ID: 1150134929

View in Genome Browser
Species Human (GRCh38)
Location 17:62690262-62690284
Sequence GCTGCTGCTGGGCCACAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150134921_1150134929 12 Left 1150134921 17:62690227-62690249 CCCTTCCGGGAGCACTGCTATTC 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG 0: 1
1: 0
2: 2
3: 41
4: 334
1150134922_1150134929 11 Left 1150134922 17:62690228-62690250 CCTTCCGGGAGCACTGCTATTCT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG 0: 1
1: 0
2: 2
3: 41
4: 334
1150134923_1150134929 7 Left 1150134923 17:62690232-62690254 CCGGGAGCACTGCTATTCTTTCC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG 0: 1
1: 0
2: 2
3: 41
4: 334
1150134920_1150134929 23 Left 1150134920 17:62690216-62690238 CCGCGTGGATTCCCTTCCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG 0: 1
1: 0
2: 2
3: 41
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150134929 Original CRISPR GCTGCTGCTGGGCCACAAGG AGG Exonic
900159518 1:1216811-1216833 GCTGGTGCTGGGTCACGTGGAGG - Intergenic
900625939 1:3608646-3608668 GGTGCTGCTGGGCTACAGAGAGG - Intronic
900705181 1:4076065-4076087 CCTGCTGCTGGGCTCCATGGTGG - Intergenic
901000289 1:6145643-6145665 GCTGCTGCTGGGGCACTGGGGGG + Intronic
901194466 1:7432752-7432774 GGAGATGCAGGGCCACAAGGGGG - Intronic
901458624 1:9378139-9378161 GAAGCTGCTGGGCCACAAGGAGG - Intergenic
902175023 1:14642984-14643006 GCAGCTGCTGAGTCACATGGTGG - Intronic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902628874 1:17692945-17692967 GAGGCTGCTGGGTGACAAGGCGG - Intronic
904033520 1:27547515-27547537 GCTGCAGCAGGGCCACGGGGTGG + Exonic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904838544 1:33355170-33355192 GCTGCTGCTGGATCACAAATTGG + Exonic
904972250 1:34428067-34428089 GCTGCTGCTGGTCAACCAGGAGG - Intergenic
905123498 1:35700949-35700971 GCTGCTGCTGATCCAACAGGAGG - Intergenic
905167581 1:36092032-36092054 GCAACTCCTGGGCCACATGGAGG + Exonic
906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG + Intronic
906246933 1:44282911-44282933 GGTGCTGCTGGCCCAAAGGGTGG - Intronic
906283456 1:44569733-44569755 GCTGCTGAGGGGGAACAAGGAGG + Intronic
906314538 1:44777756-44777778 GCTGCCCCTGGGCCGCAAGAAGG + Exonic
906751505 1:48266865-48266887 GCCACTGCTGGACCACAAAGGGG + Intergenic
907517886 1:55004858-55004880 GCTGGTGCTGTGCCCCAAGTAGG + Intronic
908796294 1:67833566-67833588 CCTCCTGCGGGGCCACAACGCGG - Intergenic
910733135 1:90420924-90420946 GCAGCAGCTTGGCCACAGGGCGG + Intergenic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
915081003 1:153352603-153352625 GATGCAGATAGGCCACAAGGTGG + Intergenic
915313018 1:155013825-155013847 GCTGCTCCTTGGCCCCATGGGGG + Intronic
915462312 1:156077407-156077429 GCTGGTGGTGGGCCCCAAAGGGG - Exonic
916718926 1:167468551-167468573 GTTCCTGCTGGGCTACCAGGAGG - Intronic
919273053 1:195376137-195376159 CCTGGTGCTTGGCCACATGGAGG - Intergenic
919981662 1:202645792-202645814 GCAGCGGCTGGGCCAAAATGGGG + Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920510410 1:206547374-206547396 GCTGCCGCTGGTCTACAAGGAGG - Intronic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
924885372 1:248210010-248210032 GCTGCTGCTGTGGCAGATGGGGG + Intergenic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063368640 10:5507142-5507164 GCTGCTGTCGGGCCAGAGGGAGG - Intergenic
1065765186 10:29022849-29022871 GCTGCTGCTGGGCCCCATTATGG - Intergenic
1065844843 10:29735967-29735989 CCCTCTGCTGGGCCACCAGGCGG + Intronic
1066396932 10:35034950-35034972 GCTGCTGCTTAGCCATACGGAGG - Intronic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067055325 10:43046510-43046532 GCTGCTGCTGGGCCCTCAGGTGG - Intergenic
1067723259 10:48746033-48746055 GGTACTGCTGGGCCGGAAGGTGG - Intronic
1067830089 10:49606630-49606652 CCTGCAGCAGGGCCACATGGTGG + Intergenic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1071872331 10:89808972-89808994 GCTGCTTCTGGGAGACAAAGTGG + Intergenic
1072582347 10:96750365-96750387 GGTACTGCTGGGCCGGAAGGTGG + Intergenic
1072690569 10:97570214-97570236 CCTGCTGCTGGAGCACACGGAGG + Exonic
1073049645 10:100659358-100659380 GCTGAGGCTGGACCACCAGGGGG - Intergenic
1073349527 10:102809966-102809988 GCCGCTGCTGGGCCTGAAGGCGG - Exonic
1074171048 10:110937134-110937156 GGTACTGCTGGGCCGGAAGGTGG - Intronic
1074923733 10:118046554-118046576 GAGGCTGCTCGGCCGCAAGGAGG - Exonic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076720642 10:132391148-132391170 GGAGCTGCTGGTCCACAGGGAGG - Intergenic
1076726171 10:132414451-132414473 GCTGGTGCTGTGGCACAAGTGGG - Intronic
1076747117 10:132520028-132520050 GCTGCCTCTGGGCCCCCAGGCGG + Intergenic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078682221 11:13487503-13487525 GCAGCTGGTGGGCCGCAAGTTGG - Intergenic
1078781165 11:14440834-14440856 GGTACTGCTGGGCCGGAAGGTGG + Intergenic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1081948725 11:47023320-47023342 GCTTCTGCAGGGCCAATAGGAGG - Intronic
1083319586 11:61837712-61837734 TCTGCTCTTGGGCCCCAAGGAGG - Intronic
1083592235 11:63902585-63902607 CCAGCTGCTGGGCCAGAGGGAGG - Exonic
1083664500 11:64267214-64267236 GCTGCTGCCCAGCCACAAGACGG - Exonic
1083721436 11:64605592-64605614 GCAGCTGCTGGGACTGAAGGTGG - Intergenic
1083809521 11:65095986-65096008 GTTGCTGCTGTCCCAGAAGGGGG - Intronic
1084271735 11:68032806-68032828 GCAACTGCTGGGCTACAAAGGGG - Intronic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1085025930 11:73236623-73236645 GTTGGGGCTGGGTCACAAGGAGG + Intergenic
1085058705 11:73424886-73424908 ACTGCTGCTGAGCCACCTGGGGG + Intronic
1085574517 11:77590085-77590107 GCTGCTGCCGGGCGACTACGCGG - Exonic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1089102566 11:115975806-115975828 GCTGCTGTTTCGCCACACGGCGG + Intergenic
1089526841 11:119102514-119102536 GCTACAGCTGGGGCAGAAGGTGG - Intronic
1089889803 11:121869694-121869716 GCAGGTGCTGAGCCACCAGGCGG - Intergenic
1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG + Intergenic
1090953616 11:131495755-131495777 CCTTCTGCTGAGCCTCAAGGAGG - Intronic
1091564839 12:1640667-1640689 GCAGCTTCTGGGCCCCTAGGTGG + Intronic
1091582043 12:1796174-1796196 GCTGGAGCTTGGCCACCAGGTGG + Intronic
1091758529 12:3072049-3072071 GGTACTGCTGGGCCAGAAGGTGG - Intergenic
1091916424 12:4274043-4274065 GGAGCTGCTGTGCCACGAGGTGG + Exonic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1092879299 12:12875576-12875598 GGTACTGCTGGGCCGGAAGGTGG + Intergenic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1094528807 12:31252501-31252523 GGTACTGCTGGGCCGGAAGGTGG - Intergenic
1096815874 12:54201492-54201514 GCCTCTGCACGGCCACAAGGGGG - Intergenic
1096895879 12:54820237-54820259 GCTGCTGCTGGCCCACGTGTGGG - Intergenic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1097255949 12:57674742-57674764 GGTGCTGCTGGGCCGGAAGGTGG + Intergenic
1100754310 12:97733372-97733394 GCTGGTGCTGGGGCCCGAGGAGG - Intergenic
1101755550 12:107618265-107618287 GTTGCGGCTGGCGCACAAGGGGG - Exonic
1101922902 12:108947296-108947318 ACTGCTGCTGGGCCTCTTGGTGG + Intronic
1102186699 12:110953925-110953947 GCTGGTGCTGGGCTAGCAGGGGG + Intergenic
1103209545 12:119156560-119156582 GCTGCTGCTGTACCAGGAGGAGG - Exonic
1103331373 12:120156560-120156582 ACTGCTGCTGGCACACAGGGTGG + Exonic
1103729504 12:123017849-123017871 CCTGCTGCTGGGGAACATGGGGG + Intronic
1103916846 12:124380210-124380232 GCTGGAGCTGGGCCTCATGGAGG + Intronic
1104017641 12:124971388-124971410 CCTGCTGCTGCGGTACAAGGTGG - Exonic
1104722405 12:131052170-131052192 GCTGCTGCTGCTCCACAAATTGG + Intronic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1105291518 13:19056510-19056532 GCTCACGCTGGGCCACATGGAGG - Intergenic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1108267957 13:48731078-48731100 GCTGCTGCTGAGGCCCAGGGAGG + Intergenic
1108828145 13:54441216-54441238 GGTACTGCTGGGCCGGAAGGTGG - Intergenic
1111020677 13:82445043-82445065 GCTGCTGATGTGAAACAAGGTGG - Intergenic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1115332057 14:32208451-32208473 GCTGCTGCTGATCTACCAGGAGG - Intergenic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1117441710 14:55766254-55766276 GTTACTGCTGGGCCGGAAGGTGG + Intergenic
1118489124 14:66242266-66242288 GCTGCTGATTGGCACCAAGGAGG + Intergenic
1119789864 14:77340526-77340548 CCAGCTGCTGGGCCCCCAGGCGG - Exonic
1123110381 14:105864387-105864409 TCTGCTGCTGGGGCAAAGGGTGG - Intergenic
1126893695 15:53235265-53235287 TCAGCTGCTGGGCCACATGTTGG + Intergenic
1127760593 15:62135830-62135852 GCTGCTGCTGGGAAACGAAGAGG - Intergenic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129104565 15:73297154-73297176 GCTGCTTCTGCCCCACAGGGTGG + Intronic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129754083 15:78085471-78085493 TCTGCAGCTGGGCCCCACGGTGG + Intronic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1130784925 15:87085526-87085548 GATGATGCTGGTCCACATGGTGG + Intergenic
1130872887 15:87985243-87985265 GCTACTGCTGGGAGAGAAGGTGG + Intronic
1131048808 15:89333316-89333338 TCTGCTTCTGGGCCAGGAGGCGG + Exonic
1131582506 15:93658589-93658611 GCTGCTTCTGGGCGTCATGGTGG + Intergenic
1132130734 15:99275990-99276012 GCTGCTGATGGGACAGGAGGTGG - Intronic
1132600350 16:770245-770267 TGCGCTGCTGGGCCACAACGTGG - Exonic
1132806439 16:1777243-1777265 GCTGCCGCCGGGCCTCAAGCAGG - Exonic
1132878954 16:2152867-2152889 CATGCTGCTGGGGAACAAGGTGG + Exonic
1132936461 16:2483741-2483763 GCTGCTGCTCGGCCCAGAGGAGG + Intronic
1133224999 16:4336903-4336925 GCTGCTCGTGGGACACAAAGTGG - Exonic
1134757402 16:16680100-16680122 GCTGTTTCTGGGATACAAGGGGG + Intergenic
1134988666 16:18679066-18679088 GCTGTTTCTGGGATACAAGGGGG - Intergenic
1136768464 16:32811494-32811516 GCTGCGGCGGGGGCAAAAGGCGG + Intergenic
1137440922 16:48497996-48498018 GCTGCTGCTGGGCTAGAAGAGGG - Intergenic
1137487434 16:48903261-48903283 GAAGCTCCTGGGCCACAGGGAGG + Intergenic
1137693022 16:50442315-50442337 GCTGGTGCTGGGGAACATGGTGG - Intergenic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1140764728 16:78146385-78146407 GCTGCTTCTGGGCCAAAAAGAGG - Intronic
1141480714 16:84304856-84304878 GCTGGGGCTGGGCCACAGGAGGG + Intronic
1142117234 16:88365462-88365484 TCTGCTGCTGGACCAGGAGGTGG + Intergenic
1142188088 16:88704023-88704045 GCTCCTGCTGGGCCCCCAGGGGG + Intronic
1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG + Exonic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1203070861 16_KI270728v1_random:1073548-1073570 GCTGCGGCGGGGGCAAAAGGCGG + Intergenic
1143116116 17:4582704-4582726 GCTGCTTCTGGGGCCGAAGGCGG - Intergenic
1143141560 17:4744386-4744408 GCAGCTCCAGGGCCACATGGGGG - Exonic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1143614243 17:8039924-8039946 GCTGTTGCTGGAGCACAGGGTGG - Exonic
1143684957 17:8506343-8506365 GCTGCAGCTGGCCAAGAAGGAGG - Exonic
1143783112 17:9239818-9239840 CCTGCTGCTGGGCAACGCGGAGG + Exonic
1144480145 17:15622238-15622260 GCCGCTGCTGGGCCAGATAGAGG + Intronic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1144918160 17:18741500-18741522 GCCGCTGCTGGGCCAGATAGAGG - Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1146968613 17:37054217-37054239 GCTGCTCCTGGGCCCCAGGGAGG + Intronic
1146968946 17:37056705-37056727 GCGGCTGCTGGTCCAGATGGAGG + Exonic
1147740438 17:42668235-42668257 GCTGCTGCAGGGCCTCTCGGGGG + Exonic
1147744764 17:42688359-42688381 GCTGCTACTGGGACACAGTGGGG + Intronic
1147757485 17:42778646-42778668 TCTGCTTCAGGGCCACAAAGGGG - Intronic
1147845265 17:43400122-43400144 GCTGGTGCTGGCCAACAAGCAGG + Exonic
1148820265 17:50355943-50355965 GGCGCAGCTGGGCCACAAGCGGG - Exonic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG + Exonic
1151140191 17:71984206-71984228 CCTGCTGCTGGATCCCAAGGGGG - Intergenic
1151560456 17:74866873-74866895 GGTGCTGCTGGGGAACAGGGTGG + Exonic
1151620278 17:75240855-75240877 TGTGCTGCTGGGCCCCAGGGTGG + Exonic
1151675751 17:75596534-75596556 GATGCTGCTGGCCCAGGAGGAGG + Intergenic
1151759126 17:76090687-76090709 GCTGATGCTTGGCCCCAGGGGGG + Intronic
1151842326 17:76627191-76627213 GCTGCTGCTGGGGCACTGGAGGG + Exonic
1151873273 17:76850928-76850950 GCGGGGGATGGGCCACAAGGTGG + Intergenic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1153429344 18:4999081-4999103 GCTGCTGCTGGGGATGAAGGAGG - Intergenic
1153443904 18:5151156-5151178 GCTGCTGCTGGTAAACAGGGAGG + Intronic
1155258691 18:24021075-24021097 GCTGCTGCTGGGTAAATAGGAGG - Intronic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1156204668 18:34872745-34872767 GCTGCTCCAGCACCACAAGGTGG + Intronic
1157929812 18:51809286-51809308 GCTGCTGCTGAGTCACAATAAGG - Intergenic
1157933145 18:51845253-51845275 GCTGCCCCTGGGCCGCAAGAAGG - Intergenic
1160089474 18:75812764-75812786 GGGACTGCTGGGCCCCAAGGGGG - Intergenic
1160505879 18:79426669-79426691 GCTGCAGCTGAGTCACAGGGGGG - Intronic
1161346172 19:3769875-3769897 GGTGCTGGTGGGCCTCCAGGTGG - Exonic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162758342 19:12873814-12873836 GCCACTGCCGGGCCACACGGTGG + Exonic
1163672639 19:18637566-18637588 GGTGCTGAAGGGCCCCAAGGTGG + Intronic
1164216530 19:23155581-23155603 CCTGCTACTTGGCCACAAGACGG - Intergenic
1165215092 19:34265360-34265382 GCTGCTCCTGGGTGTCAAGGTGG + Intronic
1165696010 19:37901498-37901520 GCAGCTCCAGGGCCACAAGAAGG - Intronic
1165769609 19:38371420-38371442 GATCCTGCTGGACCACAGGGAGG - Intergenic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167366819 19:49058778-49058800 GCTCCTGCTTGGCTACAGGGAGG - Exonic
1168121574 19:54254987-54255009 GGTGCAGCCGGGCCCCAAGGTGG - Exonic
1168335124 19:55593043-55593065 GCTGCTCCTGGGCCCCGCGGGGG - Exonic
925609907 2:5693740-5693762 GCTGCTGCTGGACGAGGAGGTGG - Exonic
927860322 2:26556643-26556665 TCTGCTCCTGGGCCACCTGGGGG - Intronic
935025229 2:99270221-99270243 GCTGCCCCTAGGCCACTAGGAGG + Intronic
935223185 2:101032340-101032362 GCTGCTGCTGTACACCAAGGAGG - Exonic
935721112 2:105980162-105980184 CCTGCTACTTGGCCACAAGATGG - Intergenic
935974066 2:108560096-108560118 GCAGATGATGGGCCACAGGGTGG + Intronic
936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG + Intronic
936269822 2:111041101-111041123 GCTTCTTCTGGGCACCAAGGTGG + Intronic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
938727328 2:134120270-134120292 GCTGCTGCTGCCCAACAAGGAGG + Exonic
941403781 2:165063549-165063571 GCTGCTGATGGGACAGGAGGTGG + Intergenic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
944685580 2:202114567-202114589 GCTTTTGCTGTGCCAAAAGGGGG - Intronic
946167995 2:217877129-217877151 CCTGCTCCTGGGCCAGGAGGAGG - Intronic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948899446 2:240949006-240949028 CCAGCTGTTGGGCCTCAAGGAGG - Intronic
948911679 2:241008148-241008170 GCTGCTCCAGGGCCACCTGGGGG + Intronic
948935865 2:241164230-241164252 ACTGCTACTGGGGCAGAAGGGGG - Intronic
1169908637 20:10628778-10628800 GCTGCTGCTTTGCCACTAGTTGG + Intronic
1172447169 20:34999335-34999357 GCTGCGGCACGGCCACGAGGAGG + Exonic
1172606509 20:36217694-36217716 CCTGCTGCTGGGCCACATTCTGG + Intronic
1173021003 20:39268356-39268378 GCTACTCCTGGGCTCCAAGGAGG + Intergenic
1173615745 20:44401808-44401830 GCTGGAGCTGGGCACCAAGGGGG - Intronic
1174112912 20:48208453-48208475 GCTACTTCTGGGCCACTTGGGGG - Intergenic
1174168457 20:48601186-48601208 GCAGTGGATGGGCCACAAGGCGG - Intergenic
1174407321 20:50310669-50310691 GCTGCCGCTGGGCCCCCAGGAGG - Intergenic
1175242709 20:57561573-57561595 GCGGCTTCTGGGCCAGATGGAGG + Exonic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175925485 20:62469341-62469363 GGGACTGCTGGGGCACAAGGAGG - Intronic
1176093930 20:63330993-63331015 GAAGCTGCAGGGCCTCAAGGTGG - Intronic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1178471613 21:32898653-32898675 GCTAGTGCTGGTCCTCAAGGTGG - Intergenic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180693593 22:17738115-17738137 CCTGCTGCTGGCCAAGAAGGTGG - Exonic
1180800309 22:18628595-18628617 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180851543 22:19024159-19024181 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180871855 22:19150781-19150803 GGTGGTGCTGGGCCCCATGGAGG - Intergenic
1180919873 22:19516164-19516186 GCTGCTGCAGGACCTGAAGGAGG + Intronic
1181221407 22:21366671-21366693 GCTGCTGCTGGGCACCATGGAGG + Intergenic
1181509023 22:23380617-23380639 GGTGCTGCTGAGACAGAAGGGGG + Intergenic
1181573719 22:23781288-23781310 GCTGCAGCTGGCCCCCACGGAGG - Exonic
1181938414 22:26455861-26455883 CATACTGCAGGGCCACAAGGTGG + Intronic
1182563159 22:31177597-31177619 ACTGCTGCTGGACCACACGTAGG - Intronic
1182767932 22:32772164-32772186 GATAGTGCTGGGCCACAGGGGGG + Intronic
1183180009 22:36253613-36253635 GCTGCTGCTGAGGCCCAATGGGG + Intronic
1183255938 22:36762178-36762200 GCTGCATCTTGGCCTCAAGGAGG + Intronic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
949705713 3:6814304-6814326 GCTGCCCCTTCGCCACAAGGAGG + Intronic
949918835 3:8985729-8985751 GCTGCTGCTGCGGCGCATGGCGG + Exonic
950304602 3:11908235-11908257 GCTGCTGCTGGTGCTCAGGGTGG - Intergenic
950555812 3:13695342-13695364 GCTGAGGCTGGGACACACGGTGG + Intergenic
951068377 3:18295431-18295453 GCTGCTGCTCTGCCACTGGGGGG - Intronic
951708385 3:25566554-25566576 GCTGCAGCTGGGCACCAAGTTGG - Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954163274 3:48737090-48737112 GTGACTGGTGGGCCACAAGGGGG + Intronic
954176166 3:48847539-48847561 GCTGCTGCAGGGCTACACGGTGG - Exonic
954424795 3:50437700-50437722 GCTCCTGCTGGGCCTGCAGGTGG - Intronic
956704013 3:71983704-71983726 GTTGCTGCTGAGACACCAGGTGG + Intergenic
957215735 3:77317675-77317697 GCTGCTGGGGGGCTACTAGGGGG + Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962688255 3:137868214-137868236 GCTGCTGCTGGGGGTCAGGGAGG - Intergenic
963798899 3:149657961-149657983 GCTAGTGCTGGGCGAAAAGGAGG + Intronic
963866454 3:150367238-150367260 GCTGGTGTTGGATCACAAGGAGG - Intergenic
964119035 3:153163026-153163048 GATCCTGGTGGGCAACAAGGTGG + Exonic
964522015 3:157580277-157580299 GCTGCTACTTGGGCACAAGATGG - Intronic
966822861 3:183938797-183938819 GCTGCTGCTGTGGCAACAGGAGG - Intronic
967321870 3:188202376-188202398 GCTGCTGCCTGACCACAATGTGG - Intronic
967322530 3:188208667-188208689 GCAAATGCTGGGCCAAAAGGAGG - Intronic
967989866 3:195122783-195122805 TCTGCTGCTGAGCCACCAAGGGG - Intronic
968607000 4:1540279-1540301 GCTGCAGCCGGGCCACCACGGGG - Intergenic
968752212 4:2396107-2396129 CCTGCAGAGGGGCCACAAGGCGG + Intronic
968752238 4:2396208-2396230 CCTGCAGAGGGGCCACAAGGCGG + Intronic
968752251 4:2396258-2396280 CCTGCAGAGGGGCCACAAGGCGG + Intronic
968752329 4:2396560-2396582 CCTGCAGAGGGGCCACAAGGCGG + Intronic
968752355 4:2396661-2396683 CCTGCAGAGGGGCCACAAGGCGG + Intronic
968752368 4:2396711-2396733 CCTGCAGAGGGGCCACAAGGCGG + Intronic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969474205 4:7412071-7412093 GCAGCTGCTGGCCCAGGAGGTGG + Intronic
969532818 4:7739277-7739299 GCTCCTGCTGGGGCAGGAGGTGG + Intronic
969612750 4:8236325-8236347 GCTGCGGCTGTGCAACAAGCTGG + Exonic
971532188 4:27703213-27703235 GCAGGTGCTGGACCACCAGGTGG + Intergenic
972471550 4:39410672-39410694 GCTTCTTCTGGGTCACAAGGGGG - Intronic
973294623 4:48503388-48503410 ACTGGTGCTGAGCCACAGGGTGG + Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
981758424 4:148167187-148167209 GCCGCTCCTGGGTCACAAGGTGG + Intronic
982078835 4:151766880-151766902 GCCGCTGCTGGTCCAACAGGAGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
985368125 4:189255309-189255331 ACTGCTGCTGGGCCACTAACAGG + Intergenic
985391647 4:189496805-189496827 TCTGCTGCTCTGCCACAAGAAGG + Intergenic
985570163 5:640523-640545 GCTGCTGCTGCTCAGCAAGGCGG - Exonic
985706702 5:1405731-1405753 GATGCTGCTGAGCCAGAGGGAGG + Intronic
986432000 5:7690756-7690778 GAGGCTGCAGGGCCCCAAGGCGG + Exonic
988051799 5:26041179-26041201 GCTGCTGCACTGCCCCAAGGAGG + Intergenic
988651983 5:33162534-33162556 GCTGCCCCTGGGCCGCAAGAAGG + Intergenic
989010149 5:36862216-36862238 GCTGGTGTTGGGCTGCAAGGTGG + Intergenic
989991452 5:50772374-50772396 GGAACTGCTGGGCCACATGGTGG + Intronic
993118568 5:83746890-83746912 GGTACTGCTGGGCCGGAAGGCGG - Intergenic
993898865 5:93571082-93571104 GGTGCTGCAGGGCCCCAGGGCGG - Intergenic
994719953 5:103369134-103369156 TCTGCTGTTGTGCCCCAAGGAGG + Intergenic
997819620 5:137053199-137053221 GCTGCTGCTCAGGGACAAGGAGG + Intronic
1001159576 5:169301079-169301101 GCTGCGGCTGGGGCACGGGGCGG + Intronic
1001589046 5:172853116-172853138 TTTGCTGCAGGCCCACAAGGTGG + Intronic
1001695838 5:173669135-173669157 CCTCATGCTGGGTCACAAGGTGG + Intergenic
1002586246 5:180250547-180250569 CCAACTGATGGGCCACAAGGGGG + Intronic
1002770013 6:282526-282548 GCTGCTGCTGGGACACTTGAGGG + Intergenic
1003305240 6:4921306-4921328 GCCGGTGCTGGGCCACCATGTGG - Intronic
1005992764 6:30913851-30913873 GCTGCTGCTGGCCCACGCGCGGG + Exonic
1006925191 6:37650121-37650143 GCTGCACCTGGGCCTCACGGGGG + Exonic
1007269448 6:40624910-40624932 GCTGGGGCTGGGCCACATTGAGG + Intergenic
1007276438 6:40677722-40677744 GCTTCTGATGGGCAAGAAGGAGG + Intergenic
1007702478 6:43772981-43773003 ACTCCTCCTGGGCCCCAAGGAGG - Intronic
1007932669 6:45706554-45706576 GCTGCTGCTTCCTCACAAGGAGG - Intergenic
1008661374 6:53671467-53671489 GCTGTGGCTGGGCCATGAGGGGG + Intergenic
1013073507 6:106750648-106750670 GGTGGTGCTGAGCCACACGGAGG - Intergenic
1014265258 6:119269618-119269640 GGTACTGCTGGGCCAGAAGGTGG - Intronic
1014780346 6:125558366-125558388 GCAGCTGCTTTCCCACAAGGAGG + Intergenic
1017104569 6:150875418-150875440 GCTGCTGCTGGGCATTTAGGAGG + Intronic
1017470555 6:154733800-154733822 GCTGCTGCGTGGCCGCGAGGAGG - Intronic
1017787470 6:157768370-157768392 GGTGCTGCTGAGCCCCAGGGTGG - Intronic
1019650626 7:2156005-2156027 GCTGATGCTGGGCAAAAAGGTGG + Intronic
1019733721 7:2640516-2640538 GCTGCTGCTGGGCATCCTGGTGG - Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1020365915 7:7380375-7380397 GCTGTTACTGGCCAACAAGGAGG - Intronic
1021483781 7:21145912-21145934 GCTACAGCTGGGCCACAGGTGGG + Intergenic
1022467266 7:30660409-30660431 GGTGGTGCTGGGGCACAGGGTGG + Intronic
1023382587 7:39623578-39623600 GCTGCTGCAGAGCCGCCAGGAGG + Exonic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1024125493 7:46290609-46290631 GCTACTGCTGACCCAGAAGGAGG - Intergenic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1027173302 7:75888052-75888074 GCTGCGTCTGGGACACAGGGTGG - Exonic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1029403498 7:100359352-100359374 TGTGCTGCTGGGCCTCCAGGTGG - Exonic
1030086412 7:105819569-105819591 GGTACTGCTGGGCCGGAAGGTGG + Intronic
1030216096 7:107044940-107044962 GCTGCTGCAGGGCTTCACGGTGG + Exonic
1030266639 7:107628732-107628754 GCCGATGCTGGGCCTGAAGGCGG - Intronic
1032191590 7:129768994-129769016 GCACCTGCTGGGACACAGGGAGG - Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1037993803 8:23338861-23338883 GCTGCAGCAGGGCCAGCAGGTGG + Intronic
1038191073 8:25321611-25321633 GCTGCTGCTGATCCAACAGGAGG + Intronic
1039843342 8:41308946-41308968 CCTGCGGCTGTGCCACAACGTGG - Exonic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1046994822 8:120506733-120506755 ACAGTTGCTGGGCCACAAAGAGG + Exonic
1047299547 8:123601350-123601372 ACTGCTTCTTGGTCACAAGGTGG + Intergenic
1047312686 8:123705875-123705897 GCTGGTGCTGGAGCAGAAGGAGG - Intronic
1048468390 8:134686054-134686076 GCTGCTGCTGGTCCCCAGAGGGG + Intronic
1049201604 8:141343305-141343327 GCTGGGGCTGGGGCACAAGGGGG - Intergenic
1049253946 8:141604121-141604143 GCCTCTGCTGGGCCCCAAGAGGG + Intergenic
1049683969 8:143931895-143931917 GCTGCCGCTGAGCCACAGTGCGG + Intronic
1049721441 8:144117456-144117478 GCAGCTGCTGGGTCACAGAGTGG + Exonic
1056383620 9:86077670-86077692 GCTGGCCCTGGGCCCCAAGGTGG - Intronic
1057198456 9:93127855-93127877 GGTGCCGCAGGGCCACAGGGAGG + Intronic
1060626037 9:125112648-125112670 GTTGCTACTGGGGCACAATGTGG - Intronic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1060934910 9:127509166-127509188 GGTGCTGCCTGGCCACAGGGCGG - Intronic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1062285790 9:135771944-135771966 GTGGCTGCTGGGGCACCAGGTGG + Intronic
1062517683 9:136944447-136944469 GCTGCTCCAGGGCCGCAGGGCGG - Intronic
1186522126 X:10214967-10214989 AGTCCTGCTGGGCCTCAAGGTGG + Intronic
1187200056 X:17126217-17126239 GTTGCTGCCTGGCCAGAAGGGGG - Intronic
1187354064 X:18550221-18550243 GCTGCTGTTGGAGCTCAAGGAGG - Intronic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1191753608 X:64570397-64570419 GCTGCTGCCAGGCCACCAGAGGG + Intergenic
1192394244 X:70762493-70762515 GCTGCTGATCTGCCAGAAGGTGG - Intronic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1197010148 X:121551142-121551164 GCTGCTGCTGGGGTTGAAGGAGG - Intergenic
1198312301 X:135434966-135434988 CCTCCAGCTGGGCGACAAGGCGG - Intergenic
1199163373 X:144641385-144641407 CCTGCAACTGGGCCACAAAGAGG - Intergenic
1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG + Intergenic
1199691431 X:150311812-150311834 GCAGCTGCTGGGCGACCAGGTGG - Intergenic
1200134512 X:153868349-153868371 GGTGATGCTGGGCTGCAAGGAGG + Exonic
1202115941 Y:21468819-21468841 TCTGCTGCTGGGCCTCACTGAGG - Intergenic