ID: 1150133608

View in Genome Browser
Species Human (GRCh38)
Location 17:62682184-62682206
Sequence CCTGCCCTGCTCTGCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 4, 2: 19, 3: 86, 4: 665}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150133598_1150133608 23 Left 1150133598 17:62682138-62682160 CCAGACTCCTCTCAGGGCATGAG 0: 1
1: 0
2: 0
3: 21
4: 179
Right 1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG 0: 1
1: 4
2: 19
3: 86
4: 665
1150133597_1150133608 24 Left 1150133597 17:62682137-62682159 CCCAGACTCCTCTCAGGGCATGA 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG 0: 1
1: 4
2: 19
3: 86
4: 665
1150133594_1150133608 30 Left 1150133594 17:62682131-62682153 CCTCTGCCCAGACTCCTCTCAGG 0: 1
1: 0
2: 3
3: 40
4: 411
Right 1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG 0: 1
1: 4
2: 19
3: 86
4: 665
1150133600_1150133608 16 Left 1150133600 17:62682145-62682167 CCTCTCAGGGCATGAGGCTGAGT 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG 0: 1
1: 4
2: 19
3: 86
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150133608 Original CRISPR CCTGCCCTGCTCTGCCCTGG GGG Intronic
900363258 1:2300078-2300100 CCTGCCCTGCCCTGGCAGGGGGG + Intronic
900404519 1:2486551-2486573 CCTGCCTGGCTCTGCCAAGGGGG + Intronic
900416450 1:2537392-2537414 TCTGCCCTGCCCTGCCCAGTAGG + Intergenic
900478913 1:2888945-2888967 CCCACCGTCCTCTGCCCTGGAGG + Intergenic
900482254 1:2905013-2905035 CCCGCCCTGCCCTGCCCGGCCGG + Intergenic
900690740 1:3978821-3978843 CCTCCCCTGCTCTGTCTTAGCGG - Intergenic
900719696 1:4167309-4167331 CCACCCCGGCTCTGCCCTTGAGG + Intergenic
900739461 1:4321966-4321988 CCTGCCCTGCTCTGACCTCCAGG - Intergenic
900902058 1:5523866-5523888 CTTGTCCTGCCCTGCCCTGTTGG + Intergenic
900928826 1:5722981-5723003 GCTGCCCAGCTCTGAGCTGGCGG - Intergenic
901027400 1:6285841-6285863 CCTGCCCTTCTCATGCCTGGCGG - Intronic
901079303 1:6574864-6574886 CATGCCCTTCTCTGCCCAGGTGG + Exonic
901207415 1:7504956-7504978 CCTGCCCAGCTGTGCCCATGAGG - Intronic
901207428 1:7505039-7505061 CCTGCCCAGCTGTGCCCATGAGG - Intronic
901209939 1:7518979-7519001 ACTGCCTTGCTCTCCCCAGGAGG - Intronic
901757557 1:11450622-11450644 CCTGCTCAGCTGTGCCCTGGAGG - Intergenic
901773169 1:11541357-11541379 ACTGACTTGCTCTGCCCTGGAGG + Intergenic
901807628 1:11748308-11748330 CATGCCCTGCTGTGTCCTTGGGG - Intronic
901989091 1:13097884-13097906 CTTGGCCATCTCTGCCCTGGAGG - Intergenic
901992722 1:13128883-13128905 CTTGGCCATCTCTGCCCTGGAGG + Intergenic
902282460 1:15384437-15384459 CCTGGCCTGCCAAGCCCTGGGGG - Intronic
902391478 1:16109626-16109648 CCTACCCTGCTCCACCCAGGGGG + Intergenic
902392255 1:16113423-16113445 CCTGCCCTGGGCTGAGCTGGTGG + Intergenic
902399721 1:16151250-16151272 CCTGGCCTGCTCTGCCCAGCTGG - Intronic
902478014 1:16698276-16698298 CCTGCCCTGCCCAGCCCTCAGGG - Intergenic
902531898 1:17096003-17096025 CCTGCCCTGCCCTGCCTGGCAGG - Intronic
903006711 1:20303504-20303526 CCTTCCCAGCTCAGACCTGGAGG + Intronic
903665711 1:25006301-25006323 CCTGCCCTGCCGTGCTCTGAGGG - Intergenic
904535290 1:31195447-31195469 CCTGCCCTGCCCTGCCGCCGCGG + Intronic
904575709 1:31503917-31503939 CCTGCCCTTCCCTGCCCTGCAGG + Intergenic
904636289 1:31884124-31884146 CCTGCCCTGCAAAGCCCTGTAGG - Intergenic
905136497 1:35804580-35804602 CATGCCCTACCCTGTCCTGGAGG + Intergenic
905172334 1:36116517-36116539 CCTGCCCTGCCTTGCCCTGAAGG + Intronic
905207759 1:36352638-36352660 CTTGCCCTGCTATGCTCTGCAGG - Intronic
905225849 1:36478727-36478749 CATGCCCTGCACTACCTTGGAGG + Intronic
905343517 1:37295546-37295568 CCTGCCCTGCTCTCCTCTTTTGG - Intergenic
905382675 1:37574327-37574349 CCCACCCTGCTCTTACCTGGGGG + Exonic
905451590 1:38060394-38060416 CCTGCCCTGGGCAGCCCCGGGGG - Intergenic
905790121 1:40785053-40785075 CCTGCCCTGCCCTACCCTGCCGG + Intronic
905873090 1:41416130-41416152 CCCGCCCCACTCAGCCCTGGTGG - Intergenic
906102259 1:43271141-43271163 TCTGCCCTGTCCTGCCTTGGAGG + Intronic
906204798 1:43981060-43981082 CCTGTCCTGCCCTGACCTGCTGG + Intronic
906246985 1:44283185-44283207 CATGCCTAGCTCTGCCTTGGGGG + Intronic
906251232 1:44312408-44312430 CCCACCCTCCTCTGGCCTGGAGG - Intronic
906674141 1:47681123-47681145 CCTGCCCTGCCCTGGGCTGAAGG + Intergenic
906800624 1:48734040-48734062 CCTGCCCTGCCCTGCCTGGTAGG - Intronic
907043913 1:51288056-51288078 CCTGCCCTGCCCTGCCTTTGGGG - Exonic
907237251 1:53061318-53061340 CCTTACCTGCTCTGGCCTGTGGG - Intergenic
907549992 1:55297186-55297208 CCTGTCCTGCTCTTACTTGGAGG + Intergenic
912379136 1:109237498-109237520 CCTGCCCTGCCCAGCCCGAGAGG - Intronic
912498301 1:110105568-110105590 CCTTCTCTGGTGTGCCCTGGAGG - Intergenic
914362075 1:146944241-146944263 CATGCCCTGCTCTGGGCTAGAGG + Intronic
914489551 1:148142714-148142736 CATGCCCTGCTCTGGGCTAGAGG - Intronic
915367623 1:155324516-155324538 CCTGCCCTGCTAGGGCCTGTAGG - Intronic
915596788 1:156900815-156900837 GGACCCCTGCTCTGCCCTGGGGG - Intronic
916548652 1:165828973-165828995 CCTGCTCTGCTCTCCCCAGCCGG - Intronic
919705362 1:200670089-200670111 CCCGCCCAGCTCTGGGCTGGTGG + Intergenic
919749179 1:201025920-201025942 GCTGCCCTGCTGCTCCCTGGTGG - Intergenic
919762027 1:201103997-201104019 CCTGCCCTGCCCTGCCCTCGAGG + Intronic
919785173 1:201254133-201254155 CCGGGCCTTCTCTACCCTGGGGG - Intergenic
920682577 1:208084204-208084226 CCTGCCCTGCTCTGGCTGAGCGG + Intronic
922238345 1:223737920-223737942 CCTTCCCTGTGCTCCCCTGGGGG - Intronic
922505130 1:226121856-226121878 CCGCCCCTGCTCAGCGCTGGGGG - Intergenic
923086291 1:230705818-230705840 CCTGCCCTGCTCTGCACCCAAGG + Intronic
924234101 1:241986295-241986317 CCTGCCTTGCCCTGTCCTGGGGG - Intergenic
1062829078 10:593461-593483 GCCGCCCTGCTCTGCCCACGCGG + Intronic
1062948173 10:1476354-1476376 TCAGCCCAGCTCTGCCCTGCAGG - Intronic
1063368689 10:5507335-5507357 CTGGACCTGCTCTGGCCTGGAGG - Intergenic
1063464483 10:6233895-6233917 CCGTCCCTGCTCTTCCCAGGTGG + Exonic
1065275736 10:24083861-24083883 CTTGACCTGCTATTCCCTGGTGG - Intronic
1067079757 10:43206260-43206282 CCTGCCCTGCCCTGGAATGGGGG - Intronic
1067095292 10:43295555-43295577 CCTTCCCTGCTCTCCTCTTGAGG - Intergenic
1067166720 10:43871178-43871200 CCTGCCCTGACCTGCCCCTGGGG + Intergenic
1067261818 10:44699668-44699690 TCTGCCCTGCACTGTCCTGTAGG + Intergenic
1067286633 10:44912030-44912052 CATGAGCAGCTCTGCCCTGGAGG + Intronic
1067693450 10:48519231-48519253 AGTGCCCTGCTCTGTCTTGGAGG - Intronic
1067945681 10:50686716-50686738 CAGCCCCTGCTCTGCCCTTGGGG - Intergenic
1069034148 10:63630312-63630334 CCGGCCCAGCTCGGCTCTGGAGG - Intergenic
1069644108 10:69979646-69979668 TCTGTGCTGCACTGCCCTGGAGG + Intergenic
1069715083 10:70515436-70515458 CCAGCCTGGCTCTGCCCTGCTGG + Intronic
1069744406 10:70706073-70706095 TGGGCCCTGCTCTGCCCTGAGGG + Intronic
1069747365 10:70724335-70724357 ACTGCTCTGTTCTGCCCTGTGGG + Intronic
1069899542 10:71699527-71699549 CCTGCACTGGTGTGCGCTGGCGG + Intronic
1070306070 10:75239920-75239942 CCTGCCCTGCTCAGTCCCGGGGG - Intergenic
1070867194 10:79713589-79713611 CAGCCCCTGCTCTGCCCTTGGGG - Intronic
1070880986 10:79851713-79851735 CAGCCCCTGCTCTGCCCTTGGGG - Intergenic
1071546691 10:86535157-86535179 CCTGCCCTCCACTCACCTGGTGG - Intergenic
1071634109 10:87235813-87235835 CAGCCCCTGCTCTGCCCTTGGGG - Intronic
1071647557 10:87368030-87368052 CAGCCCCTGCTCTGCCCTTGGGG - Intronic
1073288860 10:102403509-102403531 CCTGCCATCTTCTGCCCTGCTGG - Intronic
1073454777 10:103629869-103629891 CCTCCCCTCCTCTCCCCAGGGGG - Intronic
1073559301 10:104483099-104483121 GCAGCCCTGGTCTTCCCTGGAGG - Intergenic
1074704000 10:116115491-116115513 CCAGCCCTGCCCTGCCCTCCAGG + Intronic
1075079239 10:119371624-119371646 CCTGCCCTGCCCTGCCCTCCCGG + Intronic
1075645978 10:124096459-124096481 CCTGCTTTCCTCTGCTCTGGTGG + Intergenic
1076169855 10:128309944-128309966 CCTGCCCTCCTGTCCCCAGGTGG - Intergenic
1076206877 10:128610769-128610791 CCTGCCCTGGTCTGCCCTGCAGG + Intergenic
1076337455 10:129717934-129717956 CCTGCCTTGCTCTGGTCTGCGGG + Intronic
1076367146 10:129928728-129928750 CCTGGCCTTCTCTGACCTAGTGG - Intronic
1076507432 10:130987400-130987422 CCAGCACTGCTCTGTCCTTGCGG + Intergenic
1076529655 10:131135976-131135998 GCTGGACTGCTGTGCCCTGGGGG + Intronic
1076562438 10:131375983-131376005 CCTCCCTTGCTGTCCCCTGGGGG + Intergenic
1076683671 10:132187338-132187360 CCGGCCCTGCCCGGCCCTGCCGG + Intronic
1076713810 10:132353279-132353301 CCTTCCCTGGTCTGTCCTGTGGG + Intronic
1076791577 10:132779508-132779530 GCTGCCCTGCTCTGAGCTGGTGG - Intronic
1076798745 10:132811113-132811135 CATGCCCTGCTGCGCCCTTGGGG - Intronic
1076798798 10:132811306-132811328 CCCAGCCTCCTCTGCCCTGGAGG + Intronic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077009042 11:372000-372022 CCTGCCCTGCTCTGGCCATGTGG + Intronic
1077244762 11:1531148-1531170 CCTGAGCAGCTCTGCTCTGGTGG - Intergenic
1077339467 11:2019599-2019621 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1077376846 11:2209272-2209294 CCTGCCCTGCTCTGACAGGGTGG - Intergenic
1077487693 11:2846591-2846613 CCTGCCCTAGTCTGCCCCTGGGG + Intronic
1077509319 11:2947967-2947989 CCTGCCCTTCTCTTCCAGGGAGG + Intronic
1078085520 11:8231151-8231173 CCTCACCTGCCCTGGCCTGGGGG + Intronic
1078101066 11:8330619-8330641 CGTGCCCTGCTCTGCCGAGCTGG + Intergenic
1078489945 11:11759421-11759443 CCTCCACTGCTCTGCCTTGCAGG + Intergenic
1079139284 11:17797008-17797030 CCTGCCCTTTTCTTACCTGGTGG - Intronic
1079240854 11:18721298-18721320 CCTGCTCTGCTCTGCCCCGGGGG + Intronic
1079379638 11:19926539-19926561 CCTGCCCTTCTGTGGTCTGGTGG + Intronic
1080204446 11:29712878-29712900 CCAGCCCTGCCCTGCCCTGCAGG - Intergenic
1080442704 11:32310110-32310132 TCTGCTCTGCTCAGACCTGGGGG - Intergenic
1080697740 11:34617731-34617753 GATGCCGTGTTCTGCCCTGGAGG + Intergenic
1081527094 11:43934725-43934747 CCTCCTCTGCTTTTCCCTGGGGG - Intronic
1081625289 11:44651844-44651866 CCTGCTCTGCCCAGCCCTGGTGG + Intergenic
1081813567 11:45926618-45926640 CCTGCCCCTCTCTGCTTTGGTGG + Intronic
1082009077 11:47438243-47438265 CAGCCCCTGCTCTGCCCTGGAGG - Intronic
1082825922 11:57578797-57578819 CCAGCCAAGCTCTGCCCTGAGGG - Intergenic
1082950026 11:58804823-58804845 CCTGCCCTGAGAAGCCCTGGAGG + Intergenic
1083223493 11:61268875-61268897 CCTGAGATGCCCTGCCCTGGGGG + Intronic
1083320810 11:61845342-61845364 GCTGCCGTGCTCTGCCTGGGAGG - Intronic
1083609661 11:63998901-63998923 CCTGCCCCGGTCCACCCTGGGGG - Intronic
1083628208 11:64082671-64082693 CCTGTCCTGCTCCACCCTGCAGG + Intronic
1083771822 11:64871790-64871812 GCTGCCCTGCTCTGCCTGTGTGG - Intronic
1083846956 11:65340990-65341012 CCTACCCTGCCCGGCGCTGGCGG + Exonic
1083945399 11:65920201-65920223 CCTGCCCTGCTTTACTCAGGTGG - Intronic
1083962068 11:66020234-66020256 CCAGGCCTGCTCAACCCTGGAGG + Intronic
1084093453 11:66894497-66894519 CCTCTCCTGTTCTGCCCTTGGGG - Intronic
1084273570 11:68041011-68041033 CCTGGCTTGCTCTGCCCATGGGG - Intronic
1084274568 11:68044793-68044815 TCAGCCCTGCTCTGCCCTGGTGG - Intronic
1084368422 11:68719134-68719156 CCTGGCCTGGCCTGCCATGGAGG - Intronic
1084516539 11:69640860-69640882 CCTGCACCCCTCTTCCCTGGCGG + Intergenic
1084526336 11:69700764-69700786 CCTGGCCTGGCCTGGCCTGGGGG - Intronic
1084547823 11:69823118-69823140 CCTCCCCTTTTCTGCCCTAGTGG + Intergenic
1084563305 11:69916009-69916031 CCTGCCCTGCTCCTCCCTGCTGG - Intergenic
1084893991 11:72251924-72251946 CCAGCCCTCCTCTCCTCTGGGGG + Intergenic
1085528051 11:77175478-77175500 CCTTCCCTGGGCTGCCCTGGGGG + Intronic
1085759159 11:79226979-79227001 CCTGCTCTGCTGTGCTCTGCAGG + Intronic
1088592504 11:111415650-111415672 CCCTCCCAGCTCTGCTCTGGAGG - Intronic
1089057016 11:115593876-115593898 CCTTCTCTGCTCTGTCCTGCGGG + Intergenic
1089138879 11:116270777-116270799 CCTGCCCAGCTCTGCCAGGAGGG - Intergenic
1089152305 11:116373523-116373545 CCTGACCTCCTCTGTCTTGGCGG + Intergenic
1089249128 11:117144750-117144772 CCTGCCCTGCCCTGCCCTGCCGG + Intronic
1090330874 11:125931304-125931326 CCTGAGCTGCTCTGCACTGCTGG + Intergenic
1090635082 11:128686088-128686110 GCTGCGCTGCTCTTCCCTGCTGG - Intergenic
1091054544 11:132405941-132405963 CCTTCCCTGAGCTGCACTGGTGG + Intergenic
1091320598 11:134646735-134646757 CCTGTCCTGCTCTGCCAGGCAGG + Intergenic
1202822452 11_KI270721v1_random:74788-74810 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1091772747 12:3163814-3163836 AATCCCTTGCTCTGCCCTGGAGG + Intronic
1091801287 12:3326311-3326333 CCTGCCCTCCTCTTCCCAGTTGG + Intergenic
1092125979 12:6075300-6075322 CCTGCCCCGTCCTGCCCTGCCGG - Intronic
1092263066 12:6962760-6962782 CCTGCCCTTCACAGGCCTGGCGG + Intergenic
1094493859 12:30977421-30977443 GCTGCCCTGCTGTGGCCAGGTGG + Intronic
1095573898 12:43712814-43712836 CCTGCCCTGCTAAGCACTGGTGG + Intergenic
1095971608 12:47905396-47905418 CCTGGCCTGGTCAGCCCAGGTGG - Intronic
1095977407 12:47949240-47949262 CCTGACCTGCTCTTGCCTGATGG - Intergenic
1096104186 12:48986901-48986923 GCTGCCCGGCTCTGCTGTGGCGG + Intergenic
1096591221 12:52660370-52660392 CCTGCCCTGCTCTACCCTGGTGG + Intergenic
1096782587 12:53999741-53999763 CGCGCCCAGCTCGGCCCTGGGGG + Intronic
1096872472 12:54602093-54602115 CCTTCCCACCTCTTCCCTGGGGG + Intergenic
1100433155 12:94548248-94548270 CCAGGCCTGCGCTGCCATGGGGG - Intergenic
1102077688 12:110073163-110073185 CCTGCCCTGCTCTCCCTGGCGGG + Intronic
1102876963 12:116456531-116456553 CCTCCCAGGCTCTGTCCTGGTGG + Intergenic
1103400525 12:120640529-120640551 CTTGCCCCGCCCCGCCCTGGGGG - Intergenic
1103564068 12:121806652-121806674 CCGGCTCTGCTCTTCCCCGGCGG - Intronic
1103861801 12:124021225-124021247 TCTGCCCTGCCCTGTGCTGGTGG - Intronic
1104855569 12:131900878-131900900 CCTGGCCTGGTCTGGCCGGGGGG + Intronic
1105817992 13:24054017-24054039 CCTGGACAGCTCTGCCCTGCGGG + Intronic
1105854270 13:24361119-24361141 CACTCCCTGCTGTGCCCTGGGGG - Intergenic
1106420099 13:29578859-29578881 CCTGCCCTTCTCTCCGCAGGCGG + Intronic
1106518704 13:30477580-30477602 ACTGCCTTGCTCTGCCAGGGAGG + Intronic
1106592666 13:31110766-31110788 CCCGGCCAGCTCTGCCCTGTGGG - Intergenic
1106923393 13:34588577-34588599 CCTGCCCTGCCCACGCCTGGCGG - Intergenic
1107889924 13:44905306-44905328 CCTGGTCTGCTCCTCCCTGGGGG + Intergenic
1110367363 13:74701812-74701834 CCTGCCCTGCCCCGTCCTGTCGG + Intergenic
1111950497 13:94705566-94705588 GGTTCCCTGCGCTGCCCTGGAGG - Intergenic
1112048422 13:95620997-95621019 CAGGCCCTGCTCTGCACGGGAGG + Intronic
1113311539 13:109138004-109138026 CCTGCCCTCCTCTACCCTAGTGG - Intronic
1113522445 13:110950447-110950469 CCTCCTCTGCTCAGCCCTAGAGG - Intergenic
1113594217 13:111519973-111519995 CCTGCCCAGCTCAGAGCTGGCGG + Intergenic
1113770115 13:112902852-112902874 CCTGCCCAGCTCTCACCTCGGGG - Intronic
1113772266 13:112917706-112917728 CCTGTTCAGCTCTGACCTGGAGG + Intronic
1113834063 13:113317245-113317267 AGTGCCCTGCGCTGCCCGGGGGG - Intronic
1113928641 13:113954692-113954714 CCTCCCCTGCTGTGCCCCAGGGG + Intergenic
1114534230 14:23412820-23412842 CTTGATCTGCTCAGCCCTGGAGG - Exonic
1114674433 14:24430978-24431000 CCTGCTCTCCTCCGCCCTGGGGG - Intronic
1116618471 14:47168135-47168157 CCTTCCCTTCTCTGCCATGAAGG + Intronic
1117892102 14:60435707-60435729 CCTGCCCCGCTCTCCCCAGAAGG - Intronic
1117997485 14:61491525-61491547 CATGCCTTGCTGTGCCATGGTGG + Intronic
1118155557 14:63237944-63237966 CCCACCCTGCTCTGTCCTGCTGG + Intronic
1118388815 14:65279747-65279769 CCTGGCCTGGACTGCCCCGGCGG + Intergenic
1118589857 14:67393117-67393139 ACTGCCCAGCCCGGCCCTGGGGG + Intronic
1118617388 14:67583765-67583787 CCTGCCCTGCCAGGCCCTGGAGG + Exonic
1119229644 14:72970138-72970160 CCTTCCTTGCTGTTCCCTGGGGG + Exonic
1119684996 14:76624372-76624394 CCAGCCCAGCTCTGGGCTGGTGG + Intergenic
1119837069 14:77760167-77760189 GGTGCCTTGCTCTGTCCTGGGGG - Intronic
1121017754 14:90558693-90558715 CCAGCGCTCCTCTGCCCTGCCGG + Intronic
1121328794 14:93036787-93036809 CCTTCTCTGCTCTGCTCTGGGGG - Intronic
1121343129 14:93116471-93116493 CCTACCCTGCCCTGCCCTATGGG + Intergenic
1121867058 14:97372437-97372459 CCTGCTCTCCTCTGCCCAGTTGG + Intergenic
1122063718 14:99157472-99157494 GCTGCTCTGCTGGGCCCTGGAGG - Intergenic
1122139388 14:99653298-99653320 CCTGCCTCGCTCTGGCCTGAAGG + Intronic
1122229294 14:100297565-100297587 CCTGGGCTGCTCTGGCCTGGGGG + Intronic
1122807051 14:104265008-104265030 CCGGGGCTGCACTGCCCTGGTGG - Intergenic
1122987732 14:105220245-105220267 CGTCCCCTCCTCTGCACTGGTGG + Intronic
1123060581 14:105592456-105592478 CCTGTCCAGCACTGCCCAGGTGG + Intergenic
1123085059 14:105713427-105713449 CCTGTCCAGCGCTGCCCAGGTGG + Intergenic
1123112526 14:105880030-105880052 GCTGCCCTGCTCTCCCTGGGAGG - Intergenic
1202851628 14_GL000225v1_random:23728-23750 TCTGGCCAGCTCTTCCCTGGTGG - Intergenic
1202853585 14_GL000225v1_random:36725-36747 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202854687 14_GL000225v1_random:43166-43188 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202857099 14_GL000225v1_random:58457-58479 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202858269 14_GL000225v1_random:64556-64578 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202859580 14_GL000225v1_random:72842-72864 GCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202862250 14_GL000225v1_random:90132-90154 TCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202918069 14_KI270723v1_random:3298-3320 CCTCCCCTGCCCTGCCCCTGTGG + Intergenic
1202921901 14_KI270723v1_random:35033-35055 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
1202923014 14_KI270724v1_random:2548-2570 TCTGGCCAGCTCTTCCCTGGCGG + Intergenic
1202926556 14_KI270724v1_random:31288-31310 CCTCCCCTGCCCTGCCCCTGTGG - Intergenic
1123477292 15:20598842-20598864 CCTGCTCTGCCCTTCCCTAGAGG + Intergenic
1123640721 15:22401522-22401544 CCTGCTCTGCCCTTCCCTAGAGG - Intergenic
1124418063 15:29490868-29490890 CCTGCTCTCCTCAGCCCTTGGGG + Intronic
1124632681 15:31346479-31346501 CCTGCCTGGCTGTGGCCTGGGGG - Intronic
1125267901 15:37904768-37904790 CCTTCCCTCCTCTGTCCTGGAGG + Intergenic
1125421953 15:39512794-39512816 CCTGCTCTGCTGTTCCCTGAAGG - Intergenic
1125519208 15:40338926-40338948 CCTGCCCAGCACTGCCCATGTGG - Intronic
1125886967 15:43236433-43236455 GCTTCCCTGCTCTATCCTGGGGG + Intronic
1126860007 15:52874236-52874258 CTTGCCCTCCTCTTCCCTTGTGG + Intergenic
1127046197 15:55028148-55028170 TCAGCCCTGCTGTGCCCTGTAGG + Intergenic
1127345696 15:58095676-58095698 CCTGCCCTGCTCTGACAGGAAGG + Intronic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1128315117 15:66655135-66655157 CCGGCCCGGCTCCGCGCTGGCGG + Intronic
1128978180 15:72168160-72168182 CCTGCTCTGCTCTGCCCCAAGGG + Intronic
1129190038 15:73931760-73931782 CCTGCCCACCTCTGCCCTCCAGG + Intronic
1129198246 15:73983637-73983659 CCAGGCCTGCCCTGCCCTGCTGG - Exonic
1129454735 15:75670605-75670627 GCTGCCCTGCTCCTCCATGGGGG + Intergenic
1129457682 15:75684295-75684317 CCTTCCCTGCACTGTCCTGCTGG + Intronic
1129858292 15:78840810-78840832 CCAGTCCTGCCCTGCCCTGCTGG + Intronic
1129968532 15:79757797-79757819 CCTTCCTTGCTGTCCCCTGGGGG + Intergenic
1130516677 15:84631190-84631212 CTCGCCCTGCGCGGCCCTGGTGG - Intergenic
1130751426 15:86717149-86717171 CCTGCCCTTCGCTTCCCTTGTGG - Intronic
1130881216 15:88057683-88057705 AGTGCCCTGCTCTGCCCCTGGGG + Intronic
1131033657 15:89206977-89206999 CCTGCCCAGCTTGTCCCTGGAGG + Intergenic
1131121030 15:89823524-89823546 CCTGCCCTGCCCTGCCCTGGGGG - Intergenic
1131258083 15:90874390-90874412 CCTGCCCTGCCTGGGCCTGGAGG - Intronic
1131467450 15:92667258-92667280 CCTGCTTAGCTCTGCCCTGCTGG - Intronic
1132141740 15:99402696-99402718 TGTGCCCTGCTCCGCACTGGGGG - Intergenic
1132390738 15:101436528-101436550 CCTCCCTTGATATGCCCTGGTGG - Intronic
1132581830 16:688262-688284 CCTCCCCTGCAGGGCCCTGGAGG - Intronic
1132867860 16:2102777-2102799 CCTGCCCTGCCCTGCCAGGCTGG + Intronic
1132981430 16:2740317-2740339 CCTGCTCTGCTGTCCCCTGCAGG - Intergenic
1133008522 16:2897677-2897699 CATGCCCTGCTGTCCCCTGCAGG + Intronic
1134523914 16:14930337-14930359 CCTGCCCTGCCCTGCCAGGCCGG - Intronic
1134548990 16:15130598-15130620 CCTGCCCTGCCCTGCCAGGCCGG + Intronic
1134711505 16:16328822-16328844 CCTGCCCTGCCCTGCCAGGCCGG - Intergenic
1134719356 16:16372121-16372143 CCTGCCCTGCCCTGCCAGGCCGG - Intergenic
1134797463 16:17054348-17054370 CCTGCTCTCTTCTGGCCTGGTGG + Intergenic
1134948070 16:18339764-18339786 CCTGCCCTGCCCTGCCAGGCCGG + Intergenic
1134955324 16:18379871-18379893 CCTGCCCTGCCCTGCCAGGCCGG + Intergenic
1136398384 16:30005127-30005149 CCTCCCCAGAGCTGCCCTGGGGG + Intronic
1136576305 16:31127365-31127387 CCTGCCCAGCTCGGCCCGGCCGG - Intronic
1137004030 16:35255740-35255762 TCTCCCCTGCTCTGCCCCTGGGG + Intergenic
1137600056 16:49750363-49750385 CCTGCATTCCTCTGTCCTGGGGG + Intronic
1137765665 16:50975804-50975826 CCTGCCCTGCGGTGCCCATGTGG - Intergenic
1138577963 16:57920598-57920620 GCTGCACAGCTCTGGCCTGGGGG - Intronic
1138654351 16:58482142-58482164 CCTAGCCAGCTCTACCCTGGGGG - Intronic
1139442203 16:66973959-66973981 CCTGTCCTGCTGTGTCTTGGTGG - Exonic
1139466342 16:67155992-67156014 CTCGCCCTCCTCTGCCCTGCTGG - Intronic
1139852740 16:69960780-69960802 CCTGCCCTTTCCTGCCCTGCCGG - Intronic
1139881711 16:70183688-70183710 CCTGCCCTTTCCTGCCCTGCCGG - Intronic
1140258114 16:73354456-73354478 ACTGCCCAGCTCTGTGCTGGGGG + Intergenic
1140370797 16:74411818-74411840 CCTGCCCTTTCCTGCCCTGCCGG + Intronic
1141153322 16:81579612-81579634 CCAGCCCTGCTCCCCCCTGAAGG + Intronic
1141164305 16:81650271-81650293 CCTGGCCTCCTCTGCTCTGCTGG + Intronic
1141388464 16:83644852-83644874 CCTGCCTTGCTGTGCCTTAGAGG - Intronic
1141557033 16:84843054-84843076 CCTGCTCTGGGCTGCCCGGGCGG - Intronic
1141561146 16:84868474-84868496 CCTGCCCTGCAGAGCCCTGTGGG + Intronic
1141700265 16:85639120-85639142 CTGACCCTGTTCTGCCCTGGTGG + Intronic
1141822665 16:86457754-86457776 CCTGCCCTGCTCTGACTAAGTGG + Intergenic
1142070286 16:88088076-88088098 CCCGCCCTGCTCTGCTCTTTGGG - Intronic
1142239317 16:88938019-88938041 CCTGCCCTGCTGTGCAGGGGAGG - Intronic
1142373056 16:89693616-89693638 ACAGCCCTGCTGTGTCCTGGAGG - Intronic
1142885960 17:2912218-2912240 CCAGCCCAGCTCTGCCCAGAGGG - Intronic
1143773815 17:9185122-9185144 CCTGCGCTGCCCTACTCTGGGGG + Intronic
1144178357 17:12729855-12729877 CCTGCCCTGCGTTGCTCTTGAGG - Intronic
1144454743 17:15409395-15409417 CCTGCCCTGCCCTACGCAGGGGG - Intergenic
1144493309 17:15732502-15732524 CCTGTTCTGCACTGACCTGGTGG + Intronic
1144666487 17:17105593-17105615 CCTGCCCTCCTCTGCCTCAGTGG - Intronic
1144732754 17:17537949-17537971 TCTGCCCTGATCTTCCCTGGAGG - Intronic
1144906952 17:18644150-18644172 CCTGTTCTGCACTGACCTGGTGG - Intronic
1145052838 17:19677107-19677129 CCTGCCCTGCTCTGTCCAGCAGG - Exonic
1145907050 17:28521926-28521948 GCTGCCCTGCTCTGGCTTGAGGG + Intronic
1145924199 17:28633627-28633649 CCAGCCCACCTTTGCCCTGGTGG - Exonic
1145975489 17:28981607-28981629 ACTGCCATGCTGGGCCCTGGAGG + Exonic
1146653846 17:34623559-34623581 CCTGCCCTGGGCTGCTCTGCAGG + Intronic
1148049145 17:44760631-44760653 CCTGCCCTCTGCTGCCCTGTTGG - Intronic
1148203352 17:45764385-45764407 CCAGCTCTGCTCTGCCTTGAGGG + Intergenic
1148675552 17:49442748-49442770 TATGATCTGCTCTGCCCTGGGGG + Intronic
1148845194 17:50525945-50525967 CCTGGCCTCCTCAGCCTTGGCGG - Exonic
1148875362 17:50683930-50683952 CCTTCCCTTCTCCGCCCAGGTGG + Exonic
1148910665 17:50940676-50940698 CCCGGCCTGCTCTGCCCAGCAGG + Intergenic
1149603725 17:57910276-57910298 CCTCCCCTGCTCAGCCCATGGGG + Intronic
1150133608 17:62682184-62682206 CCTGCCCTGCTCTGCCCTGGGGG + Intronic
1150284664 17:63948126-63948148 CCTGCCCTGCTCTATGCTGCTGG + Intronic
1151408038 17:73902215-73902237 CCCGCCCCGCTCCGCCCTGCTGG + Intergenic
1151489581 17:74424896-74424918 CTGGCCCTGCCCTGCCCTGCTGG + Intronic
1151756743 17:76079586-76079608 CCTGCCCAGCTCAGCACTTGGGG - Intronic
1151785451 17:76272838-76272860 CCTGCCCCGCTTTGCCCACGCGG + Intergenic
1151882625 17:76904352-76904374 TCTGCCCCCCGCTGCCCTGGAGG + Exonic
1151890004 17:76946298-76946320 CCTGCCATGCTCGGCATTGGGGG - Intronic
1151947876 17:77329394-77329416 ACTGCCCTGTGCTGCCCTGGTGG + Intronic
1151952370 17:77362203-77362225 CCTGCCCTGCCCTGCCCTTTGGG + Intronic
1152431092 17:80248616-80248638 CCTGTCCTTCCCTGCCATGGAGG + Exonic
1152544261 17:80992663-80992685 CCGGCCCGGCTGTGCCCCGGGGG - Intronic
1152762306 17:82115188-82115210 ACTGCCCTGCTCGGCCCCAGTGG - Intronic
1153313772 18:3702490-3702512 CCTGCCAGGCTCTCCCCTAGGGG - Intronic
1154327969 18:13405813-13405835 CCTGTCCTGCTCTGAGCTGAGGG + Intronic
1155235086 18:23810979-23811001 CCTGCCCTCCTCTGGCCTTCTGG + Intronic
1155517544 18:26638648-26638670 CCTGCCCTTTGCTGCCCTGCCGG - Intronic
1156290702 18:35747085-35747107 CTTGCCCTGCCCTGCCCTGGAGG + Intergenic
1156401013 18:36740730-36740752 ACTGCTCTGCACTGCCCAGGGGG - Exonic
1156522821 18:37736048-37736070 CCTGCACTTTTCTGCACTGGTGG - Intergenic
1157600817 18:48892222-48892244 CCTGCTCTGCTGGGCCCTGATGG - Intergenic
1158025856 18:52896831-52896853 CCTACCCAGCTTTCCCCTGGAGG - Intronic
1158333890 18:56393854-56393876 CCTGCCATGCTCTGCCTTCCTGG - Intergenic
1158440263 18:57468972-57468994 ACTTCCCTGCTCTGAACTGGTGG - Intronic
1158443550 18:57499153-57499175 CCTGTTCTGCTCTTCCCTGTGGG - Intergenic
1159922344 18:74237457-74237479 CTGGCCTTCCTCTGCCCTGGGGG + Intergenic
1160066784 18:75583100-75583122 CGTGCCCGGCACTGCCCTGGTGG - Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1160345704 18:78130018-78130040 CCTGCCCTGTTCTGTCCCGAGGG - Intergenic
1160455383 18:78995456-78995478 CCTGCCATGCTCTTACCTTGAGG - Exonic
1160580227 18:79879444-79879466 ACAGCCCTGCTCTGCCCTCTTGG - Intronic
1160717580 19:583382-583404 CCTCCCCAGCTCACCCCTGGAGG + Exonic
1160987493 19:1845903-1845925 CCAGCCCTGCCCTGGCCAGGTGG + Intronic
1161126630 19:2561443-2561465 ACTGCCCTTCTGTGCCCAGGAGG + Intronic
1161296746 19:3523956-3523978 CCTCCCTGGCTCTGCCCTGTGGG - Intronic
1161514551 19:4689398-4689420 CCTTCCCTGCCCTACCCAGGAGG + Intronic
1161593802 19:5141160-5141182 CCTGCACAGCCCTGCCCAGGTGG - Intronic
1161979839 19:7624621-7624643 CCTGCCCTGCACTGCCAGGGTGG + Intronic
1162064228 19:8115417-8115439 CTGGCTGTGCTCTGCCCTGGGGG + Intronic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1162447284 19:10731167-10731189 CCCTCCCTGATCCGCCCTGGGGG - Intronic
1162460492 19:10811415-10811437 CCTGCCATGCCCTGCACTGGGGG + Intronic
1162737691 19:12755596-12755618 CCTGCCCCGCCCTGCCCAGGTGG + Exonic
1162810615 19:13162725-13162747 TCTGCCCTGCCCTGCCGTGCAGG + Intergenic
1162881804 19:13665379-13665401 CCCTCCCTACTCTGCCCTGATGG - Intergenic
1163267469 19:16229534-16229556 CCTGCCCTGAGCCCCCCTGGTGG - Intronic
1163556710 19:17997420-17997442 CATGCCCAGAGCTGCCCTGGGGG - Intronic
1163917363 19:20252871-20252893 CCTGCCATTCCCTGACCTGGAGG - Intergenic
1164884820 19:31769667-31769689 GCTGCCCTGCACTGCCAAGGTGG + Intergenic
1164932495 19:32186440-32186462 CCTCCCCTGCTCAACCCTGGGGG + Intergenic
1164977102 19:32581436-32581458 GGTCCCCTGCGCTGCCCTGGCGG + Intronic
1165070402 19:33252010-33252032 ACTGCCCTGCTCTGCCCAGGAGG - Intergenic
1165119280 19:33548745-33548767 TCTACCCTCCTCTGCTCTGGAGG + Intergenic
1165305481 19:35000435-35000457 CCTGCCCTGCCCTGCGCCCGGGG + Exonic
1165322392 19:35094097-35094119 CCTGCCCAGCCCAGCCCAGGTGG - Intergenic
1165346162 19:35249833-35249855 CCTGAACTGCTTTGCCATGGAGG - Intronic
1165722805 19:38091604-38091626 CCTGCCCTGCCACTCCCTGGAGG - Intronic
1165897882 19:39154467-39154489 CTGGCCCAGCTCAGCCCTGGAGG - Intronic
1165918647 19:39277775-39277797 CTTCCCCAGCCCTGCCCTGGCGG + Intergenic
1166094978 19:40532606-40532628 CCTGCCCTGTTCTGCACAGCTGG + Exonic
1166129956 19:40740180-40740202 CCTGCCCTGCTGTGGCCCTGTGG + Exonic
1166359683 19:42247943-42247965 CCTCCCCTGCTGTGACCTTGTGG + Exonic
1166399277 19:42466064-42466086 CCTGCCATGCTCTGCCATGGAGG + Intergenic
1166897456 19:46032840-46032862 CCTGCCCCCTTCTGCCCAGGAGG - Intergenic
1166981218 19:46633383-46633405 TCTGCCCTGCCCTGCCCTCTTGG - Intergenic
1167100773 19:47403257-47403279 CCGTCCCTTCTCTGTCCTGGCGG + Exonic
1167154466 19:47729779-47729801 CTTGCGCTCCTCTGCCCAGGCGG + Intronic
1167357945 19:49015565-49015587 CCTGCACTTCTGTACCCTGGAGG - Exonic
1167380809 19:49136929-49136951 CCCGGCCTGCCCTGCCCTGCCGG + Intronic
1167608938 19:50496870-50496892 CCTGGCCTGGCCTGGCCTGGAGG + Intergenic
1167951444 19:53030942-53030964 CCTTCCCTGTCCTGCCTTGGAGG + Intergenic
1168293586 19:55368795-55368817 CCTGACCCGCTCTCTCCTGGCGG - Exonic
1168723983 19:58570714-58570736 CCTCCCCTGCTCTGACATCGTGG + Intronic
1202712034 1_KI270714v1_random:24103-24125 CCTGCCCTGCCCAGCCCTCAGGG - Intergenic
925022765 2:584926-584948 GCTGGCCTGCCTTGCCCTGGTGG - Intergenic
925877947 2:8328316-8328338 ACTGCCCTGCCCTGCCCTGCAGG + Intergenic
925919711 2:8630654-8630676 CCCACCCGGCTCTGCCCTGGTGG + Intergenic
926060403 2:9801354-9801376 CATGCCTTGCCCCGCCCTGGAGG - Intergenic
926121528 2:10243636-10243658 CCAGCCCTGCTCTGCCTGTGTGG - Intergenic
926232460 2:11014727-11014749 GCTGCCCTGCTCTGCATTTGAGG - Intergenic
927246123 2:20958359-20958381 CCTCCGCAGCTCTGCCCTGTGGG - Intergenic
927468093 2:23351786-23351808 CCTGCCCTCCTCTCCCGGGGAGG + Intergenic
927863880 2:26576663-26576685 CCTGCCCTGCAGCCCCCTGGGGG + Intronic
928453077 2:31396181-31396203 CTTGCTCTGCTCTGCACTGCAGG + Intronic
929005541 2:37389636-37389658 CCTGCCCTGCTTCATCCTGGAGG + Intergenic
929120967 2:38483939-38483961 CCTGCCCTGCTCTTCACTCAAGG - Intergenic
929420415 2:41784504-41784526 CCTGCTCTGTGCTGTCCTGGAGG - Intergenic
929458505 2:42084183-42084205 GCTGCTCTCCTCTGCCCTGGAGG + Intergenic
929501292 2:42493637-42493659 CCTGCCCTCCGCTGGCCCGGGGG + Exonic
929532733 2:42762848-42762870 GCTGCCGCGCTCTGGCCTGGAGG - Exonic
930100728 2:47600960-47600982 TCTGTCCTGCTCTGCCCAGCTGG - Intergenic
930415817 2:51090121-51090143 CCTGCTCTGTTCTGCACTGCAGG + Intergenic
931429672 2:62197831-62197853 ACCGCCCTGCCCTGCCCTGCCGG - Intronic
931457725 2:62425123-62425145 CCTGCCCATCCCTGTCCTGGAGG + Intergenic
931570782 2:63667307-63667329 CCAGCGCTGTTCTGCCCTAGAGG - Intronic
932267626 2:70382001-70382023 ACAGCCCTGCCCTGCCCTTGTGG - Intergenic
932447370 2:71789068-71789090 CCTGCCCTGCCCTGCCCCCCTGG + Intergenic
932493972 2:72137607-72137629 CCTGCCCTGCCCTGCCCCGTGGG + Intronic
932590549 2:73064121-73064143 CAAGGCCTGCTCTTCCCTGGGGG - Intronic
933714350 2:85349353-85349375 CCTGCCCCGCCCTGCCCTTCTGG - Intronic
933776933 2:85776747-85776769 CCTGCCCTGCCCTGCCACTGAGG - Intronic
933990898 2:87633190-87633212 CCTGCCCTTCTCTGCCCCCTGGG - Intergenic
934004651 2:87750810-87750832 CCTGACCTCATCTTCCCTGGAGG + Intronic
934056837 2:88258356-88258378 CAAGCCCTGGGCTGCCCTGGAGG - Intergenic
934852413 2:97709896-97709918 CATGCTGTGCTCTCCCCTGGGGG - Intergenic
935096431 2:99948677-99948699 CTTGTCCTGCTCTGGCCTTGCGG - Intronic
935218721 2:100994181-100994203 CCAGCCCTTCCCTGTCCTGGGGG + Intronic
936302944 2:111317633-111317655 CCTGCCCTTCTCTGCCCCCTGGG + Intergenic
937116191 2:119406647-119406669 CTGGTCCTGCTCTGCCCTGGAGG - Intergenic
937230825 2:120397164-120397186 CCTGCCCTGCCCTGCCCTGGGGG + Intergenic
937299538 2:120830636-120830658 TCTGCCCTCCCCTGCCCTGCTGG - Intronic
937909806 2:127069952-127069974 TCTGCCCTGCTCTGGCCTGGAGG - Intronic
938137228 2:128769563-128769585 CCTGCCCCGCACTGCCCCAGGGG - Intergenic
938451271 2:131423755-131423777 CCCGCCCTGCCCTTCCATGGTGG - Intergenic
938458909 2:131485125-131485147 TCTCCCCTGCTCTGGCCTGGTGG + Intronic
938711708 2:133981059-133981081 CCTGTCTTGCTCTGACATGGAGG - Intergenic
938793767 2:134701465-134701487 CCTCCCCAGCTCTGCCCAGAAGG + Intronic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
940347900 2:152646346-152646368 CCTGCCCTACTCTTTTCTGGGGG - Intronic
940799258 2:158115409-158115431 CATGCTGTGTTCTGCCCTGGGGG - Intronic
945285160 2:208074821-208074843 CCTGCCCTGTTCTGCACTGTGGG + Intergenic
946024084 2:216661460-216661482 CCTGCCCAGCTCTGCCATCTTGG + Intronic
946253743 2:218429145-218429167 CCTGCCCTGCTTTTCCCCGTCGG - Intronic
946446578 2:219745220-219745242 CCTGCCCTCTTCTGCCATGAGGG - Intergenic
947122867 2:226835856-226835878 CCTGCCCCGCTGTGCCCTCGCGG + Intronic
947399214 2:229714882-229714904 CCTGCCCTGCCCGGGCCTTGGGG - Intergenic
947476968 2:230458980-230459002 CCTTACATGCTGTGCCCTGGGGG - Intronic
947551146 2:231047724-231047746 CCTGACCCTCTCTGCTCTGGGGG - Exonic
947612624 2:231533225-231533247 CCTACCCAGCTCTGCTCTGTGGG + Intergenic
947731823 2:232435489-232435511 CCTGCCCCGCTGTGCCCAGTTGG + Intergenic
948005492 2:234604646-234604668 CCTGCTGTGCTCAGCCCTGCAGG - Intergenic
948253680 2:236551048-236551070 CCTGCCTTCCTCAGCCCTGTAGG + Intergenic
948279724 2:236737857-236737879 CCTGCCATGCTCTGACCTTGAGG + Intergenic
948462832 2:238138652-238138674 CCAGCCCTGCCCCGCCCTGCAGG + Intergenic
948489556 2:238303721-238303743 CCTCCCCTCCAATGCCCTGGAGG - Intergenic
948587034 2:239026093-239026115 CCTGCCCGGCTCTGCGCTGGAGG - Intergenic
948601580 2:239110801-239110823 CCTTCCCTCCTCTCCCCTGCAGG + Intronic
948604490 2:239126290-239126312 CCTGCCCAGCTCTGTGCTGTGGG + Intronic
948871556 2:240801740-240801762 CTTGCCCTGCTCTCACGTGGTGG - Intronic
948894727 2:240922790-240922812 CCTGCCCTGCCAGGCCATGGAGG - Intronic
948942333 2:241202786-241202808 CCTCCCCTGCTCGGCCAAGGGGG - Intronic
1168800364 20:640738-640760 GCTGCCCTGGCCTGCCCTTGAGG - Intergenic
1171167003 20:22980907-22980929 TCTGCTCTGCTCTGCCCTGGAGG + Intergenic
1171346269 20:24468995-24469017 CCTGACCAGCTAAGCCCTGGAGG - Intergenic
1172057736 20:32166027-32166049 CCTGCCTTGGGCAGCCCTGGAGG - Exonic
1172060234 20:32182417-32182439 CCTGCCCTGTTCTGTTCTGTTGG - Intergenic
1172274535 20:33672561-33672583 CCTGCCCAGCTCAGCCCTGCAGG + Intronic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1172778784 20:37423465-37423487 CCTGCCCTGTACTGAGCTGGAGG - Intergenic
1173063101 20:39680814-39680836 CTTGTCCTGCTGTGTCCTGGGGG + Intergenic
1173898298 20:46567598-46567620 TCTACCCGTCTCTGCCCTGGAGG - Intronic
1174088225 20:48025413-48025435 CCTGCACTCCTCAGCCCTCGTGG - Intergenic
1174136991 20:48386545-48386567 CCTCTCCAGCTGTGCCCTGGAGG + Intergenic
1174176961 20:48651356-48651378 CTGGCCCTGCCCTACCCTGGGGG - Intronic
1174382325 20:50164072-50164094 CATTCCCTGCCCTGCCTTGGAGG - Intergenic
1174783536 20:53412179-53412201 CCGGTCCTGCTCTGGGCTGGAGG + Intronic
1175220247 20:57412519-57412541 CTTGCTCTGCTCTGCCCTGGTGG + Intergenic
1175284534 20:57829106-57829128 CCTGCCCTGCCCTGCCCCTCAGG - Intergenic
1175304952 20:57969498-57969520 TCTGCCCTGCTGTGCCCTGCAGG + Intergenic
1175378911 20:58549129-58549151 CCTGCCTAGCTCTTCCCTCGTGG + Intergenic
1175489800 20:59372169-59372191 GGAGCCCTGCTCTGCCCTGGAGG + Intergenic
1175492952 20:59391139-59391161 CCAGCCCAGCTCTGCTCAGGAGG - Intergenic
1175567015 20:59988303-59988325 CCTGCCCTGCACTGCACTAGAGG - Intronic
1175756509 20:61533575-61533597 CCTGCCTTCCTCTGCCCATGAGG + Intronic
1175801689 20:61804615-61804637 CCTGCCCAGCTCTCGCCTGGTGG + Intronic
1175851033 20:62093095-62093117 CCTGCCCAGCAGAGCCCTGGGGG + Intergenic
1175907110 20:62386441-62386463 CTTCCCCTGCCCTGCCCTGGGGG + Intergenic
1175951652 20:62586895-62586917 CCTGCACGGCTCTGCCCAGACGG + Intergenic
1176385673 21:6137641-6137663 CCTGCCCTGCCTTGCCCCAGAGG - Intergenic
1177614371 21:23498805-23498827 CCTGGGCAGCTCTGCCCTTGTGG + Intergenic
1178354630 21:31900283-31900305 CCTGCCCTCCTCTGCCCAGCTGG + Intronic
1178623872 21:34199584-34199606 TCTGCACTGCACTGCACTGGCGG + Intergenic
1179008070 21:37531762-37531784 CCTCCCCTCCTCTGCCCTGCGGG - Intergenic
1179189239 21:39108841-39108863 CCTGCCCTCATCTGCCAGGGAGG - Intergenic
1179349611 21:40595542-40595564 CCAGCCAAGCTCTGCCCTGAAGG + Intronic
1179375028 21:40842292-40842314 CCTGCCCTGCTCTGGAGAGGTGG + Intronic
1179474819 21:41636414-41636436 CCTGCCCTACACAGCCCTGTGGG + Intergenic
1179507912 21:41854009-41854031 ACTGCTTAGCTCTGCCCTGGGGG - Intronic
1179644895 21:42769928-42769950 CTTGCCTTGCTGGGCCCTGGGGG + Intronic
1179737800 21:43400611-43400633 CCTGCCCTGCCTTGCCCCAGAGG + Intergenic
1180179637 21:46112157-46112179 CCTGCACTTCTCTGACCAGGTGG + Exonic
1181018557 22:20085840-20085862 CCTGCCGCGCTGTGCGCTGGCGG - Exonic
1181056105 22:20261218-20261240 CCTGTCCTGTCCTGCCCTGGGGG - Intronic
1181644790 22:24225483-24225505 CCCTCCCTCCTCTCCCCTGGTGG + Intronic
1181885525 22:26019111-26019133 CCTACACTGCTCTCCCCAGGAGG + Intronic
1182426045 22:30273368-30273390 CCTGCCTTCGTCTGCCCTGGCGG - Intergenic
1183252206 22:36738079-36738101 CCTGCCATGCCCTGCCCTGCTGG + Intergenic
1183311710 22:37113309-37113331 CCTGCTCTGCCCTGTCCTGCTGG - Intergenic
1183384806 22:37508781-37508803 CCTGACCAGCTCTGCCATGCTGG + Intronic
1183491723 22:38120491-38120513 CCTGCCCGGCTCTGCCCTGCCGG - Intronic
1183520687 22:38294599-38294621 CCTCCCCTTCTGTGCCCTGCAGG - Intronic
1184041003 22:41943609-41943631 CCTGCTCTACTGTGACCTGGAGG - Exonic
1184074595 22:42168346-42168368 CCTGGCCAGCTGTGCCCTGAAGG + Intronic
1184155255 22:42662747-42662769 CCTCCCCTGCCTTGCCCTCGTGG + Intergenic
1184239870 22:43206444-43206466 CCTGCCCTCCTCTGTGCTGTGGG + Intronic
1184319911 22:43733403-43733425 CCTACTCTCCACTGCCCTGGAGG - Intronic
1184453552 22:44596871-44596893 CCTGCCCTGCGCTGCTGTGGTGG - Intergenic
1184669872 22:46006983-46007005 CCTTCTCCGCTCTCCCCTGGGGG + Intergenic
1184696062 22:46139752-46139774 CCTCCCCAGCTGTGCCCTCGTGG - Intergenic
1184834280 22:47011984-47012006 CCCACCCCGCTCTGCCTTGGTGG + Intronic
1184962985 22:47945078-47945100 CCTGCCCCGCCCTCCCCTGAGGG - Intergenic
1185008391 22:48299321-48299343 CCTGCCTGGCTGTGACCTGGGGG - Intergenic
1185243367 22:49759029-49759051 CCTTCCCTGCCCTGCGCTGCTGG - Intergenic
950025272 3:9815882-9815904 TCTGCCCACCTGTGCCCTGGAGG + Intronic
950098791 3:10345033-10345055 CCTGCCTCCCTCTGCCCTCGTGG + Intronic
950460833 3:13121402-13121424 TGTGCCCAGCCCTGCCCTGGTGG - Intergenic
950696651 3:14705964-14705986 TCTACCCTGCTCTGTACTGGAGG - Intronic
950831955 3:15883489-15883511 ACTGCCCTGTTCAGACCTGGAGG - Intergenic
950878261 3:16298499-16298521 CCTGCTCTACTCTGCCCAGTGGG + Intronic
951036460 3:17938320-17938342 CCTGCCCTGCTCTACCAAGGGGG + Intronic
951181396 3:19663337-19663359 CCTTCCCTTCTCTTACCTGGAGG + Intergenic
951436428 3:22670439-22670461 TCTGCGCTGCCCTGCCGTGGTGG - Intergenic
952467549 3:33605924-33605946 TCTGAGCTGCTCTTCCCTGGGGG + Intronic
953182191 3:40606148-40606170 CATGCATTGCTCAGCCCTGGTGG - Intergenic
953366676 3:42351304-42351326 CCTGCCCTCCTCCTCCCTGCTGG - Intergenic
953370306 3:42382018-42382040 CCTGCTCTGTTTTGCCATGGTGG - Intergenic
953404519 3:42653993-42654015 CCTGGGCTGCTCTGACCTGGGGG - Intronic
953666856 3:44931547-44931569 CCCTCACTGCTCAGCCCTGGTGG - Intronic
953906954 3:46873212-46873234 CCTTCCCTTCTCTGCCTGGGTGG - Intronic
953982689 3:47420514-47420536 CCTGCCCTGCCCTCTTCTGGAGG - Intronic
954108142 3:48420076-48420098 CCTTCCCTGCTCAGCCCCTGGGG - Exonic
954364893 3:50140453-50140475 CCTGCCATGGTGTGTCCTGGAGG - Intergenic
954450978 3:50571611-50571633 CCTGCCCAGCACTGGTCTGGAGG - Intronic
954701047 3:52451125-52451147 CCTCCCCAGATCTGTCCTGGGGG - Exonic
954706851 3:52485554-52485576 CCAGCCCTGCTGTGTGCTGGTGG + Intronic
956580044 3:70800461-70800483 CCTGCACTGCTCTTCCCTGCTGG + Intergenic
957084780 3:75669295-75669317 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic
959985826 3:112570162-112570184 CCTTTCCTGATTTGCCCTGGGGG + Intronic
960587692 3:119335476-119335498 CCTGGCCTGCCCTGGCCTAGGGG - Intronic
960848155 3:122023509-122023531 CATGCCCTGCTCTGCTGTGAGGG + Intergenic
961362283 3:126375723-126375745 CCTACCCTGCCCTGCCCTGAGGG + Intergenic
963049535 3:141129194-141129216 CCTGCCCACCTCTGCTGTGGAGG + Intronic
963322828 3:143827998-143828020 CCTGCCCTTCTCTGTCCATGTGG + Intronic
963730063 3:148962659-148962681 CCTCCCCTCCTCTACCCAGGAGG + Intergenic
964385512 3:156143390-156143412 CATGCCCGTCTCTGCTCTGGTGG - Intronic
964790465 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG + Exonic
965474636 3:169140149-169140171 CCTACCCTGCTCTGCCTTTCAGG + Intronic
966852791 3:184175032-184175054 CCTGCCCTGCACTGAGCTGGCGG + Intronic
966925102 3:184639608-184639630 CCTGCCTTTCCCAGCCCTGGAGG - Intronic
967062102 3:185881645-185881667 CCTGTTCTGCTCAGCCCTTGAGG - Intergenic
968449984 4:670959-670981 CCAGCCCTGCACTGCCCTCCTGG - Intergenic
968469697 4:773756-773778 CGAGCCCTGCCCTGCCCTGCAGG - Intergenic
968598156 4:1495928-1495950 GCTGCCCTGCCCTGCCAGGGAGG + Intergenic
968658693 4:1789820-1789842 CCGGCCCAGCCCAGCCCTGGCGG - Intergenic
968723852 4:2229933-2229955 CGTGCCTTGATCTGCCCTGCTGG + Exonic
968935771 4:3609608-3609630 GCTGCCCAGCCCTACCCTGGGGG + Intergenic
969213880 4:5708305-5708327 CCCGCCCCGCTCCGCCCCGGAGG + Exonic
971252062 4:24981234-24981256 CCTGCCAAGCTCTTCCTTGGGGG - Intergenic
974734480 4:65911918-65911940 TCTGCTCTGCATTGCCCTGGTGG + Intergenic
981918932 4:150066059-150066081 CCTGACCGGATCTACCCTGGAGG - Intergenic
982258245 4:153470763-153470785 CCTGACCTGCTCTGTCCTGCAGG + Intronic
983474448 4:168196517-168196539 AGTTCCCTGCTCAGCCCTGGAGG - Intergenic
984744078 4:183196642-183196664 CCTGCCCTGCCTGGCACTGGAGG + Intronic
984840123 4:184060387-184060409 CCTTCCAGGCTCAGCCCTGGGGG + Intergenic
985002898 4:185503415-185503437 CCTGCCCTGCTTTGACCTTTTGG + Intronic
985489694 5:172071-172093 ACGGCCCTGCTCTGCCATTGGGG - Intronic
985689215 5:1297978-1298000 CCTGCCCTGCCCTTGCCCGGAGG + Intergenic
985884853 5:2669988-2670010 CCTGGGCTGCTCTGGCCTGGGGG + Intergenic
986022931 5:3821727-3821749 CCTGCTCACCTGTGCCCTGGGGG + Intergenic
987251815 5:16108233-16108255 CCAGCCCTGCCCAGCTCTGGTGG - Intronic
989113375 5:37928545-37928567 TCTGCCCTTCTCCTCCCTGGGGG - Intergenic
990514895 5:56521800-56521822 GCTGCCATGCCCTGCCCTGCAGG - Intronic
990989982 5:61675133-61675155 ACTTCCCTGCTCTGGGCTGGTGG + Intronic
992590791 5:78294332-78294354 CCTGCCCTGCTCAGACCTCAGGG + Intronic
996576366 5:124980646-124980668 GCACCCCTGCTGTGCCCTGGGGG - Intergenic
997207816 5:132060263-132060285 CCCGCCCTGCTTGGTCCTGGTGG - Intergenic
997309229 5:132866274-132866296 CCTGGCCAGCGCTGCCCCGGAGG + Intronic
997591665 5:135076937-135076959 TCTGCCCCGCTCTGGCCTGCTGG - Intronic
997622491 5:135307858-135307880 ACTGCCCTCCTCTCTCCTGGGGG + Intronic
997697307 5:135871787-135871809 CATGCCCTTCTCAGCCCAGGGGG + Intronic
997749194 5:136328246-136328268 CCTATCCTGCTCTACCCTTGGGG - Intronic
997872817 5:137520185-137520207 CCTCCCCTCCTGTGGCCTGGAGG - Intronic
997899542 5:137753029-137753051 CCTTCCCTGTTTTGCCCTTGGGG - Exonic
998457834 5:142287448-142287470 TCTCCCCAGCTGTGCCCTGGGGG + Intergenic
998581805 5:143384698-143384720 CTTGGACAGCTCTGCCCTGGTGG + Intronic
999128829 5:149267027-149267049 CCTTCCCTGCCCGGCCCTGTAGG + Intergenic
999151444 5:149428902-149428924 GCTGCGCTGCTCCGCTCTGGTGG - Intergenic
999241000 5:150127319-150127341 TCTCCCCTGCCCTGCCCTGCTGG + Intronic
999317760 5:150595365-150595387 CCTTCCCTGTTCTTCCCTGAAGG + Intergenic
999322558 5:150624604-150624626 CCCGCCCCGCCCAGCCCTGGGGG - Intronic
999442629 5:151614384-151614406 TCTGCTGTGCTCTGCCCAGGGGG + Intergenic
999502947 5:152165042-152165064 TGTGCTCTGCTCTCCCCTGGTGG + Intergenic
1000097178 5:157981837-157981859 TCTGCCCTGCTCTTCTTTGGAGG + Intergenic
1000365226 5:160484520-160484542 GCTGCTCTGCTGTTCCCTGGGGG + Intergenic
1000922306 5:167152776-167152798 CCTGCTCTGTCCTGCCCTAGAGG - Intergenic
1000982189 5:167827872-167827894 CTTCCCCTGCTGTGCCCTGTAGG + Intronic
1001474973 5:172044138-172044160 CCTGGCCTCTTCTGCCCAGGTGG - Exonic
1001902590 5:175444226-175444248 CGTCCCCTCCCCTGCCCTGGGGG + Intergenic
1002105136 5:176876327-176876349 CCTGCTCTGCGCTGCCCACGAGG + Intronic
1002784581 6:391888-391910 GGTACCCTGCGCTGCCCTGGAGG - Intronic
1002784898 6:393091-393113 CCCGCTCTGCTCTGCACTGCGGG - Exonic
1002963702 6:1941811-1941833 CCTGCTCTCCTGTGCCCTGGAGG - Intronic
1003014347 6:2455994-2456016 CCTGCCCTGCTCTCTCCAGCAGG - Intergenic
1003078209 6:3000407-3000429 GCTGCCCAGCGCTGCCCTGAAGG + Intronic
1003568877 6:7242948-7242970 CCTGGCCCCCTCTGCCCTTGAGG + Intronic
1004044550 6:12012028-12012050 CGTGCCCTACTCTGCCCCGGGGG + Intronic
1004074908 6:12336230-12336252 TCAGCCAGGCTCTGCCCTGGAGG - Intergenic
1004170571 6:13292750-13292772 CCTGCCATGCACTGCCCTCCTGG + Intronic
1004228869 6:13813832-13813854 CCCGCCCTGCTCGGCCGCGGTGG - Intronic
1005840443 6:29741784-29741806 CCAGCTGTGCACTGCCCTGGTGG + Intergenic
1006379204 6:33687920-33687942 CTTGGCCTGCTCTGGCTTGGCGG + Intronic
1006641831 6:35493377-35493399 CCTGCCTGGCACAGCCCTGGGGG + Intronic
1006793008 6:36715927-36715949 CCGGCCCTGTCCTGCCCTGTAGG + Intronic
1006959778 6:37916849-37916871 TCTGCTCTGTCCTGCCCTGGTGG + Intronic
1007075457 6:39063392-39063414 CCTCCCCTTCTCTGCCGTTGGGG + Intronic
1007282745 6:40724300-40724322 CCTGCCCTTCCCTGCCCCGCTGG + Intergenic
1007303614 6:40887529-40887551 CAGGCCCTGCTCTGCCCCTGTGG + Intergenic
1007352899 6:41287130-41287152 CCTGCCCTGCTCAGCCCCGTGGG + Intergenic
1007411355 6:41663785-41663807 TCTGCCCTGCCCTGCCCTACAGG - Intergenic
1007584244 6:42979005-42979027 CCTGCCGGGCTCTCCCCTGCAGG + Exonic
1009410431 6:63359839-63359861 TCTGCTCTGATCTGGCCTGGTGG + Intergenic
1011625714 6:89281977-89281999 CATGCCCCTCTCTGACCTGGTGG + Intronic
1012279355 6:97310517-97310539 CCTGCTATGCTCTGACCTGATGG + Intergenic
1012947811 6:105486736-105486758 CCGACCCTGCTCCGCTCTGGAGG + Intergenic
1013456580 6:110335022-110335044 CCTGCCTTGTTCTGCCCTGGTGG - Intronic
1013890075 6:115016200-115016222 CCTGCCTTGCTCTGCTTTGAAGG + Intergenic
1013935182 6:115586036-115586058 CTTGGGCTGCTCTGCCCTTGTGG + Intergenic
1015640613 6:135327732-135327754 CCTTCCCCCCTCTACCCTGGAGG + Intronic
1016366247 6:143321656-143321678 CATGCCCTGTTCTGCCCCAGAGG - Intronic
1017760374 6:157563399-157563421 CTTGCCCTGCTCTGACTTGGGGG + Intronic
1017780502 6:157711785-157711807 CAAGTCCTGCTCTTCCCTGGGGG - Intronic
1018735496 6:166684653-166684675 CCTCCTCTGCTCTGCCCCAGAGG + Intronic
1019171718 6:170136648-170136670 CCAGCCCTGCGCGGCACTGGAGG - Intergenic
1019296955 7:282714-282736 CCTGTCCTGCTGAGCGCTGGGGG + Intergenic
1019337395 7:491849-491871 CTTGCCCTGCCCAGCGCTGGGGG - Intergenic
1019446950 7:1076317-1076339 CCTGGCCTGCTCCTCCTTGGCGG - Intronic
1019476324 7:1246434-1246456 CCCGCCCTGCCCGGCGCTGGAGG - Intergenic
1019566831 7:1687079-1687101 CTTGCCCTGCCCTGCCCTGTGGG + Intergenic
1019918949 7:4150698-4150720 CTGGCCCCACTCTGCCCTGGGGG + Intronic
1020586914 7:10079853-10079875 ACTGCTCTGCTCTCCCTTGGAGG + Intergenic
1022008910 7:26292115-26292137 CCTCCCCTGCACCGCCCAGGTGG + Exonic
1022213020 7:28230297-28230319 CCTGCCTTCCTCTGGCCTTGAGG - Intergenic
1022796018 7:33731888-33731910 CAGGCCCTGCTCTGCCCTTGAGG - Intergenic
1022973506 7:35537359-35537381 CCGGCAATGCTCTGCCCCGGGGG - Intergenic
1023968662 7:44976642-44976664 CCTGCCCCACTCTCCCCTGCCGG + Exonic
1023984461 7:45086805-45086827 CCTGCCCACCACTGCCCTTGTGG - Intronic
1024024842 7:45401260-45401282 CCTGCCTTGATCTGCCCAGCTGG - Intergenic
1024025638 7:45408017-45408039 CAGGCCCTGCTCTTGCCTGGTGG + Intergenic
1024093274 7:45965126-45965148 CTTCCCCTGCTCTGCCCTCCTGG + Intergenic
1024383469 7:48725153-48725175 CTTGCCCAGCTCTGCCCCTGTGG + Intergenic
1024544879 7:50508757-50508779 ACTGCCCAGCTGTGCCCTTGTGG - Intronic
1024609604 7:51053365-51053387 CCTGCCCTGTGCTGCCCTCAGGG + Intronic
1025026617 7:55521725-55521747 CCTGCCCTGCCCTGCCCTGTGGG - Intronic
1025227527 7:57178067-57178089 CCTGCTCTGCCCTGCCCTGGGGG - Intergenic
1025730346 7:64102240-64102262 GGGGCCCTGCCCTGCCCTGGGGG + Intronic
1025928955 7:65980090-65980112 CCTGCCCTGCCCTGCCCTGGGGG - Intronic
1026644138 7:72153292-72153314 CCTGCCTCTCTCTGCCCTTGGGG + Intronic
1026903147 7:74048060-74048082 CTCCCCCTGCTCTGCCCTCGGGG - Intronic
1027051555 7:75024556-75024578 CCACCCCGGCCCTGCCCTGGAGG - Intronic
1027180360 7:75935123-75935145 CCTGGGCAGCTCTGTCCTGGTGG - Intronic
1027238146 7:76310279-76310301 CCTGCCCTGCCCAGACCTGCTGG - Intergenic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1028222762 7:88216565-88216587 CCTACTCTGCCCTGACCTGGTGG - Intronic
1028827506 7:95290357-95290379 CCTGCCCTGCTCTCCTCCAGAGG + Exonic
1029420165 7:100468020-100468042 CAGACCCTGCTCTGCCCGGGGGG - Intronic
1030060145 7:105615343-105615365 CCCACCCTGCTCTGGGCTGGAGG + Intronic
1032189921 7:129759036-129759058 CCTCCTCTGCTCTGCCCTTCTGG - Intergenic
1032508266 7:132452150-132452172 CCTCCCCTGCTTTGGCCAGGAGG + Intronic
1032512615 7:132483973-132483995 CCTTCCCTGCACATCCCTGGGGG - Intronic
1032529534 7:132608892-132608914 CCTGCTCTGCCGTGCCCAGGTGG + Intronic
1032804625 7:135341694-135341716 CATCCTATGCTCTGCCCTGGAGG - Intergenic
1033422586 7:141216933-141216955 CCTGTCCCGCTGTGTCCTGGAGG - Intronic
1034093264 7:148383262-148383284 GCAGCCCTGCTCTGCCCTCCTGG - Intronic
1034433793 7:151053599-151053621 CCTCCCTTCCTCTGCCCAGGAGG - Intergenic
1034499417 7:151440194-151440216 CCTGCCCTGCCCTGGAGTGGTGG + Intronic
1035020377 7:155797151-155797173 CCGTCCCCGCGCTGCCCTGGTGG - Intergenic
1035169881 7:157011216-157011238 CCTCCCCTGCTGCGCCCTGGAGG - Intergenic
1035338576 7:158145805-158145827 CTTGTGCTGCCCTGCCCTGGGGG + Intronic
1035396671 7:158539566-158539588 CCTGCTCTCATCTGTCCTGGAGG - Intronic
1035734260 8:1876370-1876392 CCTCCCCGGCCCTGCCCGGGTGG + Intronic
1036562142 8:9906570-9906592 CCTCTCCTCCTCGGCCCTGGCGG + Intergenic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037781575 8:21872791-21872813 AGTCCCCTGCTCTGCCCTTGTGG - Intergenic
1037787567 8:21911864-21911886 GCTGCCCTGCTCTCCCCTGGGGG - Intronic
1037807981 8:22069084-22069106 CTTGCCCTGCCCTGCCCTGAAGG + Intronic
1037936895 8:22921061-22921083 CCCGGCCTGCCCTGCCCTGCAGG - Intronic
1037948873 8:23006092-23006114 CCTGCGCTACGCTGACCTGGAGG + Exonic
1038410845 8:27358175-27358197 ACAGCCCTGTGCTGCCCTGGGGG - Intronic
1039069084 8:33633959-33633981 CCAGCCCTGCCCCGCCCTGCAGG + Intergenic
1039412054 8:37363142-37363164 CCTGTCCAGCTCTGGCCTTGGGG - Intergenic
1040286188 8:46101606-46101628 CCTGCCCTGGAGAGCCCTGGGGG + Intergenic
1040294676 8:46143017-46143039 CCTGCCCTGGACAGCCCTGGGGG + Intergenic
1040296342 8:46151010-46151032 CCTTCCCTGGACTGCCCTGGGGG + Intergenic
1040303523 8:46200377-46200399 CCTGCCCGGGACAGCCCTGGAGG - Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040331297 8:46387115-46387137 CCTGCCCGGGTCAGCCCTGGGGG - Intergenic
1040332258 8:46391644-46391666 CCTGCCCAGGACAGCCCTGGGGG - Intergenic
1040338605 8:46428630-46428652 CCTGCCCGGGACAGCCCTGGGGG - Intergenic
1040934454 8:52768058-52768080 ACTGTTCTGGTCTGCCCTGGAGG - Intergenic
1041043486 8:53869803-53869825 CCTGCCCTGTTCTGCTCAGAGGG - Intronic
1042748663 8:72134488-72134510 CCTCCCCTGTGCTGCCCTGGGGG + Intergenic
1045502953 8:102757259-102757281 CCTGCCCTGCTGGGCTCTGTGGG + Intergenic
1045744080 8:105396363-105396385 CCTGCCTTTCTCTGGCCTGATGG + Intronic
1047735411 8:127760912-127760934 CCATCCTGGCTCTGCCCTGGAGG + Intergenic
1049174987 8:141186782-141186804 CCTGCCCTGCTCATCCCTCCAGG + Intronic
1049276748 8:141723775-141723797 CCTTCCCCGCTCTGCCATGTAGG + Intergenic
1049329628 8:142043305-142043327 CCTGCCTTGCTCTGGGGTGGAGG - Intergenic
1049406460 8:142453757-142453779 CCTGACCAGCTCTGCCAAGGAGG + Intronic
1049426802 8:142541389-142541411 GCCTCCCTGCTCTGCCCTGAGGG - Intronic
1049436648 8:142589238-142589260 CCTGGCCAGCACTGCCCGGGGGG - Intergenic
1049539868 8:143203511-143203533 GCTGCCCTGCCCTGGCCCGGTGG + Intergenic
1049604885 8:143524703-143524725 GCTGCGCTGCGCTGCACTGGTGG + Intronic
1049995939 9:1033683-1033705 ACTGCCCTGGGCTGGCCTGGGGG + Intergenic
1051437728 9:17051141-17051163 CCTGCACAGCACTGACCTGGGGG - Intergenic
1051896440 9:21994342-21994364 GCTGCCGAGCTCGGCCCTGGAGG - Intronic
1052816295 9:33104721-33104743 CCTGGTCTGTTCTGCTCTGGAGG - Intronic
1052985596 9:34484925-34484947 CCTGGCCACCTCTGCCCTGGGGG - Intronic
1053217098 9:36280812-36280834 ACTTCTCTGCTCTGCCCTTGTGG + Intronic
1053424524 9:38002443-38002465 CCTGCCCTGCCTTCCCCTGTAGG - Intronic
1054454414 9:65422270-65422292 GCTGCCCAGCCCTACCCTGGGGG - Intergenic
1055582429 9:77721284-77721306 CCCGCCCTGCCCTTCCCTGGTGG - Exonic
1056457927 9:86781377-86781399 TCTGGCCGCCTCTGCCCTGGTGG - Intergenic
1056579857 9:87882910-87882932 CCTGCCCTGCCCTTCCCTAGAGG - Exonic
1056579935 9:87883315-87883337 CCTGCCTTGCCCTTCCCTAGAGG - Intronic
1057313177 9:93954224-93954246 CGGGGCCTGCTCTGCCCTGATGG - Intronic
1057353252 9:94317348-94317370 CAGCCCCTGCTCTGCCCTTGGGG + Intergenic
1057420284 9:94906775-94906797 ATTGCCATGCTCTGTCCTGGGGG - Intronic
1057457358 9:95226752-95226774 CCTCCCCTGCTTTGCCCTCCTGG - Intronic
1057535652 9:95901671-95901693 CCTGCACTGTTCTGACCTGCTGG + Intronic
1057654499 9:96940244-96940266 CAGCCCCTGCTCTGCCCTTGGGG - Intronic
1057704717 9:97388524-97388546 TGTGCCTGGCTCTGCCCTGGGGG - Intergenic
1057803473 9:98204091-98204113 ACTTCCCTGCTCAGCCCTGTGGG - Intronic
1058085104 9:100740071-100740093 CCTGCCCAGTTCTGGCCAGGAGG + Intergenic
1058765803 9:108181647-108181669 CCAGCCCTGCTCGGTCTTGGTGG - Intergenic
1059325742 9:113503216-113503238 TCAGCCCTGCTCTGACCTGGAGG - Intronic
1059632172 9:116136395-116136417 CCTTCCCTGCTTGGCCCTGGTGG - Intergenic
1060172037 9:121469799-121469821 CCTGCCCTGCACACCCCAGGAGG + Intergenic
1060277281 9:122191763-122191785 CCTGCCCTGGCTTGCCCTGCTGG + Intronic
1060549511 9:124478317-124478339 CCTGCCCAGCTCAGCTCTGCTGG + Exonic
1060558857 9:124526322-124526344 GCACCCCTGCTCTGCCCTGAAGG + Intronic
1060790766 9:126484042-126484064 CCTGCCCTCCCCTCCCCTGATGG - Intronic
1060883236 9:127133269-127133291 GCTGCCCTTCTCTCCCCTTGGGG - Intronic
1060892380 9:127197000-127197022 CCTCTCCTGCTTTGCCCTGCAGG - Intronic
1061150656 9:128826294-128826316 CCTACCCTGCGCTGTCCAGGTGG - Intronic
1061187457 9:129063185-129063207 CCTGCCCAGCGATGCCCCGGGGG - Intronic
1061309007 9:129750320-129750342 CCTGCCCTGCCCTACCCCAGAGG + Intronic
1061388353 9:130303522-130303544 CGTGCCCTCCTCGGCCTTGGAGG - Intronic
1061450322 9:130664020-130664042 CCTGCCCTGCGCTTCCCACGGGG + Intergenic
1061859364 9:133460246-133460268 CCTGCCCCGCCCCGCCCCGGCGG + Intronic
1061909474 9:133715142-133715164 ACTTCCCTGCTCTTTCCTGGAGG + Intronic
1062222205 9:135422778-135422800 GGTGCCCAGCTCTGGCCTGGAGG + Intergenic
1062280156 9:135748269-135748291 CCTGCCTTGATCTGCCCCAGTGG - Intronic
1062334740 9:136060056-136060078 GCTGCCCGCATCTGCCCTGGCGG + Intronic
1062351519 9:136141984-136142006 CCTGCCCAGCTCTGGCCTCCTGG + Intergenic
1062353167 9:136148947-136148969 CCTGGCCTCAGCTGCCCTGGGGG - Intergenic
1062410091 9:136419220-136419242 CCTGCCCTGCCCTGCCCTGCCGG - Intronic
1062449405 9:136609241-136609263 CCCGCCTGGCCCTGCCCTGGGGG - Intergenic
1062482922 9:136760713-136760735 TCTGCCCTCCTGGGCCCTGGGGG + Intronic
1062540482 9:137039764-137039786 CCTGCACTGCCATGACCTGGAGG - Exonic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1062685911 9:137813332-137813354 GCTGACGTGCTCTGCCCAGGGGG - Intronic
1185608254 X:1379592-1379614 CCTCCCCTGCCCTGCCCAGCGGG + Intronic
1186498606 X:10032471-10032493 CCACCACTGCTCAGCCCTGGGGG - Intronic
1187158792 X:16745336-16745358 CCTGCCCTGCTCTGCCCATGTGG - Intronic
1196195026 X:112830614-112830636 GGAGCCCTGCTCTGCCCTGGTGG - Intronic
1197608149 X:128608332-128608354 CCTGTGCTGCTCTGCCCTAGGGG - Intergenic
1200043500 X:153387514-153387536 CCTGCTCTGCTCTGTCCTCCTGG - Intergenic
1200062095 X:153488267-153488289 CCGGCCTTTCTCTACCCTGGCGG + Intronic
1200065497 X:153502526-153502548 GAGGCCCTGCCCTGCCCTGGAGG + Intronic
1200066638 X:153507179-153507201 CATGCCCAGCTCTCACCTGGAGG - Exonic
1200091393 X:153637743-153637765 CCTTCCTTGCTCTGGCCGGGTGG + Intergenic
1200101073 X:153689270-153689292 CCTGCCCTCCCCTCCCCTCGCGG + Intronic
1201175670 Y:11307281-11307303 TCTGGCCAGCTCTTCCCTGGCGG - Intergenic