ID: 1150130468

View in Genome Browser
Species Human (GRCh38)
Location 17:62666299-62666321
Sequence CAGTGTTCCTGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150130452_1150130468 18 Left 1150130452 17:62666258-62666280 CCCATCAAGAGTGAGAGCTGTTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 425
1150130453_1150130468 17 Left 1150130453 17:62666259-62666281 CCATCAAGAGTGAGAGCTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 425
1150130451_1150130468 19 Left 1150130451 17:62666257-62666279 CCCCATCAAGAGTGAGAGCTGTT 0: 1
1: 0
2: 1
3: 14
4: 109
Right 1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 425
1150130463_1150130468 -8 Left 1150130463 17:62666284-62666306 CCGTGGGGGCGGGGGCAGTGTTC 0: 1
1: 0
2: 0
3: 16
4: 242
Right 1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 44
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150130468 Original CRISPR CAGTGTTCCTGGAGGGAGGC TGG Intronic
900084864 1:887374-887396 AACTTTTCCTGAAGGGAGGCCGG + Intergenic
900750886 1:4396688-4396710 CAGTGTTCCTTCAGCCAGGCGGG + Intergenic
900851306 1:5145108-5145130 CAGTCTACTTGGAGGGGGGCTGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901073109 1:6533564-6533586 GAGTGTTCCTGTAGGTAGGATGG - Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902318722 1:15644504-15644526 CAGTGTTGCTGTAGTGAGGCTGG + Intronic
902721448 1:18306942-18306964 CTGGGTTCCTGGAAGGTGGCAGG - Intronic
903537642 1:24077495-24077517 GAGTGAGCCAGGAGGGAGGCGGG - Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904289536 1:29475305-29475327 CACTGTTCATGCAGAGAGGCTGG + Intergenic
906200628 1:43957962-43957984 CAGAGCTCCTGGAGGAAGGAGGG - Exonic
906662116 1:47590429-47590451 CTGTGCTCCTGGAGTGGGGCTGG + Intergenic
907268316 1:53276021-53276043 GAGTGGCCCTGGAGAGAGGCAGG - Intronic
907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG + Intronic
907513613 1:54980074-54980096 CAGTTCTCCTTGAGGGAGGAAGG + Intergenic
907903452 1:58762693-58762715 CAGAGTACATGGGGGGAGGCCGG + Intergenic
908070330 1:60453453-60453475 CAGGATTCCTGGTGGGAGGCAGG - Intergenic
908905605 1:69005429-69005451 CATTGTTCCTGGAGGAAGTGTGG + Intergenic
910263284 1:85312381-85312403 CAGTCTTCCTGGGGAGAGACAGG - Intergenic
910981415 1:92962282-92962304 CAGTGTTCCTGGACGGGGCCAGG - Intergenic
911328812 1:96501658-96501680 CAGTGATCTTTGAAGGAGGCAGG + Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
914335909 1:146714821-146714843 AAGTGTTCCAGCAGGGAGCCAGG - Intergenic
917480144 1:175404691-175404713 CAGGGATCCTGGTGGAAGGCTGG + Intronic
918098616 1:181354681-181354703 TAGTTTTCATGGAGGGAGACAGG + Intergenic
919506224 1:198400781-198400803 CAGTTTTCCTGGAGGGGGGGTGG + Intergenic
920176823 1:204107332-204107354 CAAGGGTCCTGGAGGGAGTCAGG - Intronic
920726322 1:208438574-208438596 CAATGTTTCTGGAGTGAGGGAGG + Intergenic
920779551 1:208975349-208975371 CAATGTTCCTGGAGAGAGAGAGG - Intergenic
920992315 1:210951272-210951294 CAGTTTTCCTGGATGCACGCAGG - Intronic
922477830 1:225919069-225919091 CAGTGTTTCTCTAGGCAGGCCGG - Intronic
923686029 1:236154427-236154449 CAGTATTCCTGGAGGAACGTGGG + Intronic
1062793468 10:324300-324322 CAGTGTTCCTGCAGCAAGGAAGG - Intronic
1062974373 10:1672606-1672628 GTGTGTCCATGGAGGGAGGCAGG - Intronic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1064339877 10:14476329-14476351 CAGTGTTTCAGCTGGGAGGCTGG - Intergenic
1067897206 10:50196373-50196395 CAGTTTTTCTGGGGGGAGGAGGG - Intronic
1067951766 10:50745652-50745674 CAGTTTTTCTGGGGGGAGGAGGG + Intronic
1071573954 10:86712361-86712383 TAGTATTGCTGGAGGGAGGCAGG + Intronic
1072127262 10:92457899-92457921 CTGAGTTCCTGGAAAGAGGCTGG - Intronic
1072277389 10:93836451-93836473 CAGTGTTCCAGAAGGGAGCAAGG - Intergenic
1074145096 10:110710610-110710632 CAGTTTTCTTGGAGAGAAGCTGG + Intronic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1074394419 10:113085831-113085853 CAGTGTTTCTGGAGAAAGCCAGG + Intronic
1074888758 10:117717438-117717460 GAGTGTGCCTGGAGTGAGTCTGG - Intergenic
1075776933 10:124995220-124995242 CTGTGTTCTGGGCGGGAGGCAGG + Intronic
1075817900 10:125279945-125279967 CAGACTTCCTGGGGGGTGGCAGG + Intergenic
1075840074 10:125494004-125494026 CCATGCTCCTGGAGGGAGCCAGG + Intergenic
1076014290 10:127015363-127015385 CAGGGCTCCTGGTGGGAGACGGG - Intronic
1076015489 10:127024300-127024322 CAGTGTTCATGGCTGGAGGAAGG + Intronic
1076065981 10:127448172-127448194 CAGTGCTGCTGGAGGAAGCCAGG - Intronic
1076399755 10:130174270-130174292 TAGTGCTCGTGGACGGAGGCTGG - Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076547118 10:131252925-131252947 AAGTGTGCCTGGAAGGAGGGTGG - Intronic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076571896 10:131438644-131438666 CAGTGCCCCTGGACAGAGGCTGG + Intergenic
1076720181 10:132389034-132389056 CAGGCTTCCTTGAGGGAGCCAGG - Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1077050273 11:563322-563344 GAGTGGTTCTGGGGGGAGGCTGG + Intronic
1079446503 11:20561575-20561597 CAGGGTTGCTAGAGGGAGACTGG + Intergenic
1080737448 11:35030715-35030737 CTGTGTTCCTGGCGAGAGGCTGG + Intergenic
1080870316 11:36230989-36231011 CCTTATTCCTGCAGGGAGGCGGG - Exonic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083776636 11:64897373-64897395 CAGGGACCCTGGAGAGAGGCTGG + Intronic
1083837480 11:65281053-65281075 CAGTGATTCTCGAGGGAGACCGG + Exonic
1083876894 11:65529021-65529043 CAGGGTTGCTGTAGGGAGGAGGG + Intronic
1084193875 11:67512321-67512343 CAGAGTTCCGTGAGGGAGGTGGG + Intergenic
1084337720 11:68470607-68470629 CTGTGCTGCTGGAGGGAGGTTGG + Intronic
1084362696 11:68679223-68679245 CTGTGTTACTGGAGTGGGGCTGG + Intergenic
1084479385 11:69409894-69409916 CAGTGTTCCAGGCGAGGGGCAGG - Intergenic
1084677604 11:70645307-70645329 CGGTGTTGCTGGTCGGAGGCAGG + Intronic
1084965077 11:72740218-72740240 CAGTGGACCTGGTGGGAGGCAGG + Intronic
1086121026 11:83304460-83304482 CATTGTCCCTGGGGAGAGGCAGG + Intergenic
1087031308 11:93707635-93707657 CTGTAGTCCTGTAGGGAGGCAGG + Intronic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088692971 11:112343738-112343760 CAGAGTTCCTGCAGAGAGCCAGG + Intergenic
1088710450 11:112503579-112503601 GAGGGTTCCTGGAGGTAGGGTGG + Intergenic
1088717870 11:112564800-112564822 CATTTTTCCTGGAGTGAGGGAGG + Intergenic
1089018732 11:115189109-115189131 CAGTGTTCCTGCAGGGAGTGGGG + Intronic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089606838 11:119646219-119646241 CAGACCTCCTGGATGGAGGCTGG + Intronic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1090843653 11:130513669-130513691 CAGTTCTCATGGAGGGAGGGAGG + Intergenic
1091274170 11:134338832-134338854 TGGGGTTCCTGGAGGAAGGCAGG - Intronic
1091654225 12:2333566-2333588 CACTGCTACTGGAAGGAGGCTGG - Intronic
1091786077 12:3244152-3244174 CAGTCTTCTTGGAGGCAGGGAGG + Intronic
1091918141 12:4283714-4283736 CATTTTGCCAGGAGGGAGGCGGG + Intronic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092763004 12:11826491-11826513 CAGGGGTCCTGGAGGCAGGATGG - Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1094719907 12:33052804-33052826 AAGTGTCGCTGGAGGGTGGCTGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096695537 12:53345931-53345953 AATTGTTCCAGGAGGGAGGGAGG - Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1102884200 12:116509013-116509035 CAGGCTTCCTGGAAGGAGGGAGG - Intergenic
1103085080 12:118056527-118056549 CAGAGTTCCTGGTGGAGGGCAGG + Intronic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1103558306 12:121779027-121779049 CCGTGTTCCTGGGGGAAGGAAGG + Exonic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104830831 12:131750111-131750133 CTGTGGCCCTGGTGGGAGGCAGG - Intronic
1104980620 12:132571727-132571749 CAGTGGTCCTGGACTTAGGCAGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104989417 12:132616890-132616912 CAGTGCTCCTAGGGGGTGGCTGG + Intergenic
1113565962 13:111320073-111320095 CAGAGGTCCTGGGGGGAGGCTGG - Intronic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1113782089 13:112982585-112982607 CATTGTGTCTGGTGGGAGGCGGG + Intronic
1114454104 14:22844448-22844470 CAGTGTTGATGGACGCAGGCAGG - Exonic
1115351906 14:32404912-32404934 CTGTATTCCAGGAGGGAGGGAGG + Intronic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1119731911 14:76956531-76956553 CCGGCTTCCTGCAGGGAGGCGGG - Intergenic
1119877913 14:78076197-78076219 CAATGTTCCAGGAGGGATGTCGG + Intergenic
1120655595 14:87186193-87186215 CAGTGCTTCAGCAGGGAGGCAGG + Intergenic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121645444 14:95515012-95515034 AAGTGTACCTGCAGGGAGCCAGG + Intergenic
1122372321 14:101235529-101235551 CTGTTTTCTTGGAGGGGGGCTGG - Intergenic
1122604349 14:102938330-102938352 GCTTGTTCCTGGATGGAGGCTGG + Exonic
1122892824 14:104740953-104740975 AAGTGCTCCTCCAGGGAGGCTGG + Intronic
1122968591 14:105143377-105143399 CTGTGTTCCTGGTGGCTGGCAGG + Intronic
1123438558 15:20273223-20273245 CAGTCTTCTAGGAGGTAGGCGGG - Intergenic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1124650364 15:31469489-31469511 CTGTGCTCTTGGAGGGGGGCAGG - Intergenic
1124654158 15:31495096-31495118 CAGGGCTCCTGAGGGGAGGCTGG + Intronic
1127196093 15:56587346-56587368 CAGTGTTTCTATGGGGAGGCAGG + Intergenic
1127602987 15:60556909-60556931 AAGTGTTCCTGGAGGCAGAATGG - Exonic
1128151055 15:65363659-65363681 CAGGGGTCCTGGCAGGAGGCGGG - Intronic
1129150020 15:73682720-73682742 CAGAGTTCCTGGAGGTGGTCAGG + Intergenic
1129253339 15:74320461-74320483 GAGAGTTCCCGGTGGGAGGCAGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129655831 15:77525324-77525346 CAGTTCTCCTGGAAGGAGGGAGG + Intergenic
1129845943 15:78767800-78767822 CAGTTTTCCTGAGGGGAGGCTGG - Intronic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1131515790 15:93075721-93075743 CAGTGTCCCTGCCGGGAGACGGG + Intronic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1132767141 16:1540091-1540113 CAGTGTGCCTCCAGGGATGCTGG + Intronic
1133453939 16:5926260-5926282 CAGCGTTCCTGAATGCAGGCAGG - Intergenic
1133596351 16:7297143-7297165 CATTGTGCCTGCAGGGAGGAGGG + Intronic
1133769922 16:8861821-8861843 CAGAGTTCCAGGAAAGAGGCTGG + Intronic
1134064058 16:11215648-11215670 AAGTATTTCTGGAAGGAGGCCGG - Intergenic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1135323886 16:21513798-21513820 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1135532465 16:23266324-23266346 AAGGATTCCTGGAGGGAGGCTGG + Intergenic
1136335371 16:29607066-29607088 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1139997715 16:70996402-70996424 AAGTGTTCCAGCAGGGAGCCAGG + Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1141278564 16:82609619-82609641 CAGTTTTCCTGGGAGAAGGCAGG + Intergenic
1142197775 16:88746651-88746673 CAGTTTTCCGGGAGGGAGAGAGG - Intronic
1142289709 16:89187977-89187999 GGGTGTTCCTGCTGGGAGGCAGG + Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1143375212 17:6463174-6463196 CACTGTTACTGGGGTGAGGCAGG + Intronic
1145266660 17:21382979-21383001 CACAGTTCCCGGAGGAAGGCTGG + Intronic
1145943823 17:28758715-28758737 CAGAGTTCCTGCGGGTAGGCAGG + Exonic
1148029076 17:44607774-44607796 CAGTGCTCCTGGGAGTAGGCTGG - Intergenic
1149329102 17:55563141-55563163 GAGTGTTCCAGGTGAGAGGCAGG + Intergenic
1149442906 17:56690177-56690199 GAATCTTCCTGGAGAGAGGCTGG + Intergenic
1149517635 17:57292491-57292513 CAGGGTACCTGGAGGAAGGGTGG + Intronic
1149569628 17:57663215-57663237 CAATCATCCTGCAGGGAGGCTGG + Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1151366742 17:73622528-73622550 CAGTGTTTGAGGAGGGAGGGAGG + Intronic
1151462710 17:74264239-74264261 CAGTGAGCCTGCGGGGAGGCTGG - Intergenic
1152535645 17:80949093-80949115 CGGGTTCCCTGGAGGGAGGCAGG - Intronic
1152609021 17:81306621-81306643 CACGGTCCCTAGAGGGAGGCAGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1154112180 18:11579538-11579560 CAGTGGACGTGGAGTGAGGCTGG - Intergenic
1154139639 18:11811430-11811452 CAGTATTCCTGGGCAGAGGCTGG - Intronic
1154172835 18:12063492-12063514 CACTGGTCCTGGAGGGATCCTGG - Intergenic
1157451791 18:47794483-47794505 CAGTGCCCCTGGAGCGAGGGGGG + Intergenic
1157699452 18:49751658-49751680 CAGTTTTCCCGGAGTGAGGATGG - Intergenic
1159340221 18:67124958-67124980 CAGTGTTCCTGGAGCTCAGCCGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1160693683 19:472330-472352 CAGTGCTCCTGGGGGGAGATTGG + Intronic
1160726371 19:619489-619511 CAGGGCTCCTGCTGGGAGGCTGG + Intronic
1161209707 19:3060060-3060082 AAGTGTTCCTGGAAGGATCCTGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1161769146 19:6222048-6222070 CGCTGTTCCAGAAGGGAGGCGGG + Intronic
1162024956 19:7888581-7888603 CACCGTTCCGGGAGGGACGCTGG - Exonic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164574502 19:29397831-29397853 CAGTATTCCTGCAGGGCTGCTGG + Intergenic
1164738277 19:30558471-30558493 CAGATTTGCTGAAGGGAGGCTGG - Intronic
1165321886 19:35090633-35090655 CAGTGTTCATGGAGTGAGAAAGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166449606 19:42887144-42887166 CAGTGTTTATGGAGGGTGACCGG - Intronic
1166460906 19:42987442-42987464 CAGTGTTTATGGAGGGTGACCGG - Intronic
1166478197 19:43147431-43147453 CAGTGTTTATGGAGGGTGACCGG - Intronic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167174189 19:47853979-47854001 AACTGATCCTGGAGGGAGGAAGG + Intergenic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1167958146 19:53084492-53084514 CCCTGTTGCTGGAGCGAGGCCGG - Intronic
1168266570 19:55226890-55226912 CAGTGAACATGGAGGCAGGCTGG + Exonic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168536511 19:57174705-57174727 CAGTGTTCCTGGAGAGGGCATGG + Intergenic
926747372 2:16169950-16169972 CAGTTTTCTTGTGGGGAGGCAGG - Intergenic
927149242 2:20186257-20186279 CAGGGTCCCTGGAGGGAGCCGGG + Intergenic
927446344 2:23165436-23165458 CAGTGATCCAGGAAGGATGCAGG + Intergenic
927878810 2:26676144-26676166 CAGTGTTCCTGGCTGGTGGTTGG + Intergenic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
929049764 2:37826173-37826195 CAGTGACCCTGGGGGGAGGGTGG + Intergenic
930019587 2:46993435-46993457 CGATGTTCCTGGTGGGAGGACGG - Exonic
930691684 2:54371564-54371586 GAGTTTTCCAGCAGGGAGGCTGG + Intronic
931192602 2:60019997-60020019 CAAAGTTCCTGAAGGGATGCTGG + Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
932779252 2:74549637-74549659 CAGGGTTCCTTAAGGGCGGCGGG - Intronic
933340956 2:81025596-81025618 CAGCCTTCCTGGAAGAAGGCAGG - Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
934529582 2:95076748-95076770 GGGTGTTCCGGGAGGGAGGGAGG - Intergenic
934561788 2:95317371-95317393 CACTGTTCCTGGAGGCAGAAGGG - Intronic
934810341 2:97271911-97271933 CAGTGTTGCTGGTGGCTGGCTGG - Intergenic
934827351 2:97436028-97436050 CAGTGTTGCTGGTGGCTGGCTGG + Intergenic
935065188 2:99641206-99641228 CAGTGTCACTGGAGGGACACAGG - Intronic
935141114 2:100353876-100353898 GAGGGTGGCTGGAGGGAGGCTGG + Intergenic
935401279 2:102662986-102663008 CAGTGTTCCAGAGGAGAGGCGGG - Intronic
936272537 2:111060173-111060195 CAGTGTCACTGTAGTGAGGCAGG - Intronic
938638563 2:133255253-133255275 CATTTATCCTGGAAGGAGGCAGG - Intronic
938726513 2:134113424-134113446 CAGTCTTGCTGGAGAGAGGCTGG + Intergenic
940267795 2:151858259-151858281 CAGGGATCCTGGAGAGAGGTGGG - Intronic
940551881 2:155169320-155169342 CAGTGAGCCAGCAGGGAGGCTGG + Intergenic
941591350 2:167423929-167423951 CAGTATTCCTGGAGCTAGGCAGG - Intergenic
942346312 2:175005729-175005751 CAGTGAGCCTGGAGGGCGCCAGG - Intergenic
942551605 2:177125768-177125790 CAGTGATCATGAAGGGAGCCTGG + Intergenic
942944411 2:181657128-181657150 CAGGGACCCAGGAGGGAGGCGGG + Intronic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
946076136 2:217075222-217075244 CAGTGTCCGCGGAGGAAGGCTGG - Intergenic
946395393 2:219441748-219441770 CGGTGGTCGTGTAGGGAGGCAGG + Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947741953 2:232488644-232488666 CAGTTTACCTGGAAGAAGGCAGG - Intergenic
948493039 2:238326234-238326256 CACTGTGCCTGGCTGGAGGCTGG + Intronic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
948799569 2:240425855-240425877 CAGTGTTCCTGCTGGGTGGGAGG + Intergenic
948876887 2:240834148-240834170 CAGGGTTACTGGAGAGAGCCTGG - Intergenic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1169303795 20:4470752-4470774 CAGTATTGCTGGAGGCCGGCAGG - Intergenic
1169357164 20:4917084-4917106 CTGAGCTCCTGCAGGGAGGCAGG - Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1171101261 20:22385493-22385515 CAGAGCCCCTGGAGGGAGCCTGG + Intergenic
1172826281 20:37789582-37789604 CATTGTCCCTGGAGGGAGACTGG + Intronic
1172961596 20:38804448-38804470 CAGAGTTCCTGGAGAGGGCCTGG + Intergenic
1173645248 20:44629256-44629278 CTGTGGTCCTGCAAGGAGGCTGG - Intronic
1173650915 20:44663511-44663533 CAGTCTTCCAGGATGGAGGATGG + Intergenic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174283073 20:49453294-49453316 CAGTCTGCCTGGTGGGAGGACGG + Intronic
1175188197 20:57194003-57194025 CAGCGTTCATGGACGGAGGAAGG - Intronic
1175284454 20:57828770-57828792 CACTGTCCCTGGTGGGTGGCGGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175626126 20:60489546-60489568 CAGCGTTCCTGGAGGGAGCACGG + Intergenic
1175962500 20:62644196-62644218 CTGTGCTGCTGGAGGGAGCCAGG + Intronic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179937455 21:44614359-44614381 CACTGTGGCTGGAGGGAGCCCGG + Intronic
1179990731 21:44947083-44947105 AACTGTTCCTGGAGAGAGGGAGG - Intronic
1180049273 21:45323974-45323996 CAGGGTTCCTGGGCTGAGGCTGG + Intergenic
1180799116 22:18623671-18623693 CAGGGATCCTGGAGTGTGGCAGG - Intergenic
1180846725 22:18986941-18986963 CAGTGAGCCTGAAGTGAGGCAGG - Intergenic
1180972080 22:19821050-19821072 CACTGTCCCTTGGGGGAGGCAGG - Intronic
1181222602 22:21371595-21371617 CAGGGATCCTGGAGTGTGGCAGG + Intergenic
1181486899 22:23237285-23237307 CTGTGCTCATGGAGGCAGGCTGG + Intronic
1181638359 22:24184584-24184606 CAGGGATCCTGGAGTGTGGCAGG + Intronic
1182089417 22:27583939-27583961 CAGGGTTGCTGGAGCGACGCTGG - Intergenic
1182517914 22:30869431-30869453 CTGTGTTCCTGCAGGGAGATCGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183158650 22:36095188-36095210 CAGAGCTCCGGGAGGGAGACAGG - Intergenic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
1184192731 22:42905770-42905792 CAGTGCTCCTGGTGGGTGGATGG + Intronic
1184375232 22:44107812-44107834 GAGTTTTCGGGGAGGGAGGCGGG - Intronic
1184594112 22:45503685-45503707 CTCTGTCCCGGGAGGGAGGCAGG - Intronic
1184731652 22:46373994-46374016 CGTTGTTTCTGGAGGGTGGCTGG - Intronic
1184733677 22:46385463-46385485 CAGTGAGCCTGGAGTGAGGCGGG + Intronic
1184805920 22:46794794-46794816 CAGTGGTGCTGTTGGGAGGCAGG + Intronic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185056571 22:48581854-48581876 CTGTGTTCCTGGAGAGGGGAGGG + Intronic
1185058250 22:48592257-48592279 CAGTGGCCCTGGAGTGAGGCTGG + Intronic
1185109747 22:48894318-48894340 GATTGTCCCCGGAGGGAGGCAGG - Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
950266587 3:11577689-11577711 TGGTGCTCCTTGAGGGAGGCTGG - Intronic
951087109 3:18525940-18525962 CAGTCTTCCTGGTGGATGGCAGG + Intergenic
951459026 3:22928933-22928955 TAGTGTTCCTGGAACGAAGCCGG - Intergenic
956594114 3:70947888-70947910 CTGTGTTCCTCCAGGGATGCTGG + Intergenic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957636333 3:82790664-82790686 CAGGGTTCCTGGAAGGAAACGGG + Intergenic
960036313 3:113105997-113106019 CAGTGTATCTGGAGGGGGCCAGG - Intergenic
960052663 3:113252832-113252854 GAGTGCTCAGGGAGGGAGGCAGG + Intronic
961186417 3:124918889-124918911 CAGTTTTCATGGTGGGAGGCTGG - Intronic
961554794 3:127690456-127690478 CAGGGCTGCTGGAGGGAGGGTGG + Exonic
962271100 3:133978683-133978705 CACTCTTCCTGGATGGAGGCAGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962421000 3:135229167-135229189 CAGGGCTCATGCAGGGAGGCAGG + Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966879142 3:184339930-184339952 CAGTTTTCCTGGAGTGCAGCTGG - Intronic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
967975914 3:195034766-195034788 CACTGTGCGTGGAGGGATGCAGG + Intergenic
968731183 4:2270095-2270117 CAGTGGTCCTCTAGGCAGGCAGG - Exonic
969209006 4:5672100-5672122 CAGTGTGCCTGGGCTGAGGCTGG + Intronic
969462371 4:7335584-7335606 CAGTCTTGCTGGAGGCGGGCTGG + Intronic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
969703557 4:8780496-8780518 CACAGTTCCTGGAGGAAGGAGGG - Intergenic
969838855 4:9865849-9865871 CAGTGTTCCTGCAGGGACCTTGG - Intronic
970272385 4:14360776-14360798 CAGTGTGCCGGGAGGGGGGGCGG + Intergenic
971093179 4:23369442-23369464 GACTGCTCCTGGTGGGAGGCAGG - Intergenic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
976005367 4:80423663-80423685 CAGAGTTCCAGGAGGCAGTCTGG + Intronic
976482044 4:85556831-85556853 TAGAGCTCCTAGAGGGAGGCAGG - Intronic
976865725 4:89723895-89723917 CTGGGTTCCTGGATGGGGGCTGG - Intergenic
977222659 4:94356134-94356156 CAGGGATCCTGGTGGGAGGCAGG + Intergenic
977566618 4:98587129-98587151 CACTTTTCCTGAAGGCAGGCTGG - Intronic
977710870 4:100123588-100123610 CTGTCTTACTTGAGGGAGGCAGG + Intergenic
978634292 4:110785482-110785504 CAGTGTTCCCTGTGGCAGGCTGG + Intergenic
979680407 4:123453592-123453614 CAGTCTCCCTTGCGGGAGGCAGG + Intergenic
982615824 4:157636913-157636935 CCCTGTTCCGGGAGGGAGGTGGG - Intergenic
983162452 4:164433095-164433117 CACTCTTGCTTGAGGGAGGCTGG + Intergenic
984144965 4:176048985-176049007 CAGTGTTCCTTCAAGGAGACAGG - Intergenic
984522309 4:180816719-180816741 GGGTGTTCCGGGAGGGTGGCAGG - Intergenic
985069936 4:186158119-186158141 CAGTGTTCCTGGAGCAAGACAGG - Intronic
985800463 5:2002436-2002458 CAGTGGCCCTGGAAGTAGGCAGG - Intergenic
986147113 5:5088770-5088792 GTGTGTTCCTGGATGGGGGCTGG + Intergenic
986370664 5:7077323-7077345 GAGTGAGCCTGGAGGGAGCCTGG - Intergenic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
986731200 5:10636158-10636180 AGGTGTTCCTGGGGGGAGGGAGG + Intronic
986738062 5:10682253-10682275 CATGCTTCCTGCAGGGAGGCTGG - Intronic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
991024526 5:62015581-62015603 CAGTATTCGTGTAGGGAGCCTGG - Intergenic
992645667 5:78808800-78808822 CAGTGATGCTGGAGGGACACAGG + Intronic
995550473 5:113276177-113276199 CAGGGTGTCTGGAGGGAGTCAGG - Intronic
995869903 5:116733936-116733958 AAGTTTTCCTGTCGGGAGGCTGG - Intergenic
996769469 5:127071039-127071061 TAGTGTCCCTGAAGGGAGGTTGG - Intronic
997429289 5:133826440-133826462 TAGGGTCCCTGGAGGGAGTCTGG - Intergenic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
997807957 5:136938396-136938418 CATTGTTCCTGGAGAGAGACAGG + Intergenic
998132033 5:139656092-139656114 AAGTGTTCCTGCTGGCAGGCTGG - Intronic
999200082 5:149810017-149810039 AACTGTTCCAGGAGGGAGGCTGG + Intronic
999286981 5:150399953-150399975 CAGTGAGCCTGCGGGGAGGCTGG + Exonic
999705567 5:154269717-154269739 CAGTGTCAGTGGAGGGAGCCTGG + Intronic
1002066732 5:176655572-176655594 CAGGATTCCTGAACGGAGGCAGG + Intronic
1002326864 5:178415494-178415516 AAGTGTTCGTGGAGGCCGGCTGG - Intronic
1002470613 5:179433159-179433181 CAGTGAGCCAGGAGAGAGGCCGG - Intergenic
1002939879 6:1706630-1706652 CAGTTTTGCTGGAACGAGGCTGG + Intronic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1005122323 6:22403296-22403318 CAGTGTCCTTGGAGGGTGGAAGG - Intergenic
1005995163 6:30926399-30926421 CAGACTTCCAGGTGGGAGGCAGG - Exonic
1006735461 6:36269919-36269941 CCGTCCTCCTGGAGGGAGGCGGG + Intronic
1006911590 6:37566702-37566724 CAGTGTCCCTGGTAGGTGGCAGG - Intergenic
1007432337 6:41783923-41783945 TGGTCTTCCTTGAGGGAGGCTGG - Intronic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1007947860 6:45841788-45841810 CAGAGCTCCAGGAGTGAGGCTGG - Intergenic
1008969904 6:57355448-57355470 CAGTGTTACTGCTGGGAAGCAGG + Intronic
1012616051 6:101281479-101281501 CACCCTACCTGGAGGGAGGCTGG - Intergenic
1013047041 6:106497023-106497045 CAGTGTTCCTGGCAGGCAGCGGG - Intergenic
1013510534 6:110840585-110840607 GAATGTTCCTGAAGGGTGGCAGG - Intronic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015439175 6:133228017-133228039 CAGTGCTTCTTGAGGGAGGGAGG - Intergenic
1015578968 6:134702701-134702723 TGGTGTTCCTGCAGGGAGGGTGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1017729861 6:157305734-157305756 CAGTGTTTCAGGATGGAGGGGGG + Intronic
1018650568 6:165988488-165988510 CGCTCTGCCTGGAGGGAGGCTGG + Intergenic
1018698278 6:166407446-166407468 AATTGTTCATGGAGGGATGCAGG - Intergenic
1019359492 7:597462-597484 CCCAGTTCCTGGAGGGAGGCTGG + Intronic
1019590668 7:1829143-1829165 CAGGAGTCCTGGAGGCAGGCTGG + Intronic
1020083578 7:5298973-5298995 GGGTGCTCCTGGAGGGAGGATGG - Exonic
1020103156 7:5406962-5406984 CAGCGTTCCTGCAGGGAGCTAGG + Intronic
1020116180 7:5477835-5477857 CAGTGCTCCTGCAGGGATGGAGG - Intronic
1022580923 7:31553304-31553326 CAGTGTTCCTGGCATGATGCCGG + Intronic
1023045635 7:36208000-36208022 CACCGTTCCTGGAGGGCCGCAGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024769912 7:52709683-52709705 CAGTGTTACTGGATGAATGCTGG + Intergenic
1025092311 7:56074293-56074315 CAGTGTTCCTGGATGTACGAGGG - Intronic
1025210705 7:57018220-57018242 GGGTGCTCCTGGAGGGAGGATGG + Intergenic
1025661251 7:63558627-63558649 GGGTGCTCCTGGAGGGAGGATGG - Intergenic
1025943053 7:66087581-66087603 CACAGTCCCAGGAGGGAGGCAGG - Intronic
1026154443 7:67814874-67814896 CAGTGCACCAGGAGGGAGACTGG - Intergenic
1026491283 7:70866176-70866198 CACTGTTGCTGCAGGGAGCCTGG - Intergenic
1026879064 7:73897092-73897114 CTGTGTTCCTGTGGGGAAGCAGG - Intergenic
1026939868 7:74281367-74281389 CAGTGACCCTGCAGGGAGGGTGG + Intergenic
1027054741 7:75042416-75042438 CAGTGAGCGTGGTGGGAGGCTGG + Exonic
1027229745 7:76265270-76265292 CTGGGATCCTGGTGGGAGGCTGG + Intronic
1028513641 7:91652188-91652210 CAGTGGTCCATCAGGGAGGCAGG - Intergenic
1028669279 7:93382575-93382597 TAGTGTTCCTGGAACGAAGCCGG - Intergenic
1028932432 7:96428147-96428169 GAGTGTTCCTGAAAAGAGGCTGG - Intergenic
1030410817 7:109177818-109177840 CATGATTCCTGGAGGTAGGCAGG + Intergenic
1031077233 7:117224795-117224817 CAGTGTCCCTGGAAGGAGACGGG - Intronic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1031343950 7:120641355-120641377 TAGTGTCCCTGGAGACAGGCAGG + Intronic
1032463029 7:132125882-132125904 CACTGTTCCTGGAAGGAGCAGGG + Exonic
1032877093 7:136049388-136049410 GAGCGTTCCTGGTGGGAAGCTGG + Intergenic
1033842054 7:145386732-145386754 TCCTGTTGCTGGAGGGAGGCAGG + Intergenic
1034228704 7:149502146-149502168 GAGTGATACAGGAGGGAGGCAGG - Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1035344692 7:158190496-158190518 CAGTGGTCCTGATGGGAGGTGGG + Intronic
1035466115 7:159079032-159079054 CAGTGTCCATGGAGGAAGGATGG + Intronic
1035528452 8:332894-332916 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035528468 8:332939-332961 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035614136 8:990007-990029 CAGTGGTCCAGGAGGTTGGCTGG - Intergenic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1036754066 8:11460974-11460996 CAGTCCTCCTGCAGGAAGGCTGG + Intronic
1037748665 8:21665860-21665882 CACTATTTTTGGAGGGAGGCTGG - Intergenic
1039798641 8:40935949-40935971 CCCTGGTCCTGGAGGGAGGGTGG + Intergenic
1040478181 8:47799297-47799319 CACAGCTCCAGGAGGGAGGCTGG + Exonic
1040571252 8:48613253-48613275 CATTGTTGCTGGAGGGAGAGGGG + Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040705650 8:50123338-50123360 CAGTGTTCCTGAAAGGAGAATGG + Intronic
1040857282 8:51961231-51961253 GAGTGTTGCTGGAGTGGGGCTGG + Intergenic
1041389964 8:57339341-57339363 CAGTGCTGCTGGGGGCAGGCAGG + Intergenic
1042075097 8:64985234-64985256 CAGTTTTCCTGCAGGGAGCTGGG - Intergenic
1044692430 8:94894599-94894621 CGCTGGTCCAGGAGGGAGGCGGG - Intronic
1045161372 8:99549753-99549775 CAGCGGGCCTGGAGAGAGGCAGG - Intronic
1047766700 8:127996048-127996070 CAGAGGTCCTTGAGGGAGGGAGG - Intergenic
1048310422 8:133318342-133318364 TGGTGGTCCTGGAGGGAGTCGGG - Intergenic
1049570492 8:143368188-143368210 CGGAGGTTCTGGAGGGAGGCGGG + Intergenic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1050119862 9:2297154-2297176 CAGAGTGACTGGAGTGAGGCTGG + Intergenic
1052037314 9:23697017-23697039 CAGTCTTCCCCCAGGGAGGCAGG - Intronic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1057064786 9:92038611-92038633 CAGACTCCCTGGTGGGAGGCTGG - Intronic
1057548401 9:96034816-96034838 CTGTGCTCTTGGAGGGAGCCAGG + Intergenic
1057901369 9:98951442-98951464 TAGTGTTAGTGGAGGAAGGCAGG - Intronic
1058357006 9:104094516-104094538 CAGACTTCCTGGCGGGAGGCGGG + Intronic
1059127006 9:111698723-111698745 TAGTATTCCTGGGGGAAGGCAGG + Intronic
1060104614 9:120865952-120865974 AATTGTTCCAGGAGGGAGGAGGG + Intronic
1060109081 9:120893963-120893985 CAGTAGTTCTGGAGTGAGGCTGG - Intronic
1061008685 9:127942768-127942790 CAGTGCTCCTGGAGTGAGTGGGG + Exonic
1061235012 9:129337114-129337136 GTGTGTTCCTGGTGGGAGTCGGG + Intergenic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1185871659 X:3669915-3669937 AAGTGTTCCTTCAGGGAGGGAGG - Intronic
1186188279 X:7043010-7043032 CACTGTTTATGGAGGGTGGCCGG - Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1187344365 X:18449499-18449521 CAGTGATTCTGGGGGGCGGCAGG - Intronic
1188012167 X:25068792-25068814 AAGGGTTCTTAGAGGGAGGCAGG - Intergenic
1188529645 X:31125533-31125555 CAGTGTTCTGGGAGACAGGCTGG - Intronic
1188668039 X:32848894-32848916 AAGTGTTACAGGAGGCAGGCTGG + Intronic
1189920799 X:45901414-45901436 CACTGGTACAGGAGGGAGGCAGG + Intergenic
1190635034 X:52424973-52424995 CAGTCTTCCAGGAAGGAGCCAGG + Intergenic
1191197579 X:57741182-57741204 CAGTGTTGCTGGGGCTAGGCTGG + Intergenic
1191671702 X:63754600-63754622 TAGTGTTCCAGGTGGGGGGCCGG + Exonic
1193160061 X:78217627-78217649 CATGGTTCCTGGAAGAAGGCAGG - Intergenic
1195139991 X:101949756-101949778 AAGTGTTACTGGAGGGATGGGGG + Intergenic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1199671098 X:150148924-150148946 CAGTGTTCCTGCTGGGAAACTGG + Intergenic
1199715636 X:150505703-150505725 CAGAATGCCTGCAGGGAGGCAGG - Intronic
1200174001 X:154099062-154099084 CAGTGTTGCTGGAGAGTGGTAGG + Intergenic
1200336290 X:155354247-155354269 CAGAGCTCCCGGAGGGAGGGAGG + Intergenic
1200350180 X:155486980-155487002 CAGAGCTCCCGGAGGGAGGGAGG - Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic