-45137920 AAATGCAAGGAGCAGGGAGATGG - Intronic
1126201538 15:45992207-45992229 CAGAGCTGAGGGCAGGGGGAAGG + Intergenic
1126335387 15:47581663-47581685 CAGAGCAAAGGACAGGGGGTTGG + Intronic
1126371225 15:47949378-47949400 CAGGTCCAGGGGCAAGGGGAAGG - Intergenic
1126504805 15:49392362-49392384 CAGTGGAATGTGCATGGGGAAGG + Intronic
1126580191 15:50235842-50235864 CAGAGCAAGGGGTAGGGGTGGGG - Intronic
1126660848 15:51031531-51031553 CAGTGCTGGGGGGAGGGAGAGGG + Intergenic
1127547164 15:60002401-60002423 GGGTGCGAGGGGCTGGGGGAGGG - Intergenic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128358344 15:66943685-66943707 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1128559641 15:68656146-68656168 CGGTGCGAGGGGGAGGGGGAGGG - Intronic
1128610845 15:69072018-69072040 TATTGCTAGGGGCAGGGTGAAGG - Intergenic
1128618321 15:69127829-69127851 CAGTGCAGGGGGCAGGGGAGGGG - Intergenic
1128737966 15:70064221-70064243 CAGAGCCAGTGGCAGGGTGAGGG - Intronic
1128961096 15:72005622-72005644 CAGAGGAAGAGGCAGGGGAAGGG - Intronic
1128977827 15:72166512-72166534 CAGGGAATGGGGCAGGGAGAGGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129354549 15:74981032-74981054 CAGTGCAAGGGACTGGAGGGAGG + Intronic
1129823588 15:78620365-78620387 CAGTGCGCGGGGCAGGGCGACGG + Intronic
1129910590 15:79222899-79222921 CAGTCCGTGGGGCAGGGGGAAGG - Intergenic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130559439 15:84946827-84946849 CAGGGCAGGCGGCAGGGAGATGG - Intergenic
1130896939 15:88178172-88178194 CAGTGCAGAGGTAAGGGGGAAGG + Intronic
1130984240 15:88834368-88834390 GAATGCCAGGGGCAGGGGCAGGG - Intronic
1131112775 15:89776050-89776072 CAGTGGACGGGGCAGGGGCGTGG + Intronic
1131112993 15:89776907-89776929 CAGGGGCAGGGGCAGGGGCAAGG + Exonic
1131124571 15:89848100-89848122 CAGTGCAAGGGACCTGGAGAGGG - Intronic
1131296482 15:91153808-91153830 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1131352973 15:91718355-91718377 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1131432937 15:92401131-92401153 CAGTGGAAACGGCCGGGGGAGGG + Intronic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1132030808 15:98437394-98437416 AAGTATAAGGGGCAGGGGGGAGG + Exonic
1132598769 16:764782-764804 CGAGGCAAGGGGCAGGGGGTTGG - Intronic
1132626523 16:894167-894189 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132626534 16:894199-894221 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132736201 16:1387378-1387400 AAGTGCAAGGGATAGGGGGCGGG - Intronic
1132931858 16:2462744-2462766 CAGTGCAGGTGGCAGGGTGGGGG - Intronic
1132950187 16:2557464-2557486 CAGCGCGAGGGACAGGAGGAGGG + Intronic
1132964159 16:2642706-2642728 CAGCGCGAGGGACAGGAGGAGGG - Intergenic
1133019836 16:2962559-2962581 CAGTGCCAGGGACAGAGGGACGG + Intergenic
1133026103 16:2989589-2989611 CAGGGCACGGGGCAGGGGGGAGG + Intergenic
1133113388 16:3562978-3563000 CAGGGCAGGGGGCAGGGGCTGGG - Intronic
1134008933 16:10836823-10836845 TAGGGCATGGGGCATGGGGATGG + Intergenic
1134028965 16:10976752-10976774 CAGGGCAGGGGCCTGGGGGAGGG + Intronic
1134040744 16:11066383-11066405 CAGTCCAGGGGGCAGGGGCTGGG + Intronic
1134049793 16:11129601-11129623 CAGTGCAAGGCCCTGGGGCAGGG - Intronic
1134066623 16:11232512-11232534 GAGGGCGAGGGGGAGGGGGAGGG + Intergenic
1134219644 16:12343715-12343737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1135012626 16:18895526-18895548 CACTCTAGGGGGCAGGGGGAAGG + Intronic
1135339061 16:21630643-21630665 CAGTGGAAGGGCCAGCGGGTTGG + Intronic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136165003 16:28447957-28447979 GAGAGGAAGGGGGAGGGGGAGGG - Intergenic
1136197964 16:28667023-28667045 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136214309 16:28781200-28781222 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136259031 16:29061045-29061067 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136358618 16:29763048-29763070 AATTGCCAGGGGCAGGGGGTAGG - Intergenic
1136551056 16:30982827-30982849 CAGTGAGAGGGTGAGGGGGACGG + Intronic
1136568346 16:31082871-31082893 CGGGGCCAGGGGCAGGGGAATGG + Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1137382926 16:48015196-48015218 AGGAGCAAGGGGCCGGGGGAGGG + Intergenic
1137432170 16:48427230-48427252 CAGTCCCAGGGGCAGGGGCAGGG + Intronic
1137526245 16:49239009-49239031 TTGTGCAAAGGCCAGGGGGAGGG - Intergenic
1137557002 16:49477146-49477168 GAGCGGAAGGGGGAGGGGGAGGG + Intergenic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1137770000 16:51008424-51008446 CAGTGTGTGGGGCAGGGGGGAGG + Intergenic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1138161769 16:54761197-54761219 CCGTTCAAGGGGCAGGGGTGGGG + Intergenic
1138352591 16:56353873-56353895 AGGGGCAAGGGGCAGGGGGTTGG - Intronic
1138439421 16:57025347-57025369 CTCTGCAAGGGGCAGGGACATGG - Exonic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139549290 16:67664589-67664611 CAGTGGGAAGGGCAGGGGTATGG - Intronic
1140136133 16:72207164-72207186 CAGTGCAGAGTGCAGGGTGAAGG + Intergenic
1140277501 16:73523585-73523607 CAGTGCTGGGGGTAGGGGGCAGG + Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1142217607 16:88837544-88837566 CAGTGCTAGAGGCGGGGGGCAGG + Intronic
1142259965 16:89038038-89038060 CAGTCCTGGGGGCAGGGGCAGGG + Intergenic
1142367173 16:89656868-89656890 GAGTGCCAGGGGCGGGGGAAAGG + Intronic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1142610439 17:1106862-1106884 CAGAGCAAGGGGCAGGTACAGGG - Intronic
1142868824 17:2807729-2807751 GAGTGCAGGGGGCTGGGGGAAGG + Intronic
1143444353 17:6998640-6998662 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143887538 17:10076204-10076226 AAGTGGGAGGGGGAGGGGGAGGG + Intronic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144243379 17:13336174-13336196 TAGAGCAAGGTGCAGGGGTAGGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144807804 17:17979173-17979195 CAGTGCAAAGGGCCTGGGGCAGG + Intronic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1145903694 17:28505148-28505170 CAGTGCAAGGGTCAGGGAGATGG + Intronic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1145993306 17:29091943-29091965 CAGTGGGCTGGGCAGGGGGAAGG + Intronic
1146407781 17:32554187-32554209 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146407784 17:32554193-32554215 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146468362 17:33104984-33105006 CACTGCCAGGGCCAGGGTGAGGG - Intronic
1146804801 17:35856650-35856672 CAGTGAGAGGGTCAGTGGGAAGG - Intronic
1146918627 17:36694866-36694888 CAGTGCAAAGGGCACAGAGATGG - Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147265349 17:39231336-39231358 CAGTGCCACGGGCAGTGGGAGGG - Intergenic
1147311523 17:39598755-39598777 CGGTGCCAGGCGCGGGGGGAAGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1148128526 17:45248772-45248794 CAGTGCATGGGTGAGGGGCAAGG - Intergenic
1148239013 17:45987891-45987913 TAGTGCTGGGGGCAGGGGGCAGG + Intronic
1148384524 17:47224539-47224561 GATTGCCAGGGGCTGGGGGAAGG - Intergenic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148440960 17:47711384-47711406 CAGTGCCAGGGGCACCAGGAGGG - Exonic
1148441936 17:47715975-47715997 CAGCGCAGGGGGCAGGGGTGGGG + Intergenic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148614668 17:48991215-48991237 GAGGGGCAGGGGCAGGGGGAGGG + Intergenic
1148905812 17:50911474-50911496 CGGGGCCAGGGGGAGGGGGAGGG - Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150269951 17:63857436-63857458 GAGGGCTGGGGGCAGGGGGATGG + Intergenic
1151297902 17:73199061-73199083 CAGTACAAGGGGCCTTGGGAGGG + Intronic
1151459045 17:74243886-74243908 CATTGCAAGGGTCTGGGGGCAGG + Intronic
1151589410 17:75033703-75033725 CAGTGCCGGGGGCTGGGGGCTGG + Intronic
1151670274 17:75568445-75568467 CAGGGCAAGGGTCAGGGGCCGGG - Intronic
1151898099 17:76993969-76993991 CAGGGCAAGGCCCTGGGGGAGGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152226408 17:79094800-79094822 CAGTGCTACGTGGAGGGGGATGG + Intronic
1152344273 17:79742004-79742026 CAGGGGCAGGGGCAGGGGGCCGG - Exonic
1152349605 17:79777668-79777690 CAGTTCAAGAAGCCGGGGGAAGG + Intergenic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152572002 17:81125022-81125044 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152637615 17:81436557-81436579 CAGGGCAAGGGGCAGGGCCTTGG - Intronic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1155416512 18:25605075-25605097 AAGGGCAAGGGGCAGGTGCATGG + Intergenic
1156239688 18:35240979-35241001 CAGAGCAAGGGGCGGGGCGGCGG + Intergenic
1156461108 18:37321758-37321780 GAGTGAGAGGGGGAGGGGGAGGG + Intronic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157468830 18:47971895-47971917 CAGGGGATGGGGTAGGGGGAAGG - Intergenic
1157490985 18:48123567-48123589 TCCTGCAAGAGGCAGGGGGAGGG - Intronic
1157936915 18:51883574-51883596 CACTGCCAGGGGCTGGGGGAGGG - Intergenic
1158012822 18:52748468-52748490 CAGTGAACGGGGCAAGGGGTGGG + Intronic
1158075534 18:53523757-53523779 GAGGGCAGGGGGCTGGGGGAGGG + Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159954069 18:74507289-74507311 CAGTGCAGGTGGCAGAGAGATGG - Intronic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161088090 19:2344243-2344265 GGGTGCAAGGGGCAGGGTGATGG - Intronic
1161137511 19:2628683-2628705 GGGTGCTAGGGGCTGGGGGAGGG - Intronic
1161160159 19:2757312-2757334 GAGTGCATGGGGCCGGGGGCTGG - Intronic
1161170156 19:2808462-2808484 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161170159 19:2808468-2808490 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161412493 19:4124112-4124134 GAGTCCGAGAGGCAGGGGGAGGG + Exonic
1161640344 19:5418794-5418816 GAGTGCAAGGGGCAAAGGCAGGG + Intergenic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1162045150 19:7994285-7994307 CAGGGCCAGGGGTCGGGGGAGGG + Intronic
1162108489 19:8386248-8386270 CAGTGGAAGGGCCAGTGGGTCGG - Intronic
1162150370 19:8640806-8640828 CCTTGCAAGGGGCAGGGGTGAGG + Intergenic
1162261627 19:9538858-9538880 CAGGGCTACGGGCAGGGGGCGGG + Intergenic
1162470001 19:10867145-10867167 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1162479597 19:10920799-10920821 CAGAGCCATGGGCAGGGGCAAGG - Intronic
1162521339 19:11181587-11181609 GGGTGCCAGGGGCTGGGGGAAGG + Intronic
1162552270 19:11364464-11364486 CAGGGGTAGGGGCAGGGGCAAGG - Exonic
1163010989 19:14426040-14426062 CAGTGCAAGGGCCATGTGGTTGG + Intergenic
1163018722 19:14471792-14471814 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1163865377 19:19769482-19769504 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1164443466 19:28297980-28298002 CAGGGCAATGGGGAGGGGGGAGG - Intergenic
1164540088 19:29115593-29115615 GAGGGCAGGGGGCAGGGGAAGGG - Intergenic
1164565648 19:29324083-29324105 CAGCGCAAGCGGCAGAGAGAAGG + Intergenic
1164804528 19:31106269-31106291 TAGTGCAAGGGGGTGAGGGAGGG - Intergenic
1164992446 19:32693988-32694010 CAGTGAAAGGGCCAGTGGGTCGG + Intronic
1165066797 19:33234321-33234343 CAGTGCACGGGGGAGTGGGGAGG - Intergenic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165745604 19:38228447-38228469 CAGCGCACGGGGTTGGGGGAAGG + Intronic
1165792910 19:38502756-38502778 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792913 19:38502762-38502784 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792916 19:38502768-38502790 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792919 19:38502774-38502796 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792922 19:38502780-38502802 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792925 19:38502786-38502808 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165866734 19:38944024-38944046 GACTGCCAGGGGCTGGGGGAGGG - Intronic
1166081115 19:40444497-40444519 AAGTGCAACTGGCAGGGGGCGGG + Exonic
1166121666 19:40690585-40690607 CAGGGCCCGGGGCCGGGGGATGG + Exonic
1166676654 19:44745376-44745398 GGGTGCAAGGAGCCGGGGGAGGG + Intergenic
1166734171 19:45075001-45075023 AAGGGCAAGGGCCAGGGGGCTGG + Intronic
1166837727 19:45677543-45677565 CAGGGCAATCGGCAAGGGGAGGG + Intronic
1166931736 19:46305221-46305243 TGGTGCCCGGGGCAGGGGGATGG - Intronic
1166975701 19:46603955-46603977 CACTGTAAGGGGCTGGGGGTGGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167071705 19:47226066-47226088 CCGTGCCAGGGGCTGGGGGGCGG + Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167650804 19:50727648-50727670 CCCCGCAAGGGGCTGGGGGAAGG - Intergenic
1167978743 19:53254908-53254930 CGGCGCAAGGGGCAAGGGCAGGG + Intergenic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
1168688755 19:58364145-58364167 CACTGCCAGGGCCAGAGGGATGG - Intergenic
925041964 2:739513-739535 CTGTGCAGGAGGCAGGGGAATGG + Intergenic
925069519 2:955955-955977 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069542 2:956033-956055 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069548 2:956045-956067 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925340709 2:3133579-3133601 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925730838 2:6918300-6918322 CAGTGCAGGGGGCTTGGGGTCGG - Intronic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925947555 2:8879810-8879832 CAGTGACAGGGGCAGGGAGAGGG + Intronic
925970118 2:9100594-9100616 AAGTTCCAGGGGCAGGGTGATGG + Intergenic
926037414 2:9646400-9646422 GAGAGCAAGGGGCAGGGCGAGGG - Intergenic
926305805 2:11636765-11636787 CAGGGGCAGGGGCAGGGGCACGG + Intronic
926329399 2:11812366-11812388 CAGTGCTAGGAGGAGAGGGAAGG + Intronic
926349645 2:11983382-11983404 CAGTGCTAGAGGCAGTGGGATGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927064858 2:19461067-19461089 CAGTTGCAGGGGGAGGGGGATGG - Intergenic
927152930 2:20205963-20205985 CGGCACAAGGGGCAGGGGCAGGG + Intronic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927576836 2:24207654-24207676 CAGTGCAGGGAGCTGGGGCAGGG + Intronic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928565798 2:32547370-32547392 AATTGCCAGGGGCTGGGGGAAGG - Intronic
928858382 2:35827578-35827600 CAAGGTAAGGGGCAGGGGCAGGG - Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929564646 2:42976753-42976775 GAGTCCTAGGGGCAGAGGGAAGG + Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
929830761 2:45344583-45344605 CAGAGCAAGGGGTTGGGAGAGGG - Intergenic
929868799 2:45740540-45740562 GCTTGCAATGGGCAGGGGGAAGG - Intronic
929906105 2:46048110-46048132 CTATGGAAGGGGCAGGGGGTGGG - Intronic
930200912 2:48551440-48551462 CAAGGCCAGGGGCAGGGGCAGGG - Intronic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931240798 2:60450637-60450659 CAGAGCATGGGGCAGGGAGAGGG + Intergenic
931540891 2:63327897-63327919 CAGTGGAAGGGCCAGCGGGTTGG - Intronic
931582885 2:63796497-63796519 CACTGCCAGGGGATGGGGGAGGG - Intronic
931586246 2:63832483-63832505 AAGAGCAAGGGGCACAGGGATGG + Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
932406159 2:71513653-71513675 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932494114 2:72138163-72138185 CTGGGCAAGAGGCAGGGGCATGG - Intronic
932517436 2:72367675-72367697 CACTGCCAGGGGATGGGGGAGGG - Intronic
932544067 2:72688534-72688556 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932544070 2:72688540-72688562 CAGGGGCAGGGGCAGGGGGCAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932671100 2:73738518-73738540 AATTGCAGGGGGCAGGGGCAGGG + Intergenic
933121407 2:78542285-78542307 CAGTGGAGGTGGCAGGGGAATGG - Intergenic
934951476 2:98578629-98578651 GTGTGCTAGGGGCAGGCGGATGG - Intronic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936607991 2:113976713-113976735 AAGTGCATGGTGCAGGAGGAAGG - Intergenic
937034363 2:118768776-118768798 CAGTGCATGGGTCAGGGGTGTGG - Intergenic
937050497 2:118884307-118884329 CAGTGTAAGGGCCAGCGGGTCGG + Intergenic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937914451 2:127092131-127092153 CAGGGCCTGGGGCAGGGGCAGGG - Intronic
938153251 2:128904211-128904233 CAGTGGAAGGGCCAGCGGGTCGG + Intergenic
938900726 2:135796763-135796785 CCGAGCCAGGGCCAGGGGGAGGG - Intronic
939205559 2:139098146-139098168 CAGTGTTAGGGACAGGGAGATGG + Intergenic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
940267468 2:151854226-151854248 CAGTGTCATGGGCAGTGGGAAGG + Intronic
940389423 2:153114344-153114366 CAGTGCAAGAGCCAGGGTCAGGG - Intergenic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941822527 2:169856817-169856839 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
942229234 2:173844416-173844438 CAGGGCAAGGGGCTGGGGCTGGG - Intergenic
943406979 2:187501296-187501318 CAGGACATGGGGCGGGGGGAGGG - Intronic
943759618 2:191593647-191593669 CACTGCTAGGGACAGGGGAATGG - Intergenic
943863643 2:192899441-192899463 TAGTGCAAGGTACAGGGGAAGGG + Intergenic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
944897853 2:204183842-204183864 CAGTGCAAAGGGGAGAGGCATGG + Intergenic
945147415 2:206752933-206752955 CATGGCCAGGGGCAGGGGGTGGG - Intronic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
946028299 2:216685747-216685769 CAGTGGTTGTGGCAGGGGGAAGG + Intronic
946192533 2:218015166-218015188 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
946353269 2:219169279-219169301 CAGAGCAAGGGCAAGGGGTAAGG - Exonic
946456824 2:219833167-219833189 CAGAGCAAGGGGCAGGGTTTAGG - Intergenic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
947455458 2:230250023-230250045 CATTGCAAGGGGCAGGGTCCTGG - Intronic
947497898 2:230651990-230652012 TGGTGCCAGGGGCTGGGGGAGGG - Intergenic
947498978 2:230658721-230658743 CAGGGCCAGAGGCAGGCGGATGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948100895 2:235371828-235371850 CAGTGCTAGGGACAGAGAGATGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948283981 2:236769797-236769819 CAGGGCAATGGGCAGGGGTGAGG + Intergenic
948675602 2:239594815-239594837 AACTGCAAAGGGCAAGGGGAGGG + Intergenic
948718248 2:239880271-239880293 CAGTGCATGGGGTGGGGGGGTGG - Intergenic
948887700 2:240892353-240892375 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
948889626 2:240900736-240900758 GAGAGCCAGGGGCTGGGGGAGGG - Intergenic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
948946655 2:241223972-241223994 GAGTGCACGGGGCAGGGGCCTGG - Intronic
949010372 2:241674916-241674938 CATTGCCAGGGGCTGTGGGATGG - Intergenic
949069557 2:242015931-242015953 GAGGGCAGGGGGCAGAGGGAAGG + Intergenic
1168827121 20:821552-821574 CAAGGCCAGTGGCAGGGGGAAGG + Intergenic
1169117439 20:3074903-3074925 CAGTGACATGGGCAGGGGGATGG - Intergenic
1169186693 20:3623518-3623540 CAGTGCAAGGGGTTGGGGTTTGG + Intronic
1169411541 20:5374631-5374653 GAGGTCTAGGGGCAGGGGGAAGG + Intergenic
1170450588 20:16479359-16479381 CGGCGGATGGGGCAGGGGGAGGG + Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171347879 20:24479515-24479537 CAGAGGAAGGGGCATGGGAAGGG - Intronic
1171438404 20:25141515-25141537 CACTCCAGGGGGCAGGGGGCAGG + Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171779804 20:29408717-29408739 AAGAGCAAGGGACAGAGGGATGG - Intergenic
1171823787 20:29876999-29877021 GAGAGCAAGGGACAGAGGGATGG - Intergenic
1171896301 20:30813338-30813360 GAGAGCAAGGGACAGAGGGATGG + Intergenic
1172116411 20:32575955-32575977 CAGTGCAAGGGGCCTGGGGCAGG + Intronic
1172180876 20:33002754-33002776 CCCAGCAAGGGGCAGGGGCAGGG - Intronic
1172226186 20:33306718-33306740 CAGTGCCAGAGGCAAAGGGAGGG + Intronic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172379434 20:34475697-34475719 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172379437 20:34475703-34475725 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1172975154 20:38900555-38900577 CAGAGAAAGAGGCAGGGTGAGGG - Intronic
1173007370 20:39150657-39150679 CAGTACAGGGGGCAGGCAGAGGG + Intergenic
1173558467 20:43984822-43984844 AAGTGCAGGGGCCTGGGGGAGGG + Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173736211 20:45363413-45363435 CATTCCAAGAGTCAGGGGGAAGG - Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1174167024 20:48592357-48592379 CAGACCAGGGGGCAGGGGTAGGG + Intergenic
1174881588 20:54285108-54285130 CAGTCTCAGGGACAGGGGGAAGG - Intergenic
1174897825 20:54469477-54469499 GAGTTCAAGGGGCTGTGGGAAGG - Intergenic
1174918955 20:54682010-54682032 AAGTTCAGGGGGCAGGGGAAAGG + Intergenic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1175110094 20:56641780-56641802 CAGGGCAAGGGGAAAAGGGAGGG - Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175268139 20:57714898-57714920 CAGTGGGACGGCCAGGGGGACGG - Intergenic
1175268151 20:57714934-57714956 CAGTGGGACGGCCAGGGGGACGG - Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175516915 20:59575896-59575918 CAGTGCAGGGGGCCTGCGGAAGG + Intergenic
1175523501 20:59618148-59618170 CAGTGCAAAGGCCAGGTGGTGGG + Intronic
1175541709 20:59751895-59751917 CAGGGCAAGGGGGCTGGGGAAGG - Intronic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1175744864 20:61449109-61449131 CAGTGCCAGGGGCTGGGTGAGGG + Intronic
1175818882 20:61897809-61897831 CAGATCACGGGGCAGGGGAACGG + Intronic
1175819547 20:61901228-61901250 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175819550 20:61901234-61901256 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175888377 20:62304857-62304879 CACGGCAAGGGGCAGAGAGAGGG - Intronic
1175942670 20:62545140-62545162 CACTGCAAGGAGCAGGGTGTTGG - Intergenic
1175969493 20:62677119-62677141 TGGTGCCAGGGGCTGGGGGAAGG + Intronic
1176379212 21:6103397-6103419 CAGCGGCAGGGGCAGGGGCAGGG + Intergenic
1176379215 21:6103403-6103425 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1178109433 21:29355598-29355620 CAGTGAAAGGGCCAGCGGGTCGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179417666 21:41211172-41211194 CAGTGAAGGGGGGAGAGGGATGG - Intronic
1179455623 21:41497834-41497856 CAGGGCAGGGGGCAGGGACAAGG - Intronic
1179477001 21:41653362-41653384 TGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1179505527 21:41837518-41837540 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179744258 21:43434834-43434856 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1179744261 21:43434840-43434862 CAGCGGCAGGGGCAGGGGCAGGG - Intergenic
1179788604 21:43743206-43743228 CAGTGCTGGGGGCGGGGGGAGGG - Intronic
1179962287 21:44775011-44775033 CAGTGCAAAGGACAGGTGGGAGG - Intronic
1179990234 21:44944429-44944451 CAGTAGGAGGTGCAGGGGGACGG - Intronic
1180002552 21:45001936-45001958 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1180005998 21:45021012-45021034 CAGGGCAAGGGCCAGGGCCAGGG + Intergenic
1180042332 21:45287199-45287221 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1180060679 21:45383446-45383468 CACCGCAGGGGCCAGGGGGAGGG - Intergenic
1180147113 21:45927887-45927909 CAGGGAATGGGGCACGGGGAGGG - Intronic
1180638441 22:17279109-17279131 CAGTGCAAAGAGCAAGGGAAGGG - Intergenic
1180800094 22:18627687-18627709 GTGCACAAGGGGCAGGGGGAGGG - Intergenic
1181221621 22:21367579-21367601 GTGCACAAGGGGCAGGGGGAGGG + Intergenic
1181355221 22:22292898-22292920 CAGGGCCAGGGGCAGGGCCAGGG + Intergenic
1181355226 22:22292910-22292932 CAGGGCCAGGGGCAGGGCCACGG + Intergenic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181471434 22:23142681-23142703 AAGAGCAAGGGGCATGGGCAGGG - Intronic
1181479116 22:23186554-23186576 CAGTGCCAGGGGCTGGGGGCAGG - Intronic
1181530220 22:23513106-23513128 GAGAGCAAGTGGCAGGGGGTGGG - Intergenic
1181542732 22:23582405-23582427 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1181635075 22:24170755-24170777 CAGTGCATGGGGGCGGGGGGGGG - Intronic
1181891478 22:26067356-26067378 AAGTGCAAGGGGCTGTGGCAGGG - Intergenic
1181919073 22:26305837-26305859 CTGGGCAAGGGGCAGGGGTGGGG + Intronic
1182352516 22:29706786-29706808 CAGTCCAAGAGGCAGGGGCCAGG + Intergenic
1182355669 22:29721286-29721308 CAGAGCAGAGGGCAGGGGCAGGG + Intronic
1182564182 22:31184922-31184944 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
1182816329 22:33167442-33167464 TAGAGCAAGGGGCAAGGGTATGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183143357 22:35965953-35965975 CATGGCAGGGGGCGGGGGGATGG - Intronic
1183469574 22:37998349-37998371 CCCTTCAAGGGGCAGGTGGAAGG - Intronic
1183480583 22:38062595-38062617 AAGGGGCAGGGGCAGGGGGAGGG - Intronic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1184045547 22:41970396-41970418 CTGTGCAAGGGGCAGAGCTAGGG - Intergenic
1184254700 22:43280437-43280459 GAGGGGAAGGGACAGGGGGATGG - Intronic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184392052 22:44208373-44208395 CAGGGCCAGGGGCTGGGAGAAGG - Exonic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184523616 22:45009302-45009324 CAGCGCCAGGGGCAGGCGGAGGG + Intronic
1184751049 22:46487008-46487030 AAGTGGAGGGGGCAGGGGGCGGG - Intronic
1184911385 22:47536912-47536934 GAGTGCCAGGGCCTGGGGGAAGG - Intergenic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185143543 22:49117170-49117192 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143546 22:49117176-49117198 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143549 22:49117182-49117204 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143557 22:49117200-49117222 CAGGGCCAGGGGTAGGGGCAGGG + Intergenic
1185288119 22:50011295-50011317 CAAGGAAAGGGGCAGGGGCAAGG - Intronic
1185297562 22:50061906-50061928 CAGGGCAAGGGGCCGAGTGAAGG - Intronic
1185366151 22:50437822-50437844 CACTGCAAGAGCAAGGGGGATGG - Exonic
1185417451 22:50718041-50718063 CAGGGCATGGGGCAGGGGCCTGG - Intergenic
949805624 3:7952712-7952734 AATTGCCTGGGGCAGGGGGATGG - Intergenic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950477284 3:13222145-13222167 AGGTGCCAGGGGCTGGGGGAGGG - Intergenic
950522522 3:13505417-13505439 CAGTGCAAGGGGCAGGTTTTGGG + Exonic
950527152 3:13531107-13531129 GGGTGCCAGGGGCAGGGGAAGGG + Intergenic
950609754 3:14118486-14118508 CAGTTCAGGGGACAGAGGGAGGG + Intronic
950655666 3:14434794-14434816 CCGTGCCAGTTGCAGGGGGAGGG - Intronic
951059980 3:18194681-18194703 CATTGTAGGGGCCAGGGGGAGGG - Intronic
952331336 3:32367032-32367054 CAGAGGAAGGGGTAGGGGAAAGG - Intronic
952668082 3:35932007-35932029 CTATGCATGGGGCAGGGGGTGGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954225295 3:49177287-49177309 CAGAGCAGGTGGCAGGGTGAAGG - Intergenic
954369606 3:50163312-50163334 CAGTGGAAGGGCCAGAGTGATGG - Intronic
954380645 3:50217285-50217307 CAGTGCCAGGGGCAGAATGATGG - Exonic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
954584362 3:51720817-51720839 CAATGCAAGGGACAGGGGAAAGG - Intergenic
954688943 3:52385634-52385656 CACTGCACTGGGCAGGGGGTCGG + Intronic
954712522 3:52512226-52512248 CAGAGCAAGGGGCAGGGGCTGGG + Intronic
955698380 3:61659043-61659065 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
955819082 3:62876243-62876265 AAGTGAAAGGAGCACGGGGAAGG - Intergenic
956842497 3:73153558-73153580 CAGTGAAAGGGCCAGTGGGTCGG + Intergenic
957085311 3:75671787-75671809 AAGAGCAAGGGACAGAGGGATGG + Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
958601656 3:96302380-96302402 CAGTGAAAGGGCCAGTGGGTTGG - Intergenic
958864955 3:99489335-99489357 CAGGGCAGGTGGGAGGGGGAAGG - Intergenic
958898842 3:99861684-99861706 CAGTGCAGGTGGCAGAGGGCAGG + Intronic
958912862 3:100013974-100013996 AGGAGCAAGGGGCAGTGGGAAGG - Intronic
959808870 3:110592698-110592720 CAGAGCAAAGGGCCGGGGGATGG - Intergenic
959992363 3:112643479-112643501 TAGTGCTAGGGGTTGGGGGAGGG + Intronic
960195277 3:114759298-114759320 CAGTGGAAAGGGGATGGGGAGGG + Intronic
961001900 3:123379573-123379595 AAGTGCAGGGAGCAGTGGGAAGG + Intronic
961344700 3:126256476-126256498 CAGTGCCACGGGTAGGGGGAGGG + Intergenic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961454424 3:127017115-127017137 CAGGGGTAGGGGCAGGGGCAGGG - Intronic
961484317 3:127206716-127206738 CAGGGCCAGGGACAGGGGTAGGG + Intergenic
961484339 3:127206770-127206792 CAGGGCCAGGGCCAGGGGCAGGG + Intergenic
961484343 3:127206776-127206798 CAGGGCCAGGGGCAGGGGCAGGG + Intergenic
961567514 3:127774204-127774226 CAGTGCAAAGGCCCGGGGGCAGG - Intronic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
962268714 3:133962475-133962497 GAGTTCAAGGGGCAGGAAGAAGG + Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
963001770 3:140688195-140688217 GAGTGCACGGGGTAGGGGGAGGG - Exonic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963938866 3:151081433-151081455 AAGTGGGAGGGGGAGGGGGAAGG - Intergenic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964181137 3:153887789-153887811 GATTGCCAGGGGCTGGGGGAAGG + Intergenic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
964734362 3:159901137-159901159 TAGGCCAAGGGGCAGGGGGCTGG - Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967178851 3:186885581-186885603 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967178854 3:186885587-186885609 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967970365 3:194994797-194994819 GAGAGCAAGGGACAGTGGGATGG - Intergenic
968085772 3:195873269-195873291 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968298640 3:197596522-197596544 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968382936 4:110601-110623 CAGAGCAAAGGGCAAGGGGGAGG + Intergenic
968475671 4:805932-805954 GGGTGCGAGGGGCTGGGGGAAGG + Intronic
968844032 4:3029816-3029838 CAGTGGCAGGAGCATGGGGAAGG - Intronic
969110194 4:4839680-4839702 CAGGGCCAGGGCCAGGGGAAAGG - Intergenic
969283802 4:6190002-6190024 CAGGCCCAGGGGCAGGGGAATGG - Intronic
969300735 4:6295470-6295492 CAGTGTAGGGGGCAGTGGGGCGG + Intronic
969348882 4:6586629-6586651 GGGTGCTAGGGGCTGGGGGAGGG + Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969451121 4:7273985-7274007 CAGTGCACGAGGCAGAGGGAGGG - Intronic
969457455 4:7308293-7308315 CAGCAGAAGGGGCAGGGGGTTGG - Intronic
969660067 4:8522237-8522259 CAGGGCAAGGAGCAGGGCAAGGG - Intergenic
969692809 4:8713829-8713851 CAGGGAATGGGGTAGGGGGAGGG + Intergenic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
970645600 4:18117004-18117026 CAGCTTAAAGGGCAGGGGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972651412 4:41021194-41021216 CAGTGAAAGGGCCAGCGGGTCGG - Intronic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
974537810 4:63192295-63192317 CAGTGAAAGGGCCAGTGGGCTGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
975495274 4:75029730-75029752 CAGTGAGAAGGGCAGGGGGCTGG + Intronic
975592915 4:76017916-76017938 CACTGCCAGGGGAAGGGAGAGGG + Intronic
976691024 4:87867353-87867375 GAGTGCAAGAGGAAGGGGAAAGG - Intergenic
976844003 4:89465715-89465737 GATTGCAAGGAGCTGGGGGAGGG + Intergenic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977640735 4:99355540-99355562 CAGTGAAAGGGCCAGTGGGTTGG - Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
978264717 4:106810151-106810173 CAGGGCAAGGGGCTGGTGAAAGG - Intergenic
978407691 4:108397132-108397154 CAGAGAAAGGGGTGGGGGGAGGG + Intergenic
978438066 4:108707161-108707183 GGGGGAAAGGGGCAGGGGGAGGG + Intergenic
978833023 4:113112502-113112524 CACTGCAGTGGGCAGAGGGAAGG - Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981114198 4:140970795-140970817 CAGTGCAAATGGCAGTGGGGAGG + Intronic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
983570802 4:169206376-169206398 CCATTCAAGGGGCTGGGGGAAGG + Intronic
984701043 4:182819082-182819104 CAGTGCCAGTGCCAGGGAGAAGG + Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984939041 4:184915621-184915643 CAGTGAAAGGGCCAGCGGGTTGG + Intergenic
984992717 4:185396651-185396673 CGGCGCCGGGGGCAGGGGGAGGG - Exonic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985658906 5:1146020-1146042 GACTGCCAGGGGCTGGGGGAGGG - Intergenic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
986362395 5:6993107-6993129 GAGGGCAAGGGGAAGGGGAAGGG - Intergenic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
989663631 5:43825349-43825371 CCGTGCAAAGGGTAGGGGGAGGG + Intergenic
990117152 5:52403134-52403156 CAGTGAAAGGGCCAGGGGGTTGG - Intergenic
990226087 5:53656047-53656069 CAGTGCAAGGAGCCTGGAGACGG - Intronic
990582085 5:57174533-57174555 GTGTGCAAGAGGCCGGGGGAAGG - Intronic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
991253221 5:64586437-64586459 AAGTGAAAGGGACAGGGGTAGGG - Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992094674 5:73351806-73351828 AGTTGCAAGGGGCTGGGGGAAGG + Intergenic
992157688 5:73971096-73971118 CTCTGCAAGGGGCAGGGGGTGGG + Intergenic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992182943 5:74215580-74215602 CAGTGGAAGGGGCAGAGGAAAGG + Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993148291 5:84125659-84125681 CCGTACTTGGGGCAGGGGGAGGG - Intronic
993272761 5:85816217-85816239 CATAGAAAGGGGCAGGGGAATGG + Intergenic
994352341 5:98761043-98761065 GGATGCCAGGGGCAGGGGGAGGG - Intergenic
995190241 5:109311858-109311880 TAGGGCAAGGGGCAAGGGGAGGG + Intergenic
995697922 5:114900442-114900464 CACTGCCAGGGGAAGGGAGAGGG + Intergenic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
996942329 5:129023075-129023097 CAGTGAAAGGCTCAGGGGAAAGG + Intronic
997074089 5:130651628-130651650 CAGCTCCAGGGGCAGAGGGAAGG + Intergenic
997633912 5:135390521-135390543 CAGTGCAGGGTGCTGGGAGAGGG + Intronic
998059749 5:139110725-139110747 CAGTGCACAGGGCAGGGTGGGGG - Intronic
998112219 5:139511111-139511133 CAGTGAAAGGGCCAGTGGGTAGG - Intergenic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998905544 5:146900786-146900808 CAGTGCATGGGGATGGGGCACGG - Intronic
999079970 5:148834028-148834050 ACTAGCAAGGGGCAGGGGGAGGG - Intergenic
999127912 5:149259917-149259939 CACTGAATGGGGGAGGGGGAGGG + Exonic
999204463 5:149837973-149837995 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
999265931 5:150266924-150266946 TAGTGAAGGGGGCAGGGGAAAGG - Intronic
999288189 5:150406802-150406824 CAGTGCCAAGGGGAGGGGCAGGG - Intronic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
999450084 5:151671541-151671563 GAGAGACAGGGGCAGGGGGAAGG - Intronic
999500087 5:152138192-152138214 GAGTGGAAGGGGCAGGGCAAAGG - Intergenic
999621874 5:153482028-153482050 GATTGCAAGGGTCAGGGGAAAGG + Intergenic
999704843 5:154262751-154262773 CAGTGCAATGGGCAAGAGAAGGG + Intronic
1000123066 5:158216432-158216454 CAGGGAGAGGGGCAAGGGGAGGG - Intergenic
1001214750 5:169845284-169845306 CAGGGCAAGGGACAGAGGCAGGG - Intronic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1001959264 5:175870642-175870664 GAGTGCAAGGGGAAGAGGAAAGG + Intronic
1001980755 5:176035724-176035746 CACTGCCAGAGGCAGGGGGCAGG - Intergenic
1002000682 5:176194860-176194882 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002176279 5:177403223-177403245 AACTGCTAGGGGCAGGGGTAGGG - Intronic
1002236705 5:177808341-177808363 CACTGCCAGAGGCAGGGGGCAGG + Intergenic
1002260504 5:177990857-177990879 CAGGGCAAGGGGTAGGGACAAGG - Intergenic
1002328781 5:178427785-178427807 CGTTGCCAGGGGCTGGGGGAGGG + Intronic
1002493893 5:179599071-179599093 GTGTGCAAGGGGCCTGGGGAGGG + Intronic
1002571424 5:180141541-180141563 GAGTGCCAGGGGCTGGGGGTGGG + Intronic
1002845212 6:939282-939304 CTTGGCAAGGGGCATGGGGAGGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003248231 6:4402081-4402103 CAGTGCTGAGGCCAGGGGGAAGG - Intergenic
1003468837 6:6409547-6409569 CAGTGCAAAGGGGAGGGGCCAGG - Intergenic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003570663 6:7254314-7254336 GAGGGCATGGGGCATGGGGATGG + Intergenic
1003650725 6:7957843-7957865 CATTTCCAGGGGCTGGGGGAGGG + Intronic
1003806102 6:9727429-9727451 CAGTGAAAGGGCCAGGAGGTCGG - Intronic
1004169240 6:13283272-13283294 GAGGGGCAGGGGCAGGGGGAGGG - Intronic
1005710703 6:28501544-28501566 CCGTGCAAAAGGGAGGGGGAGGG - Intergenic
1005900920 6:30215462-30215484 CCATGCAAGGGGCTGGGGCAGGG - Intergenic
1005924251 6:30428889-30428911 GAGGGCATGGGGCTGGGGGAGGG + Intergenic
1006068027 6:31476609-31476631 CAGTGCAGGGGGCAGGATGGAGG - Intergenic
1006222154 6:32500431-32500453 CAGTGAAAGGGCCAGTGGGTTGG - Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006373651 6:33659898-33659920 CAGGGCAAGGGGCGGGGGCCTGG - Intronic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006567608 6:34973841-34973863 GAGGGCAAGGGGAAGGGGAAGGG - Intronic
1006706466 6:36025104-36025126 CAGTGCTAGGGACAGGGATAGGG - Intergenic
1006723692 6:36179821-36179843 AACTACAGGGGGCAGGGGGAGGG + Intergenic
1006868085 6:37225271-37225293 AAGTGCAAGGGGCAGGGATAGGG + Intronic
1007072732 6:39048854-39048876 CAGCGCAAGGCGCAGCGGGCCGG - Exonic
1007077725 6:39078533-39078555 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077728 6:39078539-39078561 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007114859 6:39336256-39336278 GAGTGCTAGGGGCAGGGTGAAGG - Exonic
1007244448 6:40450457-40450479 CATTGCAAGGGAGAGAGGGAGGG + Intronic
1007431151 6:41778058-41778080 CCGTGGGAGGGGCATGGGGAAGG + Exonic
1007729886 6:43939433-43939455 TGGGGCAAGGGGCAGGGGGTGGG - Intergenic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1007816340 6:44528088-44528110 CAGGGCTAAGGGCTGGGGGAAGG - Intergenic
1008377780 6:50810769-50810791 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377783 6:50810775-50810797 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377786 6:50810781-50810803 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008761629 6:54859057-54859079 CAGTGCTGGGGGCTGGGGGGTGG - Intronic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1010075383 6:71791641-71791663 CAGTGAAAGGGACAGTGGGTTGG - Intergenic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1012660763 6:101887714-101887736 CAGAGCATGGGAGAGGGGGAAGG + Intronic
1012958758 6:105599624-105599646 CAGTGAAAGGGAAAGGGGAAAGG + Intergenic
1013157990 6:107511948-107511970 CACTGCATGGGGGCGGGGGAGGG - Intronic
1013204372 6:107933674-107933696 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013204375 6:107933680-107933702 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013294566 6:108747299-108747321 CAGGACCTGGGGCAGGGGGATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013799979 6:113931578-113931600 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1014256025 6:119160533-119160555 CTCTGCAAGGGGCTGGGAGAAGG - Intergenic
1014340134 6:120194618-120194640 TAGTCCAAGGGGGAGGCGGAGGG - Intergenic
1014743698 6:125174829-125174851 GAGTGCAAAGTGCATGGGGAAGG + Intronic
1015366837 6:132405056-132405078 GACTGCAAGGGGTTGGGGGAAGG + Intergenic
1015744183 6:136492088-136492110 CTGGGCCAGGGGCAGGGGGTGGG + Intronic
1016541360 6:145169908-145169930 CATTGCCAGGGGGTGGGGGAGGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1016929646 6:149391546-149391568 CAGGGACAGGGGCAGGGGCAGGG + Intronic
1017101833 6:150855746-150855768 CAGTGGAAGGGCCAGCGGGTCGG - Intergenic
1017409853 6:154156527-154156549 CAGAGCATGGGGCAGCGGGAGGG + Intronic
1017754882 6:157521061-157521083 AAGTGCAAGGGATTGGGGGAGGG + Intronic
1018177536 6:161190112-161190134 AAGTGCCAGGGTCAGGGGAAGGG + Intronic
1018890613 6:167978792-167978814 CAACTCAAAGGGCAGGGGGAGGG + Intergenic
1018906229 6:168077826-168077848 CAGTGCCTCGGGCTGGGGGAGGG - Intronic
1019061326 6:169260141-169260163 CAGGGCAGGGGATAGGGGGAGGG - Intergenic
1019110019 6:169702221-169702243 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019299568 7:296409-296431 GAGTTCAAGGGTCGGGGGGAAGG - Intergenic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019506344 7:1393376-1393398 CAGGGCCAGGGCCAGGCGGAGGG + Intergenic
1019554036 7:1619788-1619810 CTGTGCTGGGGGCAGGGAGATGG + Intergenic
1019587274 7:1812482-1812504 CGGTGCCAGGTGCAGTGGGAGGG + Intergenic
1019651383 7:2161117-2161139 CCGTGCAAAGGGGAGAGGGAGGG - Intronic
1019786388 7:2980135-2980157 CAGTGCCAGGGGCCGGGGAGTGG - Intronic
1019817438 7:3211457-3211479 TATTACAAGGGGGAGGGGGATGG + Intergenic
1020004018 7:4772163-4772185 GTGTGCCAGGGGCAGGGGGTTGG - Intronic
1020667727 7:11068784-11068806 CAGGGAAAGGGGCTGGGGCAGGG + Intronic
1021356633 7:19658853-19658875 CCCTTCAAGGGGTAGGGGGAGGG - Intergenic
1021440033 7:20667673-20667695 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440036 7:20667679-20667701 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440039 7:20667685-20667707 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440042 7:20667691-20667713 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440045 7:20667697-20667719 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440048 7:20667703-20667725 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440051 7:20667709-20667731 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021540088 7:21748065-21748087 CAGTTCAAGGGTTAGGGTGAAGG + Intronic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1022593300 7:31687113-31687135 CAGGGCAAGGGGGATGGAGAAGG - Exonic
1022597061 7:31722771-31722793 GAGTGCAGGAAGCAGGGGGATGG + Intergenic
1022655922 7:32319306-32319328 CAAGTCAAGGGGCAGGGGCAGGG - Intergenic
1022782548 7:33601027-33601049 TAGGAAAAGGGGCAGGGGGAGGG + Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023021023 7:36011820-36011842 CACTGCATGGTGCAGGGGAAGGG - Intergenic
1023077665 7:36499828-36499850 CAGTGAAAGGGCCAGTGGGTTGG + Intergenic
1023156440 7:37256709-37256731 AAGGGAGAGGGGCAGGGGGAAGG + Intronic
1023640791 7:42254985-42255007 AAGTGGAAGGGGCAGTGGGCAGG - Intergenic
1023870443 7:44260487-44260509 CAGTGCAAGTGGCAGGGGCTGGG - Intronic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1024261735 7:47578539-47578561 AGGTGCATGGGGCAGGGGGTTGG + Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024568187 7:50701729-50701751 AAGTGCAGGATGCAGGGGGAAGG - Intronic
1024576755 7:50770665-50770687 GATTGCAGGTGGCAGGGGGATGG + Intronic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1025871768 7:65440960-65440982 CAGTGCAGGGGGCAGGTGTCTGG - Intergenic
1026102720 7:67396199-67396221 CAGTTCAGGGGCCTGGGGGAAGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027668688 7:81071021-81071043 CAGTGCAAGCGGCGGGCTGAAGG - Intergenic
1028427985 7:90712307-90712329 GATTACCAGGGGCAGGGGGAAGG - Intronic
1028494368 7:91447638-91447660 CAGTGAAAGGGCCAGTGGGTCGG + Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029153994 7:98502041-98502063 CAGTGCATTTGGAAGGGGGATGG + Intergenic
1029347173 7:99987117-99987139 CAGGGCAGGGGGCAGTGGGGCGG + Intergenic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029481226 7:100814124-100814146 CAGTACAGGGGACAGGTGGAGGG + Intronic
1029515317 7:101019923-101019945 CAGGCCAAAGGGCAGAGGGAGGG - Intergenic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029569535 7:101360466-101360488 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569538 7:101360472-101360494 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569541 7:101360478-101360500 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569544 7:101360484-101360506 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029611155 7:101627327-101627349 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1029611158 7:101627333-101627355 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1030085127 7:105809426-105809448 GAGTGCCAGGGGCCGGAGGAAGG - Intronic
1030818391 7:114065264-114065286 CACTGCAAGTAACAGGGGGATGG - Intronic
1031179058 7:118392051-118392073 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179061 7:118392057-118392079 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179064 7:118392063-118392085 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179067 7:118392069-118392091 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179070 7:118392075-118392097 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179072 7:118392081-118392103 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1031759149 7:125689210-125689232 CAGGGCGGGTGGCAGGGGGAGGG - Intergenic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1031922853 7:127614170-127614192 CTATGCATGGGGCAGAGGGAGGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032129313 7:129215728-129215750 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1032779003 7:135147297-135147319 AAGAACTAGGGGCAGGGGGAGGG + Intronic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033565526 7:142574905-142574927 CAGAGGCAGAGGCAGGGGGAGGG - Intergenic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034204294 7:149302364-149302386 CAGTGCAGGGAGCCAGGGGAAGG - Intergenic
1034397999 7:150842028-150842050 CACTGCCAGGGGATGGGGGAAGG - Intronic
1034411589 7:150945171-150945193 CAGTGAGAGGGGCAGGGGCAGGG - Exonic
1034422712 7:150997810-150997832 CAGTGACAGGGGCAGGGGAGTGG - Intronic
1034430135 7:151037107-151037129 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1034875937 7:154724750-154724772 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1034988897 7:155535078-155535100 CATTGCAAAGGGCACGGAGAAGG + Intergenic
1035271454 7:157722387-157722409 CAGGGCCAGGGGCAGGGCGGGGG + Intronic
1035377670 7:158416147-158416169 CAGTGCATGGGGCCCAGGGAAGG - Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035739347 8:1914417-1914439 CAGTGCATCGGGCAGGGGCCAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036765728 8:11548231-11548253 CAGGGCTGGGGGCAGGGCGATGG - Intronic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1037710124 8:21348680-21348702 CAATGGCAGGGGCAGGGGCAGGG + Intergenic
1038417158 8:27405379-27405401 CAGTGCAAGAGGTAGGGAGGAGG + Intronic
1038429760 8:27491006-27491028 CCGGGAAAGAGGCAGGGGGAGGG - Exonic
1038542693 8:28402416-28402438 CAGGGGAAGGGGCGGGGCGAGGG + Intronic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039742687 8:40396772-40396794 GAGTGGAAGGGGTAGGGAGAGGG + Intergenic
1039757783 8:40541813-40541835 AAGTGCAGGGAGCAGGGGAAGGG + Intronic
1039820145 8:41127679-41127701 CAGGGCAAGGTGTAGGGGAAGGG - Intergenic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1041315733 8:56560226-56560248 CAGTGCTGGGGCCAGAGGGAAGG + Intergenic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042498440 8:69482589-69482611 GAGAGAGAGGGGCAGGGGGAGGG + Intronic
1043868840 8:85406703-85406725 CAGTGCAAGGGGGTAGTGGAGGG + Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044944156 8:97375307-97375329 CAGTGCAAGGGGGAGGACCAAGG + Intergenic
1045016765 8:98007318-98007340 CAGAGCAAGGGGCAGGGGAGGGG - Intronic
1045132972 8:99178298-99178320 CATTTCAAGGGGAGGGGGGAGGG - Intronic
1045238902 8:100380440-100380462 AAGTGTAAGGGCCAGGGGTAGGG - Intronic
1045602480 8:103733367-103733389 CATTGCCTGGGGCTGGGGGAAGG + Intronic
1045724889 8:105160765-105160787 CAGTGGCGGGGGCAAGGGGAAGG - Intronic
1045977542 8:108146751-108146773 GAGTGCAAGGGGTAAGAGGAAGG - Intergenic
1046077482 8:109330885-109330907 CAGAGAATGGGGTAGGGGGAGGG + Intronic
1046323708 8:112612926-112612948 GAGTGCAGCGGGGAGGGGGATGG + Intronic
1046778859 8:118193798-118193820 CAGTGGAGGGGGCTGTGGGAGGG + Intronic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048556299 8:135480430-135480452 AAATGCAAAGGGGAGGGGGAAGG - Intronic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1049222449 8:141434234-141434256 CAGAACAAGGGGCTGGGGAATGG - Intergenic
1049222774 8:141435449-141435471 CCGTGGAAGGGGCAGGGCCAGGG - Intergenic
1049240467 8:141535218-141535240 CAGCACGAGGGGGAGGGGGAAGG + Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049359622 8:142206110-142206132 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049538568 8:143194585-143194607 CAGTGCAGGGGCCAGGGGAGAGG + Intergenic
1049605154 8:143525929-143525951 CAGTGCCAGGCCCAGGCGGACGG - Intronic
1049668394 8:143858987-143859009 CAGCGAGAGGGCCAGGGGGAGGG - Exonic
1049668813 8:143860595-143860617 CAGCGAGAGGGCCAGGGGGAGGG - Exonic
1049669228 8:143862197-143862219 CAGCGAGAGGGCCAGGGGGAGGG - Exonic
1049669640 8:143863790-143863812 CAGCGAGAGGGCCAGGGGGAGGG - Exonic
1049670055 8:143865398-143865420 CAGCGAGAGGGCCAGGGGGAGGG - Exonic
1049797535 8:144503539-144503561 CACTGCGAGGGGCTGGGGGAGGG - Intronic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1050107946 9:2185186-2185208 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1050517621 9:6461387-6461409 CAGAACAAGGGGCGGGGGGGAGG - Intronic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051184912 9:14450110-14450132 GAGTGTAGGGGGCTGGGGGAGGG - Intergenic
1051222899 9:14869066-14869088 TAGTCCAAGGGGCAGGGTGAGGG + Exonic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1051800051 9:20922404-20922426 AAGTGGAAGGGAGAGGGGGAAGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051935746 9:22440700-22440722 CAGTGCAAGGACCAGTGGGTCGG - Intergenic
1052056931 9:23917144-23917166 CAGTGGAAGGGCCAGTGGGTCGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052536595 9:29755698-29755720 AGGTGCAAGGGGCAGGTGGGTGG + Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1053358682 9:37467501-37467523 AAGTACAAGGGGCGGGGGGGGGG + Intergenic
1053361221 9:37487947-37487969 CAGGGGAAGGGACAGTGGGAAGG + Intronic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1053470727 9:38344665-38344687 GAAGGCAAGAGGCAGGGGGAGGG + Intergenic
1055388437 9:75791146-75791168 CAAAGCATGGGGCAGGGGGATGG - Intergenic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1055673488 9:78631275-78631297 GAGTGGGAGGGGCAGGGAGAAGG + Intergenic
1055814128 9:80185375-80185397 CAGGGCAAGGGGCGGGGGCGGGG + Intergenic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1056803837 9:89712910-89712932 CAGGGTGAGGGGCAGGGGCAGGG + Intergenic
1057256695 9:93554920-93554942 CAGTGCAAGGGGCCAGGAGATGG + Intronic
1057489030 9:95507797-95507819 CAGGGCAGGGGGCACGGGGCAGG + Intronic
1057851287 9:98568651-98568673 CACTGCAAAGGCCAGAGGGATGG - Intronic
1057854671 9:98593428-98593450 CAATGGCAGGAGCAGGGGGAAGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058139511 9:101342527-101342549 GAGTGGGAGGGGGAGGGGGAAGG + Intergenic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1060245193 9:121939928-121939950 CAGGGAAAGAGGCTGGGGGAGGG + Intronic
1060281523 9:122218844-122218866 CAGTGCAAAGGCCTGGGGGTGGG - Intronic
1060420361 9:123464567-123464589 CAGTAGCTGGGGCAGGGGGAAGG + Intronic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1060561451 9:124548133-124548155 AAGAGCAAGGGGGAGGGGGGAGG + Intronic
1060781174 9:126414404-126414426 CAGTTCCGTGGGCAGGGGGAAGG + Intronic
1060802108 9:126551406-126551428 CAGGGGCAGGGGCAGGGGAAGGG - Intergenic
1060802111 9:126551412-126551434 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1060802114 9:126551418-126551440 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1060977955 9:127776517-127776539 CACAGCTGGGGGCAGGGGGAGGG - Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061251686 9:129430111-129430133 AAATGCATGGGGCAGGGTGAGGG + Intergenic
1061259030 9:129469530-129469552 AATTGCATGGGGAAGGGGGAGGG - Intergenic
1061294567 9:129669998-129670020 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061531634 9:131218647-131218669 CAATGGAAGAGCCAGGGGGAAGG - Intronic
1061540952 9:131277631-131277653 CAGTGCCCGGGGAAGGGGGTGGG - Intergenic
1061779887 9:132989281-132989303 CACCCCCAGGGGCAGGGGGAGGG - Intronic
1061943496 9:133895119-133895141 CAGCACAAGGGGCAGGGGAGGGG + Intronic
1062113422 9:134795185-134795207 ACGTGCCAGGGGCTGGGGGAAGG + Intronic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062185001 9:135213428-135213450 CAGAGCCAGGGGCATGGGCAAGG + Intergenic
1062359753 9:136182136-136182158 CTGTGCAGGGCGCAGGGAGAAGG - Intergenic
1062379552 9:136280715-136280737 CAGTGCCAGGGGGAGGAGAAGGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062637577 9:137499693-137499715 CCGGGCAAGGGGCAGGGGTGGGG - Intronic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1203768189 EBV:37247-37269 CAGGGGGAGGGGCAGGGGCAGGG + Intergenic
1203768195 EBV:37259-37281 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203768197 EBV:37265-37287 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1185526360 X:783357-783379 CATTTCCAGGGGCTGGGGGACGG - Intergenic
1185644020 X:1604261-1604283 AAGTGCATGTGGCCGGGGGAAGG + Intergenic
1186193900 X:7093165-7093187 GATTGCCAGGGGCTGGGGGAGGG - Intronic
1186267832 X:7850932-7850954 CATTGCTAGGGGCTGGGGGAGGG - Intergenic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1187039583 X:15579552-15579574 CATTGCAAGAGAAAGGGGGAAGG + Intronic
1187376055 X:18755713-18755735 TATTGCCAGGGGCTGGGGGAGGG - Intronic
1188003830 X:25004442-25004464 CAGTAGCAGGGGCAGGGGCAGGG + Exonic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188496933 X:30791476-30791498 CAGTGCAAGGCGCAAGGCAAGGG - Intergenic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189019472 X:37319626-37319648 CAATGCTAGGGGATGGGGGAAGG - Intergenic
1189113559 X:38320278-38320300 CGGGGCAAGGGGCAGGGGCAGGG + Intronic
1189113562 X:38320284-38320306 AAGGGGCAGGGGCAGGGGGAAGG + Intronic
1189972545 X:46432967-46432989 CATTGATAGGGGCAGGGGGATGG - Intergenic
1190265695 X:48826378-48826400 CAGTGGCAGGGGCAGGGGCGCGG + Intergenic
1190324768 X:49199836-49199858 GAGGGCAAGGGACAAGGGGAGGG - Intronic
1190495268 X:51022493-51022515 CATTGAAAGTGGCAAGGGGAAGG + Intergenic
1190685927 X:52873110-52873132 TAATGCAGGGTGCAGGGGGAAGG + Intergenic
1190772435 X:53526639-53526661 CAGAGCAAGGGGCGGGGTGGGGG - Intergenic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1192174880 X:68879340-68879362 CAGTCCATGGGGCAGGGACAGGG - Intergenic
1193219781 X:78910516-78910538 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193396496 X:80990173-80990195 CACTGCAAGGGGATGGAGGACGG - Intergenic
1193584956 X:83310532-83310554 CACTGCCAGGGGCATGGGAAAGG - Intergenic
1193596542 X:83452309-83452331 CACTGCCAGGGGATGGGGGAGGG + Intergenic
1193755979 X:85408950-85408972 CAGTGGACTGGGTAGGGGGAGGG - Intergenic
1194223515 X:91226742-91226764 CCGTGCTGGGGGCAGGGGGCTGG + Intergenic
1194747969 X:97650437-97650459 CAATACATGGGGGAGGGGGAAGG - Intergenic
1195157982 X:102142159-102142181 CAGTGCAAGGGGCGTCGAGAAGG + Intronic
1195202756 X:102565641-102565663 GAGAGGGAGGGGCAGGGGGAGGG + Intergenic
1195206537 X:102605121-102605143 CAGTAAAAGAGGCAGGGGGTAGG - Intergenic
1195403349 X:104485758-104485780 CAGGGCCAGGGCCAGGGGTAGGG - Intergenic
1195547382 X:106127505-106127527 GATTGCCAGGGGCAGGGGGTAGG - Intergenic
1195676895 X:107513427-107513449 AATGGCAAGGGGCAGGAGGATGG - Intergenic
1195941529 X:110171840-110171862 CAGGCCAAGGGGCAGGGTTAGGG - Intronic
1196316909 X:114237818-114237840 TGGGGTAAGGGGCAGGGGGAGGG - Intergenic
1197854716 X:130902754-130902776 CAGAGCCAGGGGGAGGGGGGCGG + Intronic
1197871806 X:131068582-131068604 CAGTGAAAGGGCCAGGGGGAGGG - Intronic
1197985865 X:132266035-132266057 CATGGCATGGGGTAGGGGGAGGG - Intergenic
1198663291 X:138995108-138995130 CATTGCTAGGGGATGGGGGAGGG - Intronic
1199332869 X:146582375-146582397 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1199758650 X:150888507-150888529 CAGTGCCAGGGGTTAGGGGAGGG + Intronic
1199767520 X:150952130-150952152 TAGGGCAGGGGGCAGGGGCAGGG + Intergenic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1199964478 X:152808136-152808158 CAGTGCCGGGGGTAGGGGGAGGG - Intergenic
1200042280 X:153379198-153379220 CAGTGAATGGGGGTGGGGGATGG + Intergenic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1200559982 Y:4690124-4690146 CCGTGCTGGGGGCAGGGGGCTGG + Intergenic
1201335622 Y:12878103-12878125 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1201437848 Y:13978770-13978792 CATTGCTAGGGGCTGGGGGAGGG + Intergenic
1201565859 Y:15364844-15364866 GATTGCCAGGGGCTGGGGGAGGG - Intergenic