ID: 1150137142

View in Genome Browser
Species Human (GRCh38)
Location 17:62702244-62702266
Sequence GTGGAGGAGGTGGAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1205
Summary {0: 1, 1: 0, 2: 18, 3: 126, 4: 1060}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150137142 Original CRISPR GTGGAGGAGGTGGAGTTGGT GGG Intronic
900192057 1:1356031-1356053 GTGGAGGAGGAGGAGTAACTGGG + Intronic
900395200 1:2450615-2450637 GGGGGGGAGTTGGAGTTGGAGGG - Intronic
900488851 1:2936303-2936325 GTCGAGGTGGTGGGGATGGTGGG - Intergenic
900659171 1:3774333-3774355 GTGGGGGTGGAGGAGTTGGAGGG - Intronic
900768484 1:4521128-4521150 GTGGTGGAGGTGGAGATGGAGGG - Intergenic
900906286 1:5561867-5561889 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
900969414 1:5981145-5981167 GAGGAGGAGGTGGCGGTGCTGGG - Intronic
900975170 1:6012150-6012172 GTGATGAAGGTGGAGGTGGTGGG + Intronic
901099994 1:6712561-6712583 GTGGAGGTGGTGTAGTTGCATGG + Intergenic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901535400 1:9879542-9879564 GTGGAGGCGGTGGCAGTGGTGGG - Intronic
901535800 1:9882451-9882473 GAGGAGAAGGAGGAGTTGGTAGG + Intronic
901572258 1:10171042-10171064 GTGGAGGAACAGGAATTGGTTGG - Intronic
901740216 1:11336662-11336684 GTGGTGCAGGTAGGGTTGGTGGG + Intergenic
901740359 1:11338113-11338135 GTGGGGGAGGAGGAGGAGGTAGG - Intergenic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
902379973 1:16048246-16048268 ATGGAGGAGGGGGTGTTGGGGGG + Intronic
902389450 1:16094633-16094655 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
902488388 1:16763137-16763159 GTGGCGGTGGTGGTGGTGGTGGG + Intronic
902792437 1:18778442-18778464 CTGGAAAAGGTAGAGTTGGTTGG + Intergenic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
902953824 1:19910716-19910738 GTGGAGCAGCTGGAGCTGGCTGG + Exonic
903216201 1:21844502-21844524 TGGGAGGAGGAGGAGATGGTGGG - Intronic
903235956 1:21950991-21951013 GTGCTGGTGGTGGAGTTGTTTGG + Intergenic
903262181 1:22137234-22137256 ATGGGGGAGGGGGAGCTGGTGGG + Intronic
903383037 1:22909876-22909898 GAGAAGCAGGTGGAGATGGTGGG + Intronic
903651500 1:24925266-24925288 GTGGGAGAGGTGGAGGCGGTTGG - Intronic
903676415 1:25067370-25067392 CTGGAGGAGGTGGAGCGGGAAGG - Intergenic
904014604 1:27409920-27409942 GTGGTGGAGGAGGAGGTGGAGGG + Exonic
904034309 1:27550807-27550829 GTGGAGGAGGCGGTGGTGGTGGG + Exonic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904752786 1:32751376-32751398 CTGGTGGAGGTGGAGATGGTGGG - Intronic
904833021 1:33317528-33317550 GTGGAGGAGCTGGACTTGGGAGG - Intronic
905181290 1:36168612-36168634 GTGGAGTTGGTGGAGTTGGAGGG + Intronic
905229719 1:36507527-36507549 GTGGAGGGGATGGACTTGGGGGG + Intergenic
905310524 1:37045852-37045874 GTGGAAGAGGTGGAGAGGGTGGG - Intergenic
905630198 1:39514321-39514343 GTGGGGGAGGTGGAGAGGGCGGG + Intronic
905667562 1:39771869-39771891 GTGGGGGAGGTGGAGAGGGCGGG - Intronic
905938546 1:41844168-41844190 GCAGTGGAGGTGGACTTGGTGGG - Intronic
905951669 1:41956819-41956841 ATGGAGGAGAAGGAGTTGGAAGG + Intronic
906149299 1:43578245-43578267 GGGGAGGGGGTGGAGTAGGAGGG + Intronic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
906655917 1:47548281-47548303 TTGGAGGTTGTGGAGGTGGTTGG + Intergenic
906918771 1:50040837-50040859 GTGGAGGGGGTGGAGTCCCTGGG + Intergenic
907422645 1:54357529-54357551 GTGGAGGTGGTGGGGCTGGCTGG - Intronic
907422648 1:54357538-54357560 GGGGGAGAGGTGGAGGTGGTGGG - Intronic
907729635 1:57053489-57053511 GAGGTGGAGGTGGAGGTGGGAGG - Intronic
907807671 1:57837768-57837790 GTGAAGGTGGTGGAGGTGGTAGG - Intronic
907906409 1:58786007-58786029 GGGGAGGGGGTGGGGTAGGTAGG + Intergenic
908477682 1:64505644-64505666 GGGGAAGAGGTGGAGGTGTTGGG - Intronic
908519033 1:64923138-64923160 GTGGTGGAGGAGGAGGAGGTTGG - Intronic
908781933 1:67698851-67698873 GTGGAGGGGTGGGAGGTGGTTGG + Intergenic
909318067 1:74248274-74248296 GTGGAGGGAGTGGAGTGGGCAGG - Intronic
909449658 1:75784486-75784508 GTGGTGGCGGTGGTGGTGGTGGG + Intronic
910325944 1:86007237-86007259 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
910675851 1:89815884-89815906 GTGGAGGAAATGGAGCTGGACGG - Intronic
910703569 1:90103042-90103064 GCGGAGGAAGTGGATGTGGTGGG - Intergenic
910870511 1:91829019-91829041 GTGGAGGGGGCGGGGTTGGGAGG - Intronic
911699968 1:100941335-100941357 GTTGTGGAGGTGGTTTTGGTGGG - Intronic
911933868 1:103941329-103941351 GTGTAAGAAGTGGAGTTGGCAGG - Intergenic
912533098 1:110340347-110340369 GTGGCGGAGGTGGAGGGGGCAGG - Exonic
912758783 1:112347433-112347455 CTGGAGGTGGTAGAGTTGGGTGG - Intergenic
912772362 1:112476559-112476581 GGGGATGGGGTGGAGTAGGTAGG - Intronic
912987863 1:114453012-114453034 GAGGAAGAGGGGGTGTTGGTAGG + Intronic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913146393 1:115994177-115994199 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
913368977 1:118075584-118075606 GTGTGGGAGGTGGATTTTGTGGG + Intronic
913650904 1:120913165-120913187 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
913650908 1:120913174-120913196 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914170209 1:145215902-145215924 GTGGAGGAGGAGGGGGAGGTCGG + Intergenic
914525322 1:148459859-148459881 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
914525326 1:148459868-148459890 GTGGAGGAGGAGGGGGAGGTCGG + Intergenic
914598347 1:149175962-149175984 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
914598351 1:149175971-149175993 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914641074 1:149607260-149607282 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
914641078 1:149607269-149607291 GAGGAGGAGGTGGAGGAGGAGGG - Intergenic
914747135 1:150509108-150509130 GTGGAGGAGGTGGATTGGGTAGG + Intronic
915068298 1:153244447-153244469 GTGGTGGTGGTGGAGGTGGTGGG + Intergenic
915068342 1:153244645-153244667 GTGGAGGTGGTGGTGATGGTGGG + Intergenic
915145224 1:153792831-153792853 GAGGAGGAGGCTGAGTTGGGAGG + Intergenic
915165365 1:153945338-153945360 GTGGTGGCGGTGGCGGTGGTGGG + Intronic
915313277 1:155015218-155015240 GTGGCGGTGGCGGAGGTGGTGGG - Exonic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915536806 1:156541286-156541308 GAGGAGGAGGAGGAGCAGGTTGG - Intronic
915609284 1:156978248-156978270 GTGGAGGAGGTGGTGGTGAGGGG + Exonic
915649776 1:157301290-157301312 GTGGAGGAACTGGAGGTGATAGG - Intergenic
915661665 1:157410279-157410301 GTGGAGGAGCTGGAGGTGATAGG + Intergenic
915898720 1:159831031-159831053 GAGGTGGAGGTGGAGTTGTTGGG - Intronic
915899048 1:159833398-159833420 GTGGAGGAAGTGGAGTTCCTGGG + Intronic
916072145 1:161176690-161176712 GAGGAGGAGCAGGAGATGGTAGG + Intronic
916575062 1:166059776-166059798 GTGGCTGAGGTGGAGGTGTTTGG + Intronic
916802203 1:168226045-168226067 GCTGAGGAGCTGGAGCTGGTGGG + Exonic
918046501 1:180944740-180944762 CTGGAGGGGGTAGAGTTGGCCGG + Intronic
918069276 1:181123035-181123057 GAGGATGGGTTGGAGTTGGTGGG + Intergenic
918244415 1:182646370-182646392 GAGGAGGGTGTGGAGGTGGTGGG + Intronic
918263748 1:182820802-182820824 GTGCTGGAGGTGGGGCTGGTGGG - Intronic
918811638 1:189129256-189129278 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
919406684 1:197193693-197193715 GCGGGGGAGGTGGTGGTGGTAGG - Intronic
919791532 1:201293769-201293791 GTGGAGGATGTGGAGATAGATGG + Intronic
919866802 1:201788695-201788717 GTGGTGGGAGTGGAGGTGGTGGG - Intronic
919898504 1:202025507-202025529 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
919976476 1:202616104-202616126 GAGGAGGAGGCGAAGCTGGTGGG - Intronic
920001272 1:202800818-202800840 ATGGAGGTGTTGGAGTCGGTTGG - Intronic
920068746 1:203287623-203287645 GTGGGGGAGGAGGAGAGGGTAGG + Intergenic
920098150 1:203499948-203499970 GTGGTAGAGGTGGAGGTGGGTGG - Intronic
920098174 1:203500025-203500047 GTGGTGGTGGTGGCGGTGGTAGG - Intronic
920098211 1:203500142-203500164 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098218 1:203500161-203500183 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098253 1:203500267-203500289 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098260 1:203500286-203500308 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098267 1:203500305-203500327 GTGGTAGAGGTGGAGGTGGGTGG - Intronic
920098279 1:203500346-203500368 GTGGCAGAGGTGGAGGTGGGTGG - Intronic
920145833 1:203860496-203860518 GTGGAGCAGCTGGAATTTGTAGG - Intergenic
920444257 1:206003497-206003519 GTGGAGGGGGTGGAGTGGAATGG + Intergenic
920528875 1:206686982-206687004 AAGGAGGAGGAGGAGTTGTTTGG + Intronic
920679242 1:208060117-208060139 GTGGCTGCTGTGGAGTTGGTGGG - Intronic
920730252 1:208476698-208476720 GAGGAGGAGGTGGAGGGAGTGGG + Intergenic
921129715 1:212209300-212209322 ATGGAGGAGGTGGAGGTGCCAGG - Intergenic
921714725 1:218406264-218406286 GTAGTGGAGTTGGAGTTGGTGGG + Intronic
921876240 1:220199843-220199865 GTGGAGGCAGTGGAGTTGGAAGG - Intronic
921877391 1:220213716-220213738 GGGGCGGAGGAGGAGTTGGGGGG + Intronic
922002362 1:221492381-221492403 GTGGAAGAGGTAGAGGAGGTGGG + Intergenic
922167148 1:223125626-223125648 GTGGGGGTTGTGGTGTTGGTGGG + Intronic
922800632 1:228363169-228363191 GAGGAGGAGGTGGAGGAGGGAGG + Intronic
922811335 1:228416950-228416972 GTGGAGGGTGGGGAGTTGGGGGG + Intergenic
922919555 1:229290519-229290541 GTGGAGCAGGTGGGCTTGGAGGG - Intronic
923146485 1:231202209-231202231 GTGGAGGAGGAGGAGGTAGTAGG + Intronic
923323870 1:232862896-232862918 TTGGTGGTGGTGGAGTTTGTTGG - Intergenic
923371566 1:233319180-233319202 GATGAGGAAGTGGAGATGGTGGG - Intergenic
923524342 1:234760505-234760527 GTGGGGGAGGGGGAGCTGGGAGG + Intergenic
923782331 1:237036120-237036142 GAGGCAGAGGTGGAGGTGGTAGG - Intergenic
924134296 1:240947605-240947627 GTGGAGGTGGTGGATGTGGGTGG - Intronic
924374587 1:243391823-243391845 GTGCAGGAGGTGGGGGTGGTAGG + Intronic
1063105197 10:2986578-2986600 GAGGAGGAGGAGGAGCAGGTGGG - Intergenic
1063139337 10:3242797-3242819 GAGGAGGAGGAGGGGCTGGTGGG + Intergenic
1063142406 10:3267252-3267274 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1063382356 10:5593687-5593709 GTGGGGGATGAGGAGGTGGTGGG - Intergenic
1063665999 10:8061006-8061028 TTGCAGGGGGTGGAGGTGGTGGG + Intronic
1063910956 10:10829991-10830013 ATGGTGGTGGTGGGGTTGGTGGG - Intergenic
1063945360 10:11170674-11170696 GTGGAGGAGGAGGAGTTGAAGGG + Intronic
1064117208 10:12588600-12588622 GTTGAGCAGGTGCAGGTGGTGGG - Intronic
1065184205 10:23156618-23156640 GTGGAGGAAGTGGTGAAGGTGGG - Intergenic
1065454393 10:25891924-25891946 GTGGTGGAGGTGGCTTTGGCAGG + Intergenic
1065626039 10:27629550-27629572 GAAGAGGAGGTGGAAATGGTTGG + Intergenic
1065935597 10:30517924-30517946 GTGGAGGGGGTGGTTTTGGTGGG - Intergenic
1066404317 10:35104537-35104559 GGGAAGGAGGTGGAATTGCTGGG + Intergenic
1066530276 10:36330255-36330277 GTAAAAGAGGTAGAGTTGGTTGG + Intergenic
1067217695 10:44316586-44316608 GTGGAGGAGACGGGGCTGGTAGG - Intergenic
1067225331 10:44372699-44372721 GTGGAGGATGTGGAGGTGCTCGG + Intronic
1067831850 10:49615052-49615074 ATGGAGGAAGAAGAGTTGGTAGG + Intronic
1068933266 10:62612719-62612741 GTGTAGGAGGTAGAGTTGACAGG + Intronic
1069000530 10:63258627-63258649 AAGGATGAGGTGGGGTTGGTGGG - Intronic
1069854657 10:71433362-71433384 GTTCAGGAGGTGGAATTGCTGGG + Intronic
1069940844 10:71954247-71954269 GTGTAGTGGGTGGTGTTGGTGGG + Intergenic
1070285981 10:75084062-75084084 GTGAGGGGGGTGGAGTTGGGGGG + Intergenic
1070327923 10:75400093-75400115 GTGGAGGCGGTGGCGGTGGCGGG - Exonic
1071564591 10:86665211-86665233 GAAGAGGAGGCGGAGGTGGTAGG + Intronic
1071924571 10:90391317-90391339 GAGGAGTAGGTGGATTTGGCAGG - Intergenic
1072169049 10:92842693-92842715 GTGGTGGTGGTGGAGTTGGTGGG + Intronic
1072294816 10:93998722-93998744 TTTGGGGAGGTGGAGATGGTAGG + Intronic
1072312582 10:94170952-94170974 GTGGCGGTGGTGGTGGTGGTAGG - Intronic
1073047789 10:100651024-100651046 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047795 10:100651042-100651064 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047826 10:100651132-100651154 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047832 10:100651150-100651172 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047876 10:100651294-100651316 GTGGGGGTGGTGGAGGTGGTGGG - Intergenic
1073047927 10:100651438-100651460 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047945 10:100651492-100651514 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047951 10:100651510-100651532 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047970 10:100651564-100651586 GTGGGAGTGGTGGAGGTGGTGGG - Intergenic
1073047991 10:100651636-100651658 GTGGGGGTGGTGGAGGTGGTGGG - Intergenic
1073048012 10:100651693-100651715 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048029 10:100651738-100651760 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048046 10:100651783-100651805 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048063 10:100651828-100651850 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048080 10:100651873-100651895 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048097 10:100651918-100651940 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048114 10:100651963-100651985 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048131 10:100652008-100652030 GTGGAGGTGGCGGGGGTGGTTGG - Intergenic
1073096605 10:100983906-100983928 GTGGGGGCGGTGGGGGTGGTGGG - Exonic
1073220497 10:101868502-101868524 GTGGAGGAGGTGGAAAGGGGAGG - Intronic
1073221397 10:101877252-101877274 ATTCAGGAGGTGGAGGTGGTAGG + Intronic
1073862701 10:107765806-107765828 GTGGAGCAGGTGGAATAAGTGGG + Intergenic
1074104152 10:110376290-110376312 GTGGAGGCTGTGGTGTTGCTGGG - Intergenic
1074223226 10:111459020-111459042 GTGGACGATGTGGAGTGGGTGGG + Intergenic
1074313574 10:112342863-112342885 CTGGTGGAGGTGCAGTTCGTGGG + Intergenic
1074865487 10:117542319-117542341 GTGGCTGAGGGGGAGTAGGTGGG + Intergenic
1075023714 10:118968711-118968733 CTGGAGGAGGTGGAGCTGCGAGG - Intergenic
1075143448 10:119862306-119862328 GTGGAGGAGGTGGTGTGGGGGGG - Intronic
1075331556 10:121577851-121577873 GTGGAGGAGGAGGAGGTTGAAGG - Intronic
1075564774 10:123495235-123495257 GTGAAGAAGGTGGTGCTGGTTGG + Intergenic
1075640737 10:124062579-124062601 GTTGAGCAGTTGGAGTTGGCAGG - Intronic
1075658677 10:124178314-124178336 GTTGAGGAGCTGCATTTGGTGGG + Intergenic
1076205678 10:128599548-128599570 GTGGAGGCGGTGGTGGGGGTTGG - Intergenic
1076330071 10:129657628-129657650 GAGGAGGAGCTGGAGCTGGGGGG + Intronic
1076331624 10:129674696-129674718 CTGGGGGAGGTGGAGTAGCTGGG + Intronic
1076377999 10:130004382-130004404 GTTGAGGAAGTGGAGTGTGTGGG + Intergenic
1076532806 10:131155857-131155879 GTGAGGGAGGAGGAGTTGGCGGG - Intronic
1076589561 10:131573922-131573944 GTGGAGGATGTGGAGTCAGCTGG - Intergenic
1076853667 10:133104991-133105013 GTGGAGGAGGGGGAGGTGAGCGG - Intronic
1076948515 10:133666805-133666827 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076949502 10:133670115-133670137 GTGGTGGCGGTGGTGGTGGTGGG - Intronic
1076949525 10:133670162-133670184 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1076950486 10:133673414-133673436 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076950509 10:133673461-133673483 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076951473 10:133676713-133676735 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076952463 10:133680023-133680045 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076953449 10:133683333-133683355 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076953472 10:133683380-133683402 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076955419 10:133742984-133743006 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076956409 10:133746294-133746316 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076957397 10:133749603-133749625 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076958384 10:133752913-133752935 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076958407 10:133752960-133752982 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076959370 10:133756212-133756234 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076960357 10:133759522-133759544 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076960380 10:133759569-133759591 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1077013801 11:391256-391278 GTGGAGGGGCTGGACTTGGCTGG + Intergenic
1077156231 11:1092987-1093009 GTGAAGGTGGTGGGGGTGGTGGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077365510 11:2159976-2159998 GTGGGGCAGGTGGAGCTGGGCGG - Exonic
1077405294 11:2379859-2379881 CTGGGTGAGGTGGGGTTGGTGGG + Intronic
1077501145 11:2910219-2910241 GAGCAGGAGGTGGAGTGGGGTGG + Intronic
1077515325 11:2998379-2998401 CAGTAGGAGGTGGGGTTGGTGGG - Intergenic
1077651080 11:3973262-3973284 GTCGTGGAGGTGGTTTTGGTGGG - Intronic
1077657270 11:4032229-4032251 GTGGCTGAGGTGGGGTGGGTGGG + Intronic
1077661750 11:4074662-4074684 GAGGAGGAGTTGGAGCAGGTAGG + Exonic
1078238924 11:9512282-9512304 GTGGAGGTGGAGGAATTGGAAGG + Intronic
1078390563 11:10932149-10932171 GGAGAGGAGGAGGAGGTGGTGGG + Intergenic
1078479368 11:11662710-11662732 GTGGAGGTGGTGGGGATGGATGG - Intergenic
1078591045 11:12641030-12641052 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591061 11:12641070-12641092 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591070 11:12641090-12641112 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591079 11:12641110-12641132 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591096 11:12641150-12641172 GGGGATGATGTGGAGGTGGTGGG - Intergenic
1078591127 11:12641231-12641253 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078651647 11:13200347-13200369 GTGTTGGAGGTGGGCTTGGTGGG - Intergenic
1078662929 11:13301651-13301673 GTAGAGGAGATGGAGATGGAAGG + Intronic
1078779085 11:14420311-14420333 GTGGAGGAGAGGGAGTTTGTTGG - Intergenic
1079135879 11:17775770-17775792 GTGGAGGGGGTGGTGGTGGCCGG + Intronic
1079172080 11:18105977-18105999 GAGGAGGAGGAGGAGGTGGCCGG - Exonic
1079239114 11:18709962-18709984 GTGGATGTGGTGGAGATGGTTGG - Intronic
1079701924 11:23558739-23558761 GTGGAGGAGGGAGAGTTGATAGG - Intergenic
1079777229 11:24546978-24547000 GTGGTGGTGGTGGTGGTGGTTGG + Intronic
1080088125 11:28310944-28310966 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1082071617 11:47944020-47944042 GTGGCGGAGGTGGGGAGGGTGGG + Intergenic
1082106696 11:48228903-48228925 GTGGAGGGAGAGGAGTGGGTGGG + Intergenic
1082891797 11:58147021-58147043 CTGGTGGTGGTGGAGTTGGAGGG + Intronic
1083148804 11:60777178-60777200 AAGGAGGAGGGGGAGTTTGTTGG - Intergenic
1083156641 11:60827395-60827417 GAGGAGGAGATGGAGTCCGTAGG - Intergenic
1083482711 11:62959921-62959943 GTGGAGGAGGAGGAGAGGGGAGG + Intronic
1083728838 11:64642603-64642625 GTGGAAGTGGTGGACGTGGTGGG + Intronic
1083815946 11:65132506-65132528 CTGGGGGAGGGGGAGTTGTTGGG + Intronic
1083887858 11:65581507-65581529 GAGCAGGAGGGGGAGTTGGGGGG - Intronic
1084003730 11:66312735-66312757 GCGGAGGAGGTGGGGCTTGTAGG + Intergenic
1084254820 11:67933486-67933508 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084507226 11:69575817-69575839 GTGGTGGTGGTGGAGGTGGAAGG + Intergenic
1084685600 11:70693111-70693133 GTGGAGGAGGTGGGGTAGAGAGG - Intronic
1084849727 11:71929071-71929093 GTGGTGGAGGTGGAGGTTGGAGG + Exonic
1084978690 11:72816950-72816972 GTGGGGGTGGTGGAGGTGGTGGG + Intronic
1084978695 11:72816959-72816981 GTGGAGGTGGTGGGGGTGGTGGG + Intronic
1085161856 11:74355060-74355082 GTCGTGGAGGTGGTTTTGGTGGG + Intronic
1085293219 11:75415028-75415050 CTGGAGGTGGTGGACTGGGTGGG - Intronic
1085557756 11:77440886-77440908 ATGGAGGAGGTAGAGGTGGGAGG - Intronic
1085689124 11:78651331-78651353 GTGGCTGAGGTGGTGTGGGTGGG + Intergenic
1085733243 11:79017282-79017304 CTGGAGGAAGTGGGGTAGGTGGG + Intronic
1087188829 11:95231220-95231242 GTGGAGGTGGTGAAGGTGGTGGG - Intronic
1087226078 11:95600716-95600738 GTGAAGGTGGTGGGGATGGTGGG - Intergenic
1087307122 11:96500841-96500863 TTGCAGGAGGTGGAATTTGTGGG - Intronic
1087999126 11:104853133-104853155 GTGGAGGAAGTGGGGTTGAAAGG + Intergenic
1088996645 11:115006088-115006110 GTGGTGGTGGTGGTGATGGTTGG + Intergenic
1089323426 11:117641703-117641725 GGGCAGGAATTGGAGTTGGTGGG - Intronic
1089332126 11:117696937-117696959 GTGGAGGAGGTGGGGTTTTCAGG - Intronic
1089338575 11:117742531-117742553 TTGGAGGAGGTGGAGGTGACTGG + Intronic
1089579456 11:119472299-119472321 GTGGAGGGGGTGGTGGGGGTGGG + Intergenic
1089796879 11:120987916-120987938 GTGGTGGAGGTGGAGGTGGTTGG - Exonic
1089906654 11:122046836-122046858 GAGGAGGAGAGGGAGTAGGTGGG + Intergenic
1090185465 11:124736734-124736756 GTGGAGGGGGTGGAGGTAGCAGG - Intergenic
1090203799 11:124873999-124874021 GTGGATGAGATGGAGTAGGCAGG + Intronic
1090212847 11:124935137-124935159 CTGGTGGAGGGGGTGTTGGTAGG - Intronic
1090318449 11:125818471-125818493 CTGGAGGAAGGGGAGGTGGTGGG + Intergenic
1090385803 11:126356905-126356927 CTAGAGGAGGTGGAGTCTGTAGG - Intronic
1090452541 11:126819433-126819455 GTGGAGGAGCAGGAGTGGGCAGG + Intronic
1091460500 12:640870-640892 GTGGAGGGGTTGGAGTGGGGTGG - Intronic
1091548137 12:1518301-1518323 GTGGTGGAGGTGGAGGTGACGGG - Intergenic
1091668787 12:2437941-2437963 GTGGTGGTGGTGGTGATGGTTGG + Intronic
1091668835 12:2438165-2438187 GTGGTGGTGGTGGGGATGGTGGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091813793 12:3421091-3421113 ATGGAGGAGGAGGAGTGGGAGGG - Intronic
1091843706 12:3638425-3638447 GAGGAGGAGGAGGAGGTGTTTGG - Exonic
1092014971 12:5151102-5151124 TTGGAGGAGGAGGAGTTGAATGG - Intergenic
1092191964 12:6527801-6527823 GAGGAGGAGCTGGGGCTGGTTGG + Exonic
1092252097 12:6905233-6905255 GGAGAGGAGGAGGAATTGGTAGG + Intronic
1092424883 12:8366955-8366977 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1092704525 12:11268086-11268108 CTGGAGGAGGTGGGGTACGTTGG + Exonic
1093413344 12:18892864-18892886 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1094203480 12:27816584-27816606 GTGGAGGAGGAGGTGGTGGGTGG + Intergenic
1094282130 12:28752135-28752157 GTGGAGTAGGGGGAGGTGGGAGG - Intergenic
1094375468 12:29783962-29783984 GCGGAGGAGGTGGCGATGGCCGG - Intronic
1094476491 12:30844617-30844639 GTGGGGGAGGTGGCATTGGGGGG - Intergenic
1094606677 12:31955429-31955451 GTGGAGGTGGAAGAGTTGGCTGG + Intergenic
1095866336 12:46976450-46976472 GTGGTGGTGGTGGAGGTGGTAGG + Intergenic
1096231903 12:49901372-49901394 GGTGAGGAGGAGGAGTTGGAAGG - Intronic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096851063 12:54437742-54437764 GTGGCGGTGGTGGGGTTGGGTGG + Intergenic
1097186497 12:57199135-57199157 CTTGAGGAGGTGGAGTGGGCCGG + Intronic
1097188763 12:57209666-57209688 GGGGAGGAGGTGGAGTCAGAGGG - Intronic
1097630525 12:62056552-62056574 GTGTGGGAAGTGGGGTTGGTGGG - Intronic
1098035636 12:66299596-66299618 GAGGAGGAGGGGGAGGTGGAGGG - Intergenic
1098569942 12:71976965-71976987 GGGCAGGAGGTGGAGTAAGTGGG + Intronic
1099889946 12:88579243-88579265 GTGGAAGGGGTGGAAGTGGTGGG - Intronic
1100168380 12:91944598-91944620 GATAAGGAGATGGAGTTGGTAGG + Intergenic
1101032946 12:100677886-100677908 GTGGAAATGGTGGAGGTGGTAGG - Intergenic
1101508752 12:105373748-105373770 GTGGAGGCAGTGGAGGTGGGGGG - Intronic
1101762537 12:107670549-107670571 GTGGAGCAGGTGTGGTTGGGTGG + Intergenic
1101976658 12:109365520-109365542 GTGGAGGTGGTGAGCTTGGTTGG + Intronic
1102394324 12:112574441-112574463 GTGGAGGAGGTAGAGGGGGTAGG + Intronic
1102394478 12:112574912-112574934 GTGGAGGAGGGAGAGAGGGTGGG + Intronic
1102687525 12:114736155-114736177 TGGGAGGAGGTGGAGATGCTGGG + Intergenic
1102757228 12:115352070-115352092 GTGGAGGGGGTGTGGTTGTTGGG - Intergenic
1102961414 12:117095931-117095953 GTGGAGGAGTTGGAGATCATGGG - Intronic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104058300 12:125246912-125246934 GTGGGGGAGGTGGTGGGGGTAGG + Intronic
1104080747 12:125428653-125428675 GTGCAGGAGGTGAGCTTGGTTGG - Intronic
1104137073 12:125950826-125950848 ATGGATGTGGTGGAGTTGATTGG + Intergenic
1104177039 12:126342937-126342959 CTGGAGGAGGAGGTGTGGGTGGG + Intergenic
1104943483 12:132405450-132405472 GGGGAGGAAGTGGAGTTTCTGGG - Intergenic
1105374046 13:19827077-19827099 TTGGAGGAGTTGGAGTTGAAAGG + Intronic
1106546965 13:30739082-30739104 GTGGAGGCGGTGGAGGGGGGTGG - Intronic
1108401843 13:50053001-50053023 GTGGAAGAGGTGGAGGAGGTGGG - Intergenic
1108751007 13:53448284-53448306 GTGGATGGGGTGGGGTTGGTGGG + Intergenic
1109114010 13:58357799-58357821 GTGGAGGGAGTGGAGATGGATGG - Intergenic
1109322104 13:60823536-60823558 ATGGAGGGGGTGGGGCTGGTTGG + Intergenic
1109821382 13:67660364-67660386 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1110195060 13:72779751-72779773 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1110399557 13:75073811-75073833 GTGAAAGAGTTGGGGTTGGTAGG - Intergenic
1110814783 13:79849166-79849188 GTGGGGGAGGTGGCGGTGGAAGG + Intergenic
1111374506 13:87361121-87361143 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1112092646 13:96098356-96098378 GTGGCTGAGGTGGTGGTGGTTGG + Intronic
1112297679 13:98202623-98202645 GTGGGGCAGGAGTAGTTGGTAGG + Intronic
1112507339 13:99982753-99982775 GTGGTGGTGGTGGTGGTGGTGGG - Exonic
1112585600 13:100716152-100716174 GTGTAGGGGGTTGAGTGGGTGGG - Intergenic
1112693071 13:101917286-101917308 GTGGAGGGGGTGTAGTGGGGTGG - Intronic
1113707260 13:112442919-112442941 GTGGAGGAGGTGGTGCTGCTGGG - Intergenic
1113909916 13:113836832-113836854 GAGGAGGAGGGGGAGTGGGGGGG + Intronic
1114162043 14:20179240-20179262 GTGAAGGTGCTGGAGTTGCTGGG - Intergenic
1114163688 14:20197456-20197478 GTGAAGGTGCTGGAGTTGCTGGG - Exonic
1114927654 14:27423553-27423575 GTGTTGGAGGGGGACTTGGTAGG - Intergenic
1115273765 14:31583803-31583825 GAGAAGGAGGTAGAATTGGTAGG + Intronic
1115322519 14:32099020-32099042 TTGGAGCAGCTGGAGTTGGGAGG + Intronic
1115496303 14:34008027-34008049 GGAGAGGAGGAGGAGTGGGTTGG - Intronic
1115518108 14:34205803-34205825 GTGGAGGGAGAAGAGTTGGTTGG - Intronic
1116658148 14:47675694-47675716 GTGGAGGGGGTGGGGACGGTCGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117913186 14:60653402-60653424 GTGTGGGCGGTGGAGGTGGTGGG - Intronic
1118244103 14:64091647-64091669 GTGGTGGCGGTGGTGGTGGTTGG + Intronic
1118261901 14:64255565-64255587 GTGGTGGAGCTGGACTTGGGGGG - Intronic
1118600657 14:67469652-67469674 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1118715502 14:68556863-68556885 GTGGAGAAGGTGGGGTGGGGTGG - Intronic
1119663536 14:76467849-76467871 GAGGAGGAGGTGAAGTTGGCGGG - Intronic
1119764484 14:77179781-77179803 CTCTAGGAGGTGGAGTGGGTTGG + Intronic
1120578829 14:86220958-86220980 GTGGCGGAGCTGGAGGTGGGTGG + Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121735481 14:96214840-96214862 CTGGAGGTTGGGGAGTTGGTGGG + Intronic
1121810257 14:96880482-96880504 GTGGAGTAGGAGTAGTAGGTGGG + Intronic
1122177033 14:99928227-99928249 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1122214557 14:100194225-100194247 GTGGTGGAGGTGGGGCTGGATGG - Intergenic
1122292300 14:100686572-100686594 GTGGAGGAGGCTGAGGTGGAGGG - Intergenic
1122506839 14:102236990-102237012 GTGTAGCAGGTGGTGTTGGAGGG - Intronic
1122782668 14:104150200-104150222 GAGGAGGAGGAGGAGGGGGTGGG - Intronic
1122901675 14:104784653-104784675 GTGGTGGTGGTGGGGTGGGTTGG - Intronic
1123440728 15:20289242-20289264 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1124059517 15:26276651-26276673 CTTTAGGAGGTGGAGTTGGGAGG + Intergenic
1124067932 15:26363424-26363446 GTGGAGGGATTGGAGGTGGTGGG + Intergenic
1124466991 15:29949031-29949053 GTGGCGGAGGTGATGGTGGTGGG - Intronic
1124634735 15:31357798-31357820 GGGGTGGGGGTGCAGTTGGTGGG - Intronic
1125076069 15:35620084-35620106 GAGGTGGAGGTGGAGGTGGGAGG - Intergenic
1125320657 15:38484394-38484416 GTAGAGGAGGTGGTGGGGGTGGG + Exonic
1125380392 15:39080731-39080753 TTGGAGGGTGTGGAGATGGTGGG - Intergenic
1125476532 15:40051428-40051450 GTGAAGGAGGTGGACTTTGAAGG + Intergenic
1125676970 15:41507328-41507350 GTGGGGGAGGGAGAGTTGATGGG - Intronic
1125833096 15:42729930-42729952 GTGCAGGAGGTGGGGTGGGTTGG - Intronic
1126756539 15:51930810-51930832 AAGGAGGAGGCAGAGTTGGTGGG + Intronic
1127778987 15:62294983-62295005 TTGAAGGAGGTGGTGATGGTGGG + Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128109374 15:65067199-65067221 GTGGAGGGGGAGGGGTTGGACGG + Intronic
1128223025 15:65982146-65982168 GTAGAGGAGGTGGAGGGGCTGGG - Intronic
1128228010 15:66015920-66015942 GTGGGGTAGTGGGAGTTGGTGGG + Intronic
1128377552 15:67088319-67088341 TTGGAGGAGGTGAGGTGGGTGGG + Intronic
1128546205 15:68569893-68569915 GAGAAGGAGGTGGAGTGGGAGGG - Intergenic
1128695819 15:69761847-69761869 GTGGAGGAGGTGGTGCTGAAAGG - Intergenic
1128801688 15:70501159-70501181 GTGGGGGTGGTGGAGTGGGTAGG + Intergenic
1128815165 15:70602906-70602928 GTCTAGGAGGTGGAGATGCTGGG + Intergenic
1129310975 15:74708745-74708767 GTGGAGGAGAGGGGGTGGGTTGG + Intergenic
1129412670 15:75358663-75358685 GTGGGGATGGTGGAGGTGGTGGG - Intronic
1129465750 15:75723366-75723388 GGGGAGCAGTTGGAGTTGGAGGG - Intergenic
1129600258 15:76994609-76994631 GTGGTGGCGGTGGTGGTGGTGGG + Intronic
1129624768 15:77185363-77185385 GCTGAGGAGGTGGCCTTGGTGGG + Intronic
1129756413 15:78101709-78101731 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1129830880 15:78669183-78669205 GAGGAGGAGATGGGGATGGTCGG + Intronic
1130010969 15:80152812-80152834 GTGGAGGACCTGGAGCTGGCGGG + Exonic
1130062918 15:80582564-80582586 GTGGAGGAGGTGGGGAGGGCTGG - Intronic
1130394871 15:83493226-83493248 GTGGTGGTGGTGGAGGTGGAGGG + Intronic
1130875698 15:88012171-88012193 GTGGAGGATGTAGAGATGGCAGG - Intronic
1131072975 15:89477488-89477510 GTGGAGGAGGTGCGGTGGGATGG - Intronic
1131356227 15:91749352-91749374 GTGGAGGTGGAGGTGGTGGTGGG + Intergenic
1131356471 15:91750255-91750277 GTGGTGGAGGTGGAGGTGGTTGG + Intergenic
1131356592 15:91750827-91750849 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1131356603 15:91750869-91750891 GTGGTGGAGGTGGAGGTGGTAGG + Intergenic
1131356623 15:91750953-91750975 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356634 15:91750995-91751017 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356645 15:91751037-91751059 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131435158 15:92416336-92416358 GTGGAAGGGGTGGAGGTGGGTGG + Intronic
1131540371 15:93270366-93270388 GTGTGGGAGGTGGATTTGGAGGG + Intergenic
1131675622 15:94667446-94667468 GTGAAGGAGGCGGTGGTGGTAGG - Intergenic
1132292029 15:100710521-100710543 ATGGTGGAGGTGGAGGTGGTGGG + Intergenic
1132482926 16:175574-175596 GTGGAGGAGGTGGAGGAGGGAGG - Intergenic
1132516460 16:368377-368399 GAGGAGGAGGCAGAGTGGGTGGG - Exonic
1132672233 16:1106615-1106637 GAGGTGGAGGTGGAGGGGGTGGG - Intergenic
1132751575 16:1460110-1460132 GAGGCGGAGGTGGAGATGGAAGG + Intronic
1132883026 16:2170713-2170735 GAGGAGGAGGAGGAGCCGGTAGG + Exonic
1132927846 16:2440843-2440865 CTGTAGGAGGTTGAGTTGGGAGG + Intronic
1132976874 16:2715470-2715492 GTGGAGGGGATGGAGGGGGTCGG + Intronic
1133099483 16:3470502-3470524 GGGAAGGACGTGGAGCTGGTTGG - Intronic
1133321042 16:4914053-4914075 CTGGAGGAGGTGGTGTCGGCTGG + Intronic
1133373358 16:5263077-5263099 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1133425291 16:5683142-5683164 GGGGTGGAGGTGGAGGTGGGGGG + Intergenic
1133460700 16:5984065-5984087 GAGGAGGAGGGGGAGTGGGAGGG - Intergenic
1133460711 16:5984090-5984112 GAGGAGGAGGGGGAGTGGGAGGG - Intergenic
1134122841 16:11596819-11596841 GGGGAGGAGGAGGAGGTGGTGGG + Intronic
1134512634 16:14860577-14860599 GAGGAGTAGATGGATTTGGTAGG + Intronic
1134700270 16:16259072-16259094 GAGGAGTAGATGGATTTGGTAGG + Intronic
1134763966 16:16739535-16739557 GTGGAGGAGGTGGAGGTGATAGG + Intergenic
1134971553 16:18535587-18535609 GAGGAGTAGATGGATTTGGTAGG - Intronic
1134982088 16:18619628-18619650 GCGGAGGAGGTGGAGGTGATAGG - Intergenic
1135631120 16:24036216-24036238 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1135632926 16:24049998-24050020 GTGGACAAGTAGGAGTTGGTAGG + Intronic
1135720307 16:24811735-24811757 GTGGAGGAAGTGGAATTGACAGG + Intronic
1135983495 16:27166996-27167018 GTGGAGTGGGTGGGCTTGGTGGG - Intergenic
1136023060 16:27452199-27452221 AGGGAGGAGGTGGTGTTGGTTGG + Intergenic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1136317506 16:29463062-29463084 GCGGAGGAGGGGGAGCTGGTGGG + Intronic
1136383275 16:29906989-29907011 GGGGAGCAGCTGGAGCTGGTGGG - Exonic
1136432081 16:30202407-30202429 GCGGAGGAGGGGGAGCTGGTGGG + Intronic
1136726126 16:32359148-32359170 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1136788238 16:32947918-32947940 ATGCAGGAGGTGGAGTGGGCTGG - Intergenic
1136844458 16:33565193-33565215 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1137049950 16:35700635-35700657 GTGGAGTGGGTGGAGGGGGTAGG + Intergenic
1137327383 16:47455523-47455545 GAGGTGGAGGTGGAGGTGGGTGG + Intronic
1137627111 16:49916183-49916205 GTGTTGGAGGTGGGGCTGGTGGG + Intergenic
1137685478 16:50383720-50383742 CAGAGGGAGGTGGAGTTGGTTGG + Intergenic
1137715725 16:50597163-50597185 GTGGAGGAGGTGGCAATGATTGG + Intronic
1137788290 16:51154304-51154326 GTGGAGGAGGGGGGGATGGGAGG + Intergenic
1137798237 16:51239723-51239745 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1137798253 16:51239782-51239804 GTGGTGATGGTGGAGGTGGTGGG + Intergenic
1138019547 16:53465843-53465865 ATGGAGGAGGCAGAGGTGGTGGG + Intronic
1138086993 16:54142407-54142429 TTGGAGGAGGGGGGGTTGGCAGG + Intergenic
1138128588 16:54458907-54458929 GTGGGGGTAGTGGAGATGGTGGG - Intergenic
1138247563 16:55479067-55479089 GTGGAGGAGGGCGAGTAGGGGGG + Exonic
1138360257 16:56422429-56422451 GGGGAGGAGGTGAAGGAGGTGGG - Intronic
1138563031 16:57813461-57813483 GTGGAGGGGGTGGAGTAGCGTGG - Intronic
1138601221 16:58055760-58055782 GTGAAGGGGGTGGAGGTGGGAGG + Intergenic
1138765232 16:59594474-59594496 GTGGGGTAGGGGGAGTAGGTGGG - Intergenic
1139066777 16:63325404-63325426 GAGGAGGAGGGGAAGTTGGCAGG + Intergenic
1139099116 16:63744234-63744256 GTGGGGGAGGCTGAGGTGGTGGG - Intergenic
1139136087 16:64206233-64206255 GTGGAGGGGGTGGGGGTGGGGGG + Intergenic
1139165756 16:64563332-64563354 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1139481593 16:67233887-67233909 GAGGTAGAGGTGGAGGTGGTGGG + Exonic
1139504591 16:67392646-67392668 GTGGAGGAGGGGGATGTGGTGGG - Intronic
1140124053 16:72105731-72105753 GTGGAAGTGGTGGTGGTGGTGGG + Intronic
1140840443 16:78833415-78833437 GAGGAGGAGGAGGAGATGGCTGG - Intronic
1141139684 16:81489290-81489312 GAGGAGGAGCTGGAGTTGGTGGG + Intronic
1141181210 16:81754336-81754358 GGGGAGGAGGTGGGGATGGGCGG - Intronic
1141490914 16:84372075-84372097 GTAGAGGCGTTGGGGTTGGTAGG + Intronic
1141556505 16:84839889-84839911 GAGGTGGAGGTGGAGGTGGGGGG + Intronic
1141703606 16:85653255-85653277 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703625 16:85653302-85653324 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1142087779 16:88193279-88193301 GTGGTGGAGATGGTGGTGGTGGG + Intergenic
1142125966 16:88410896-88410918 CTGGAGGAGGAGGAGGTGGGAGG - Intergenic
1142143127 16:88481409-88481431 GTGGTGGGGGTGGGGGTGGTGGG - Intronic
1142144193 16:88485962-88485984 AGAGAGGAGGTGCAGTTGGTGGG + Exonic
1142423419 16:89987411-89987433 GAGGAGGTGGAGGAGGTGGTGGG + Intergenic
1203000305 16_KI270728v1_random:158608-158630 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1203131907 16_KI270728v1_random:1695011-1695033 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1203154625 16_KI270728v1_random:1865492-1865514 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1142592344 17:1011923-1011945 GTGGAGGAGGTGGAGAAGAGGGG - Exonic
1142641426 17:1288231-1288253 GTGGGGGATGGGGAGCTGGTGGG - Intronic
1142642924 17:1295197-1295219 GTGGAGGAGGTGGCGGTGGCAGG - Intronic
1142703887 17:1682082-1682104 GTGGTGGTGGTGGTGGTGGTTGG - Intronic
1142899615 17:3004001-3004023 GAGGAGGAGGGGGAGTGGGGTGG + Intronic
1143338917 17:6194132-6194154 GTGGAGGTGGTGGTGGTGATGGG + Intergenic
1143523967 17:7462020-7462042 TTGGGGGAGGTGGTGTTGGTGGG + Exonic
1143611725 17:8021846-8021868 GGTGAGGAGGTGGAGTAGATGGG - Intergenic
1143700891 17:8659238-8659260 GTGGAGGCAGTGGTGGTGGTGGG + Intergenic
1143871089 17:9957729-9957751 GTGGAGTTGATGGAGCTGGTGGG - Intronic
1144061627 17:11588086-11588108 CTGGAAGAGGTGGAGTTGTGGGG + Intergenic
1144139631 17:12336278-12336300 GTGGAGGTGGTGGGGGTGGGGGG + Intergenic
1144777814 17:17793597-17793619 GAGGAGTAGGTGGAGGAGGTGGG - Exonic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1145261206 17:21355838-21355860 GTGGGGGAGGTGGCAGTGGTGGG - Intergenic
1145748442 17:27337826-27337848 TAGTAGGAGGTGGAGTTGGGTGG + Intergenic
1145786505 17:27597310-27597332 GTGGAGGAGGTGGTGGAGGAAGG - Exonic
1146454972 17:33002331-33002353 AGGGAGGAGGTGGAGTTGCAAGG - Intergenic
1147125435 17:38364810-38364832 GAGGAGGAGGGGGAGTTGGAGGG - Exonic
1147125523 17:38365375-38365397 GTGGAGGAGGCGGAGGTAGGGGG - Exonic
1147134120 17:38425512-38425534 GAGGAGGGGGTGGGGTAGGTTGG - Intergenic
1147308501 17:39579765-39579787 GCGGGGGAGGAGGGGTTGGTGGG - Intergenic
1147384375 17:40072748-40072770 GGGGAGGAGAAGGAGTGGGTGGG - Intronic
1147562675 17:41518732-41518754 CTGGGGGAGGTGGCTTTGGTGGG - Exonic
1147610533 17:41799404-41799426 GTGGAGGAGGTGAAGCTGTCTGG + Intergenic
1148820970 17:50359427-50359449 GAGGAGGAGGGGGTGCTGGTGGG + Intronic
1149048048 17:52270432-52270454 CTGCAGGAGGAGGAGTTGGGTGG + Intergenic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1149517789 17:57293431-57293453 GAGGAGGAGGCGGAGGTGGAAGG - Intronic
1149626300 17:58083208-58083230 GAGGAGGAGCTGGAGCGGGTGGG - Intergenic
1149648370 17:58257257-58257279 GGGGCGGAGGTGGAGATGGTTGG - Intronic
1149966606 17:61170755-61170777 GTGGAGGAGATAGAGGTGGGAGG + Intronic
1150137142 17:62702244-62702266 GTGGAGGAGGTGGAGTTGGTGGG + Intronic
1150148864 17:62793287-62793309 GTGATGGAGGTGGTGGTGGTGGG - Intronic
1150438144 17:65169919-65169941 GTGGAGGTGGTGGAGAAAGTGGG - Intronic
1151223078 17:72627942-72627964 GTGGCGGATGAGGAGTTGCTTGG - Intergenic
1151293531 17:73166788-73166810 GTGAAGGTGGTGGAGGTGGGAGG - Intronic
1151440704 17:74127036-74127058 ACAGAGGAGGTGGAGTGGGTGGG - Intergenic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1151852191 17:76697649-76697671 ATGGAGGAGGTGGAGGCGGGAGG + Intronic
1152045946 17:77935758-77935780 GCGGGGGAGGGGGAGGTGGTGGG + Intergenic
1152441635 17:80313423-80313445 GTGGAGGTGATGGTGATGGTTGG + Intronic
1152441647 17:80313472-80313494 GTGGAGGTGATGGTGATGGTTGG + Intronic
1152553402 17:81040915-81040937 GAGGAGGCTGTGGAGATGGTGGG + Intronic
1152561141 17:81079339-81079361 GAGGTGGAGGTAGAGCTGGTGGG + Intronic
1153061980 18:1004293-1004315 GTGTTGGAGGTGGGGTTTGTGGG - Intergenic
1153081205 18:1227342-1227364 GGGCAGCGGGTGGAGTTGGTGGG - Intergenic
1153522169 18:5963480-5963502 GAGGATGAGGTGGAGGTGGCAGG - Intronic
1153581516 18:6578585-6578607 GTGGAAGAGCAGGAGATGGTGGG + Intronic
1154177437 18:12094420-12094442 GTGGTGGGGGTAGAGTTGGGTGG + Intronic
1154177545 18:12094705-12094727 GTGGTGGGGGTAGAGTTGGGTGG + Intronic
1154290983 18:13106507-13106529 GTGGTGGTGGTGGTGGTGGTAGG - Intronic
1154303027 18:13211358-13211380 GTGGGGGAGGAGGAGTGGGGAGG + Intergenic
1155107575 18:22682899-22682921 GTGGAGGAGGTGGGATTTGAAGG - Intergenic
1156112640 18:33745956-33745978 GTGGAGGTAGCGGAGGTGGTGGG - Exonic
1156185289 18:34655345-34655367 GTGGGGGAGGAGGCCTTGGTGGG - Intronic
1156561138 18:38127033-38127055 GGGGAGGAGGAGGAGGTGGTGGG - Intergenic
1157202503 18:45671262-45671284 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1157353702 18:46914562-46914584 GTGTCGGGGGTGGAGTTGGGGGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157404455 18:47411329-47411351 CTGGAGGAGGTGAAGTGGGAAGG + Intergenic
1157907723 18:51584548-51584570 GTGAAGGAGGTAGTTTTGGTGGG + Intergenic
1158232147 18:55269018-55269040 AGGGAAGAGGTGGAGTTGGTGGG - Intronic
1158610359 18:58935089-58935111 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1158610365 18:58935105-58935127 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1158610371 18:58935121-58935143 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1158610377 18:58935137-58935159 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1158610383 18:58935153-58935175 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1158610389 18:58935169-58935191 GGGGAGGAGGAGGAGTGGGGAGG - Intronic
1159187157 18:64989864-64989886 GTGGAGGAGGCTGAGAAGGTAGG - Intergenic
1160057031 18:75492680-75492702 TTGCAGGAGGTGGCGTTGGAAGG - Intergenic
1160100655 18:75916774-75916796 GTGGGGCAGGTGGGGTCGGTGGG - Intergenic
1160326768 18:77957437-77957459 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160326847 18:77957850-77957872 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160326859 18:77957900-77957922 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160326869 18:77957953-77957975 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160326892 18:77958059-77958081 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160326914 18:77958162-77958184 GTGGTGGTGTTGGAGTTGTTGGG - Intergenic
1160388844 18:78515092-78515114 GTGGAGGAGGTGGTGCAGGCAGG + Intergenic
1160403544 18:78629047-78629069 GTGGAGCTGGTGGAGATGGCGGG + Intergenic
1160417167 18:78719545-78719567 GTGGAAGAGGAGGAGAAGGTTGG - Intergenic
1161021487 19:2013579-2013601 GTGGCGGAGCTGGAGGTGGGTGG + Intronic
1161093395 19:2374980-2375002 GTGGAGGAGCTGGTGCTGGGCGG + Intergenic
1161151660 19:2713263-2713285 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151672 19:2713307-2713329 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151706 19:2713439-2713461 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151761 19:2713659-2713681 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151786 19:2713747-2713769 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151811 19:2713835-2713857 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151835 19:2713923-2713945 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151847 19:2713967-2713989 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151910 19:2714187-2714209 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161903862 19:7140303-7140325 GTGGACCAGGTTTAGTTGGTGGG - Intronic
1162118634 19:8447511-8447533 GTGGAGGAGAAGAAGATGGTTGG + Intronic
1162235996 19:9309915-9309937 GTGAAGGGGGTGGAGCAGGTAGG + Intergenic
1162386121 19:10361638-10361660 GTGGAGGAGGTGGGATGGGAGGG - Intronic
1162386132 19:10361669-10361691 GTGGAGGAGGTGGGATGGGAGGG - Intronic
1162461014 19:10814089-10814111 GAGGTGGAGGTGGAGTTTGCAGG + Intronic
1162469306 19:10862877-10862899 GGGGAGGAGGAGGAGCTGGCAGG + Intronic
1162857490 19:13480222-13480244 GTGGCAGAGGTGGAGGTGGAAGG - Intronic
1163171187 19:15532344-15532366 GTGGAGGAGGAGGAGGGGGATGG - Intronic
1163342674 19:16719699-16719721 GTCTAGGAGGTGCAGTTGGTTGG - Intergenic
1163345218 19:16737027-16737049 GTGGAGGGGGTGGGGAAGGTGGG - Intronic
1163411514 19:17157932-17157954 GTGGAGGAGGAGGGGATGGCAGG - Intronic
1163462124 19:17445315-17445337 GTTCAGGAAGTGGAGCTGGTGGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163715741 19:18870947-18870969 GTGGAGGCGGTGGAGTTGTCAGG - Intronic
1163718438 19:18886047-18886069 GAGGAGGAGGTGGACGTGGTGGG - Intronic
1164563961 19:29312616-29312638 GTGGAGCAGGGGGAGGTGGGAGG + Intergenic
1165264647 19:34649970-34649992 GTGGAGGAAGAGGAAATGGTGGG - Intronic
1165411696 19:35666241-35666263 GTGGAGGAGTTGGAGGTGGAGGG - Intergenic
1165861225 19:38910614-38910636 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1165948259 19:39458231-39458253 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1166210828 19:41305732-41305754 GTGGTGGAGGTGGAGGCGGTGGG - Exonic
1166312374 19:41970009-41970031 GAGGAGGAGGTGGAGAAGGATGG + Intronic
1166647516 19:44543177-44543199 GGGGAGGTGGTGGTGGTGGTAGG - Intergenic
1166712416 19:44945792-44945814 GTGGAGGGGTTGGAGGTGCTGGG - Intronic
1166831939 19:45644555-45644577 GTGGAGGTGTGGGGGTTGGTAGG - Intronic
1167201656 19:48069497-48069519 GAAGAGGAGGTGGAATTGGCAGG - Intronic
1167363431 19:49042439-49042461 GTGCTGGAGGTGGAGGTGTTGGG + Intergenic
1167382856 19:49148798-49148820 GTGGAGGGCGTGGAGCTGGATGG + Intronic
1167456963 19:49601516-49601538 GGGCAGGAGGTGGAGTGGGTGGG - Exonic
1167608216 19:50492978-50493000 GAGGAGGAGGTGGAGTAAGAGGG + Intergenic
1167711758 19:51115944-51115966 GTGTAGGAGGTGAAGTGGGGTGG - Intergenic
1168137275 19:54360110-54360132 GTGGAGGAGGGCAGGTTGGTTGG - Intronic
1168160802 19:54508975-54508997 GTGGAGGAGGGCAGGTTGGTTGG + Intronic
1168260614 19:55191955-55191977 GCGGAGGAGGAGGAGGAGGTAGG - Intronic
1168277135 19:55284483-55284505 GTGGGGGTGGGGGAGGTGGTAGG - Exonic
1168416765 19:56174324-56174346 GAGGAGGAGGAGGAGTGGGCAGG - Intergenic
1168443405 19:56391407-56391429 GCAGGGGAGGTGGTGTTGGTTGG - Intronic
1202702810 1_KI270713v1_random:1103-1125 GTGGCGGTGGTGGTGGTGGTGGG - Intergenic
925003480 2:424653-424675 GTGGAGGTGGTGGAGGTGGGTGG - Intergenic
925003481 2:424656-424678 GTGGTGGAGGTGGTGGAGGTGGG - Intergenic
925600909 2:5607940-5607962 GTGGATGAGGTGGAGTTTGAAGG + Intergenic
925849880 2:8069785-8069807 TTGGAGGTGGTGGAGGTAGTTGG - Intergenic
926783540 2:16497969-16497991 GTGGTGGGGGTGGGGGTGGTGGG + Intergenic
926907384 2:17818073-17818095 GTGGGGGATCTGGAGTTGGGGGG - Intergenic
927393880 2:22627246-22627268 GGGGAGGATGAGGAGGTGGTAGG - Intergenic
927448175 2:23184226-23184248 GTGGAAGTGGTGGAGGTGGGTGG - Intergenic
927574158 2:24187366-24187388 GTGGAGGAGGTTGTGTTTGTTGG - Intronic
927756729 2:25714365-25714387 GTGGTGAAGATGGAGGTGGTGGG + Intergenic
928674501 2:33637111-33637133 GTTGTGGAGGTGGTTTTGGTGGG + Intergenic
929883486 2:45857938-45857960 GTGGAGGTGGCTGAGTTGCTTGG + Intronic
929960288 2:46491020-46491042 GTGGAGGAGGTGGGGAGGGCAGG + Intronic
930198548 2:48531276-48531298 GTGGGGGTGGGGGAGTTGGGAGG - Intronic
931077493 2:58732850-58732872 GTCGAGGAGGAAGAGTAGGTAGG + Intergenic
931200963 2:60096927-60096949 ATGGAGGAGGTGGGGTGGTTAGG + Intergenic
931489162 2:62725611-62725633 CTGGTGGGGGTGGAGTTGGATGG + Intronic
931578346 2:63744815-63744837 GTGCAGGAGGTGGGGTGGGTAGG - Intronic
931904003 2:66822448-66822470 GTGGGGGATGTGGGGTTGCTGGG + Intergenic
932355436 2:71064635-71064657 GAGGTGGAGGTGGAGGTGGGGGG - Intronic
932474333 2:71992204-71992226 GTGGTGGAGGTGGAGAGGGGTGG - Intergenic
932515304 2:72341008-72341030 GAGGAGGAGGTGGAGGTGGAAGG + Intronic
932757418 2:74418027-74418049 CTGGAGGCGGTGGTGATGGTGGG + Intronic
933183598 2:79254319-79254341 GTGTTGGAGGTGGGGCTGGTGGG + Intronic
933289336 2:80420454-80420476 GTGGTGGTGGTGGTGGTGGTAGG - Intronic
933506309 2:83181101-83181123 TGGGAGGGGGTGGAGTTGGCGGG + Intergenic
934044889 2:88164759-88164781 GAGGTGGAGGTGGTGGTGGTGGG + Intergenic
935157631 2:100497275-100497297 GTGGAGGAGAGGGAGGCGGTGGG - Intergenic
935649557 2:105370574-105370596 GTGGGGGGTGTGGAGCTGGTGGG + Intronic
935786826 2:106557129-106557151 GAGGAGGGGGTGAAGTTGGCAGG + Intergenic
936343175 2:111655456-111655478 TTGGAGGTGGTGGGGGTGGTGGG - Intergenic
936962265 2:118088480-118088502 GTGGAGGAGGAAGAGGCGGTAGG + Exonic
937353542 2:121184170-121184192 GTGATGGTGGTGGGGTTGGTGGG - Intergenic
937496713 2:122428206-122428228 GTGTGGAAGGTGGAGTTGCTGGG - Intergenic
938579530 2:132633830-132633852 GTGGAGGTGATGATGTTGGTGGG + Intronic
939680787 2:145129519-145129541 GTGGCAGAGGTGGAGGAGGTTGG - Intergenic
941072115 2:160967087-160967109 TGGGAGGAGGTGGAGATGGGAGG + Intergenic
941248467 2:163131500-163131522 TTGGATGAGATGGAGTGGGTTGG - Intergenic
941285847 2:163611144-163611166 GTGGCGGAGGAGGTGGTGGTGGG + Exonic
942629489 2:177940091-177940113 GAGGAGGAGGAGGAATGGGTAGG + Intronic
942695969 2:178645959-178645981 GTGGAGCAGGTGGAGGAGGTGGG + Exonic
943756463 2:191561974-191561996 GTGGAAGAAGTGGATTTGGGAGG - Intergenic
944000746 2:194834731-194834753 GTGGAGTAGGGGGAGTGGGGAGG - Intergenic
945036024 2:205704582-205704604 ATGGGTGAGGTGGAGTTGCTGGG - Intronic
945117204 2:206419602-206419624 GTCGTGGAGGTGGTTTTGGTGGG - Intergenic
946104009 2:217353322-217353344 GTGGAGGGGTTGGGGTTTGTGGG + Intronic
946690262 2:222304082-222304104 GTGGAGGAGGCAGAGTTGTCAGG + Exonic
947389586 2:229625413-229625435 GTGGAGGAGGCTGGGTTGATGGG - Intronic
947760945 2:232603411-232603433 GAGGAGGAGGAGGAGGTGGAAGG + Intergenic
947829244 2:233127079-233127101 GAGGAGGAGATGGAGTTGGCGGG - Intronic
948005006 2:234601028-234601050 GTTGAGGAGGTGGAGATGGGTGG + Intergenic
948209034 2:236178820-236178842 GGGGAGGCGGGGGAGTTGGGGGG - Intergenic
948375844 2:237519768-237519790 GTGGAGGGGGTGGATGTGCTGGG + Intronic
948413714 2:237784948-237784970 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948665296 2:239530809-239530831 GTGGAGGAGGAGGTGTCGGCTGG + Intergenic
948765660 2:240217477-240217499 GTGGAGCCGGTGGAGGTGGACGG - Intergenic
948765729 2:240217736-240217758 GTGGAGATGGTGGAGATGGGTGG - Intergenic
948840635 2:240647169-240647191 GTGGAGGAGGGAGAGTGGCTGGG + Intergenic
948883191 2:240870691-240870713 CTGCAGGAGGTGGAGGAGGTAGG + Exonic
948933094 2:241144749-241144771 TTGGAAGAGGTGGTGTTGGGAGG - Intronic
948939227 2:241187829-241187851 GAGGAGGAGGAGGAGTTGGGGGG + Intergenic
1168847070 20:952557-952579 GTGCAGCAGGTGGAGATGGGTGG + Intergenic
1169687815 20:8295954-8295976 TTGGAGGAGGTAGAGGTGGGAGG - Intronic
1170150334 20:13221212-13221234 GAGGAGGAGGAGGAGTAGGAGGG - Intergenic
1170329465 20:15192507-15192529 GTGGCAGAGGTGGTGCTGGTAGG - Intronic
1170714416 20:18819648-18819670 GTGGAGGCGGGGGAGTTGGTAGG - Intronic
1170850375 20:19998886-19998908 GTGGAGGAGGGTGTGTTGGCAGG - Intronic
1171154402 20:22859150-22859172 GTGGTGGACATGGGGTTGGTGGG + Intergenic
1171178218 20:23070965-23070987 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1171448763 20:25222178-25222200 GAGGAGGAGGTGGTGTGGCTTGG + Intronic
1172194547 20:33083187-33083209 GTGGAGGAGGTGGCAGTGGTGGG + Intronic
1172240827 20:33411483-33411505 CTGGGGGAGGTGGAGGTGGGTGG - Intronic
1172302973 20:33862910-33862932 GAGGAGGCGGTGGAGTGGGGCGG + Intergenic
1172392721 20:34576849-34576871 GTGGAAGAGGTGGAGGTGGGGGG - Intronic
1172482447 20:35278792-35278814 GTGGAGGTGGTGAACTGGGTTGG + Intergenic
1172679257 20:36699671-36699693 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1172846282 20:37931556-37931578 GTGAAGGAGGTGGAGAACGTAGG - Intronic
1173167351 20:40694913-40694935 GTGGGGGAGGTGTAGTGGGAAGG - Intergenic
1173349618 20:42232986-42233008 TTGCAGCAGGAGGAGTTGGTTGG - Intronic
1173581971 20:44153530-44153552 GGGGAGGAGATGGAGGTGGGGGG + Intronic
1173611650 20:44372633-44372655 ATTTGGGAGGTGGAGTTGGTGGG + Intronic
1173656836 20:44705262-44705284 GTGGAGGAGGTGGTTTTGAAAGG - Intergenic
1173693631 20:44986812-44986834 GTGGGAGAAGTGGAGTAGGTTGG + Intronic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1173988691 20:47283038-47283060 GTGTTGGGGGTGGGGTTGGTGGG - Intronic
1174545902 20:51324891-51324913 TGGGAGTAGGTGGAGTAGGTGGG + Intergenic
1174614194 20:51823378-51823400 GAGGAGGATGTGAAGTTGGTGGG + Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175339936 20:58222234-58222256 GTGGAGGAGGAGGAGCGGGAGGG + Intronic
1175650928 20:60722051-60722073 GTTGAGGAGACAGAGTTGGTGGG - Intergenic
1175979183 20:62728374-62728396 GAGGAGGGGGTGGAGCTGGGTGG + Intronic
1176048727 20:63105588-63105610 GTGGCGGAGGTGGGGTTGCCAGG - Intergenic
1176058562 20:63161618-63161640 CTGGAGGCGGAGGAGGTGGTGGG - Intergenic
1176257128 20:64158474-64158496 GTGGGGCAGGTGGAGCAGGTGGG - Intronic
1176304025 21:5114144-5114166 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304038 21:5114184-5114206 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304063 21:5114264-5114286 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304076 21:5114304-5114326 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1177327236 21:19606836-19606858 GTGGACGCAGTGGGGTTGGTGGG + Intergenic
1178340842 21:31784660-31784682 GTGGTGGTGGTGGTGGTGGTTGG - Intergenic
1178343628 21:31806624-31806646 GTGTTGGAGGTGGACTGGGTAGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178580276 21:33832202-33832224 GTGGAGAGGTTGGAGCTGGTTGG - Intronic
1178752301 21:35316583-35316605 GTGGAGGAGCTGACTTTGGTTGG + Intronic
1178771991 21:35513874-35513896 GTGGAAGAGGTAGAGATGGATGG - Intronic
1179141539 21:38730202-38730224 GGGGCTGGGGTGGAGTTGGTGGG - Intergenic
1179250149 21:39665254-39665276 GTGGAGGGGCAGGAGGTGGTTGG - Exonic
1179771743 21:43624527-43624549 GTGGAGGAGGAGGGATTGGCAGG + Intronic
1179831294 21:43998305-43998327 GTGGAGGAGATGGAGCTGCAGGG + Intergenic
1179852968 21:44147686-44147708 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179852993 21:44147766-44147788 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179853006 21:44147806-44147828 GTGGAGGAGCTGGGAGTGGTAGG - Intergenic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180177528 21:46097934-46097956 CTGGAGGAGGTGGAGAGGGTGGG - Intergenic
1180249036 21:46567398-46567420 GTGGTGGTGGTGGAGCTGGATGG + Exonic
1180308011 22:11145477-11145499 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1180546487 22:16507290-16507312 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1180609555 22:17086221-17086243 GAGGTGGAGGTGGAGGTGGAGGG - Intronic
1181007387 22:20020514-20020536 GTGGAAGTGGGGGAGGTGGTGGG + Intronic
1181592871 22:23895562-23895584 GAGGAGGAGTTGGAGTTGGGAGG + Intronic
1181715610 22:24725221-24725243 GTGGTGGAGGTGGTGGAGGTGGG + Intronic
1181741411 22:24924522-24924544 TTGCAGGAGGTGGAGGTTGTTGG + Exonic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1182212702 22:28690089-28690111 GAGGAGGGGCTGGAGTTGGGTGG - Intronic
1182800558 22:33028694-33028716 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1183311513 22:37112334-37112356 GGGGAGGAGGCAGAGTTGTTGGG - Intergenic
1183530089 22:38348675-38348697 ATGGAGGAGGTGGGACTGGTAGG - Intronic
1183601388 22:38842554-38842576 GTGGAGGAGGAGGAGCTCGGGGG + Intronic
1183733458 22:39630870-39630892 GTGGAGGAGGTGTCGTGGGTGGG + Intronic
1183747294 22:39699001-39699023 GTGAAGGAGGAGGAGGTGATGGG - Intergenic
1183770960 22:39925518-39925540 GTTGAGGAGGTGGACTTGGAGGG - Intronic
1184290252 22:43495107-43495129 GTGGTGGTGATGGAGGTGGTAGG + Intronic
1184291346 22:43499526-43499548 ATGGAGGTGGTGGTGATGGTGGG + Intronic
1184667701 22:45997375-45997397 GGGGAGGGGGTCGAGTTGGGAGG - Intergenic
1185111493 22:48902527-48902549 GGGGAGGAGGTGGAAATGGAGGG + Intergenic
949219023 3:1607214-1607236 GAGGAGGAGGAGGAGCTGGAGGG + Intergenic
949469533 3:4380103-4380125 GCACAGGAGGTGGAGGTGGTAGG - Intronic
950004508 3:9682979-9683001 GTGGTGGAGGGAGAGGTGGTAGG + Intronic
950529328 3:13544073-13544095 GTGCAGGTGCTGGACTTGGTGGG + Intergenic
950539141 3:13599626-13599648 GTGGTGGAGGAGGAGGTGGCTGG + Intronic
950613079 3:14138571-14138593 AAGGAGGTGGTGGAGGTGGTGGG + Intronic
950726675 3:14921513-14921535 GTGGAGGATGAGGGGTAGGTGGG - Intronic
950791590 3:15476735-15476757 GTTGAGAAGGTGGTGTTGGCTGG - Intronic
951697510 3:25461236-25461258 GGGGAGGAAGTGGAGATGGGGGG - Exonic
952107556 3:30087624-30087646 GAGGAGGAGGTGGAGGGGGAGGG - Intergenic
952107560 3:30087630-30087652 GGGGAGGAGGAGGAGGTGGAGGG - Intergenic
952215347 3:31272543-31272565 CTGGAAGAGATGGGGTTGGTGGG - Intergenic
952396151 3:32922373-32922395 GTGGTGGAGGTGGTGGAGGTTGG + Intergenic
952742082 3:36743831-36743853 GGAGTGGAGGTGGAGTGGGTTGG - Intergenic
952968764 3:38637523-38637545 CTGGAGGAGGTAGAGTGGGGAGG - Intronic
953043573 3:39276108-39276130 GTGAAGATGGTGGAGTTGGGAGG + Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953392853 3:42543874-42543896 GTGGCGGAGTTGGAACTGGTGGG - Intergenic
953437472 3:42889970-42889992 GTCGTGGAGGTGGTTTTGGTGGG + Intronic
953751523 3:45611955-45611977 GCAGAGGAAGTGAAGTTGGTGGG + Intronic
953900396 3:46837719-46837741 GTGGTGGTGGTGGGGTTGCTGGG - Intergenic
954407687 3:50354604-50354626 GTGGTGGTGGTGGCGGTGGTGGG + Intronic
954513142 3:51145820-51145842 GTGGAGGTGGTGGTGTGGGATGG + Intronic
954677865 3:52325561-52325583 CTGGGGGAAGGGGAGTTGGTGGG - Intronic
955125320 3:56105387-56105409 GCCCAGGAGTTGGAGTTGGTTGG - Intronic
955198724 3:56830244-56830266 ATGGTGGAGGTGGTGCTGGTGGG + Intronic
955213376 3:56962633-56962655 TTGGAGGGGTTGGAGTTGGGGGG + Intronic
956176499 3:66478099-66478121 GTGGAGATGGTGGAGGTGATAGG - Intronic
956361741 3:68455270-68455292 TTGGAGGAGGTGGAATGGGGAGG + Intronic
956547611 3:70422264-70422286 GAGGTGAAGGTGAAGTTGGTGGG - Intergenic
956572167 3:70709000-70709022 GTGGAAGAGGGGGAGGAGGTGGG + Intergenic
957226827 3:77459930-77459952 ATGGGGGTGGTGGAGTGGGTGGG + Intronic
957227577 3:77469475-77469497 GTGGTGGCAGTGGTGTTGGTAGG + Intronic
957236727 3:77602646-77602668 GTGGTGGCGGTGGTGGTGGTAGG - Intronic
958641895 3:96815021-96815043 GCGGAGGAGCGGGAGTGGGTGGG + Intronic
958896780 3:99838323-99838345 GGGAAGCAGGTGGAGTTGGAAGG + Intronic
958896845 3:99838969-99838991 GTGGATGAAGTTGAGATGGTTGG - Intronic
960438016 3:117651189-117651211 GTGTAGGAGAAGGAGTTGGCAGG - Intergenic
960618949 3:119621075-119621097 GTGGTGGAGGTGGTGTTGCCAGG + Intronic
960967753 3:123116798-123116820 GAGGAGGAGGTGGGGCTGGATGG + Intronic
961428005 3:126862348-126862370 GTGGAGGAGGTGGTGATAGTGGG - Intronic
961428325 3:126863452-126863474 GTGGAGGAGGTGGTGACAGTGGG - Intronic
961428487 3:126864070-126864092 GTGGAGGAGGTGGTGATTGTGGG - Intronic
961481511 3:127183740-127183762 GTGGAGGAGGGGGAGAGGGAGGG - Intergenic
961656574 3:128445715-128445737 GTGGTGGTGCTGGAGGTGGTGGG + Intergenic
961816922 3:129555899-129555921 GTGGATGAGGTAGAGTTTCTGGG + Exonic
962212405 3:133490458-133490480 GTGGGGGAGGTGGAGGTTGCTGG + Intergenic
962990758 3:140575037-140575059 GTAGAGGAGCTGGAGGTGGGTGG - Exonic
963223053 3:142832209-142832231 GTCGAGGAGGTGGAGAAGGGTGG - Intronic
963500432 3:146119061-146119083 GTGCTGGAGGTGGGGTTGGGTGG + Intronic
963897625 3:150703714-150703736 GTGGTGGAGGAGGAGTTGGTGGG - Exonic
963981246 3:151539651-151539673 GTGTTGGAGGTGGGGGTGGTCGG - Intergenic
964059961 3:152509347-152509369 GGGGAGGAGGTGAGTTTGGTTGG + Intergenic
964503294 3:157371747-157371769 GTGGATTATTTGGAGTTGGTAGG + Intronic
964714680 3:159709204-159709226 GAAGAGGGGGTGGGGTTGGTGGG + Intronic
964881775 3:161431274-161431296 GTGGTGGGGTTGGAGGTGGTGGG + Intergenic
965809570 3:172577946-172577968 GTGGGGGAAGTGGGGTCGGTGGG + Intergenic
966155009 3:176906719-176906741 ATGGAGGAGCTGTAGTTCGTTGG - Intergenic
966592894 3:181701001-181701023 GTGTAGGGGGTGGAGTAGGAAGG + Intergenic
966908510 3:184544581-184544603 GGGGAGGAGGAGGAGTAGGAGGG - Intronic
966908538 3:184544652-184544674 GGGGAGGAGGAGGAGTAGGAGGG - Intronic
967602569 3:191406803-191406825 GTGTTGGAGGTGGGGCTGGTGGG - Intergenic
967870292 3:194224019-194224041 GTGGAGGGGGTGGTGGTGGCAGG - Intergenic
968158805 3:196407004-196407026 GTCGGGGAGATGGGGTTGGTTGG - Intronic
968222146 3:196947431-196947453 GTGGAGGTGGTGGACATGGGGGG - Exonic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968243144 3:197111288-197111310 GTGAACTAGGTTGAGTTGGTTGG + Intronic
968282283 3:197486105-197486127 GGGAAGGATGTGGAGTCGGTGGG - Intergenic
968527937 4:1073840-1073862 GTGGTAGAGGTGGTGTGGGTGGG + Intronic
968730543 4:2267444-2267466 GAGGAGGCAGTGGAGTTGGGCGG + Intergenic
969129658 4:4982220-4982242 GGGGAGGAGGTGGAGGGTGTGGG - Intergenic
969194909 4:5553227-5553249 CAGGAGCAAGTGGAGTTGGTGGG + Intronic
969336264 4:6512098-6512120 GTGGTGGTGGTGGTGATGGTGGG + Intronic
969364411 4:6685862-6685884 CTGGAGGAGGAGGAGTTGAGAGG - Intergenic
969472956 4:7400461-7400483 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
970008965 4:11437805-11437827 GTGGAGTAGGGGGAGTGGGGAGG - Intergenic
970180212 4:13384069-13384091 CTGGAGGTGGTGGGGTTGGCAGG - Intronic
970221744 4:13818875-13818897 GTGGTGAAGGTGGAGCAGGTGGG - Intergenic
970298368 4:14655775-14655797 GTGGAGCAGGTTGTGATGGTGGG + Intergenic
970864935 4:20747545-20747567 GTGGAGGGAGAGGAGATGGTTGG - Intronic
971214597 4:24651410-24651432 TTGGTGGAGGTGGGGATGGTGGG + Intergenic
971327905 4:25658908-25658930 GTGGTGGGGGTGGGGTGGGTGGG - Intronic
971362446 4:25950554-25950576 GGGGAGGAAGTGGAGTTAGCTGG + Intergenic
971455953 4:26844010-26844032 GTGTTGGAGGTGGACATGGTAGG - Intergenic
972032382 4:34477783-34477805 GAGGAGGAGGAGGAGGGGGTGGG - Intergenic
972118941 4:35676986-35677008 GTGGGGTGGGTGGAGTTGGGAGG - Intergenic
972370320 4:38417214-38417236 GTGCTGGAGGTGGAGTCTGTGGG - Intergenic
972375415 4:38465197-38465219 GAGGAGGAGGTGGTGGTGGTTGG - Intergenic
973927072 4:55749279-55749301 GTGGAGGAGATGGTGTCTGTAGG + Intergenic
974540750 4:63230977-63230999 GTGGAAGAAGTGGAGGAGGTGGG + Intergenic
975757773 4:77588003-77588025 GTGGATGAGGCTGAGTAGGTGGG - Intronic
975794128 4:77988187-77988209 GTCGTGGAGGTGGTTTTGGTGGG - Intergenic
976070367 4:81233348-81233370 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
976230722 4:82840302-82840324 GTGAAAGAGGTGGCGTGGGTTGG - Intronic
976704692 4:88008025-88008047 GAGGAGGAGGAGGAGGTGGAAGG + Exonic
976936825 4:90646408-90646430 GTTTAGGAGGTAGAGTTGGAAGG + Intronic
977079454 4:92505611-92505633 GTGGAGGAGAGGGAGTTGTGAGG + Intronic
977282751 4:95062223-95062245 TTGGAGGTGGTGGTGATGGTAGG - Intronic
977751436 4:100614390-100614412 GTGGAAGATATGGAGTTGGAGGG - Intronic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
978200148 4:106016459-106016481 GTGGGGGAGGTGGGGTAGGTGGG - Intergenic
978816603 4:112913406-112913428 GTACAGGAGGTTGAGGTGGTAGG - Intronic
979398463 4:120218410-120218432 TTGGAGGTGGGGGAATTGGTGGG + Intergenic
979556456 4:122052973-122052995 GTGGAGGAGGTGAAGGTGAATGG + Intergenic
980714097 4:136610316-136610338 GTGGGGGCGGTGGGGATGGTGGG - Intergenic
980721077 4:136696584-136696606 GTGGGGCAGGTGGGGTGGGTGGG - Intergenic
981018035 4:139994762-139994784 GTGGTGGTGGTGGTGCTGGTGGG + Intronic
981319619 4:143376111-143376133 GTGGAGGTGGTGTAGGGGGTTGG - Intronic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
981552863 4:145959437-145959459 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
982319690 4:154065042-154065064 GTGTTGGAGGTGGGCTTGGTTGG + Intergenic
982612063 4:157587898-157587920 ATGGAGGATGTGGAGGTGGGAGG - Intergenic
982761190 4:159286028-159286050 GTGGTGGTGGTGGTGGTGGTTGG - Intronic
983058589 4:163128953-163128975 GTGGTGGAGGGGGAGGGGGTGGG + Exonic
983881502 4:172938295-172938317 GAGGAGGAGGTGGAGGAGGAGGG + Intronic
984100207 4:175475494-175475516 GTGGGGTAGGGGGAGTGGGTAGG - Intergenic
984392326 4:179151992-179152014 CTGGAGGAGGATGAGTGGGTGGG - Intergenic
985117388 4:186605402-186605424 GGGGAGGAAGTGGAGTAGGGAGG + Intronic
985223373 4:187731984-187732006 GTGGAAGAAGTGGAGGAGGTGGG - Intergenic
985263301 4:188135312-188135334 GAGGAGGAGGTGGGGGTGGGAGG - Intergenic
985451969 4:190067610-190067632 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985452956 4:190070901-190070923 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985453945 4:190074194-190074216 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985454933 4:190077487-190077509 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985455919 4:190080784-190080806 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985455945 4:190080830-190080852 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985456904 4:190084078-190084100 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985456928 4:190084124-190084146 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985457892 4:190087374-190087396 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985458880 4:190090671-190090693 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985458904 4:190090717-190090739 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985463132 4:190173434-190173456 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985463155 4:190173479-190173501 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985615551 5:918412-918434 GTGGAGGTGGGGGAGCTGTTAGG - Intronic
985649173 5:1099360-1099382 CCGGAGGAGGTGGACTGGGTCGG - Intronic
985649202 5:1099440-1099462 CCGGAGGAGGTGGACTGGGTCGG - Intronic
985649217 5:1099476-1099498 CCGGAGGAGGTGGACTGGGTCGG - Intronic
985688691 5:1295162-1295184 GCGGAGGAGGCGGAGCTGGAAGG + Intergenic
986400288 5:7372620-7372642 GTGGTGATGGTGGAGGTGGTAGG - Intergenic
986773848 5:10996173-10996195 GTGGAGTGGGTAGAGTTGATGGG + Intronic
987793000 5:22592683-22592705 GTGGATTGGGTGGAGGTGGTGGG - Intronic
987873585 5:23650511-23650533 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988809144 5:34767594-34767616 GTGGGGGTGGTGGGGGTGGTGGG - Intronic
989236197 5:39151192-39151214 GTGGTGGAGGTGGAGTGTGAGGG - Intronic
989331555 5:40265981-40266003 GTGGAGGAGATAGAGTGGGGAGG - Intergenic
991461681 5:66865134-66865156 CTGGGGAAGGTGGATTTGGTGGG + Intronic
991512978 5:67400437-67400459 GTGTAGGAGGTAGTGTGGGTGGG - Intergenic
991774245 5:70069255-70069277 GTGGTGGCGGTGGCGGTGGTGGG - Exonic
991853540 5:70944678-70944700 GTGGTGGCGGTGGCGGTGGTGGG - Exonic
992062953 5:73074900-73074922 GTGGAGGAGGTGGTGGGGCTTGG + Intronic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992698451 5:79314634-79314656 GTGGGGGAGGGGGAGGAGGTGGG - Exonic
992768804 5:80028180-80028202 GTGGCGGAGGTGGGGTGGGGTGG - Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
992912338 5:81408167-81408189 GAGGAGGAGGAGGAGGTGGGGGG + Intergenic
996215141 5:120856797-120856819 TTAGAGGAGTTGAAGTTGGTGGG + Intergenic
996663174 5:126027642-126027664 CTGGTGGAGGTGGAGCTGGCTGG - Intergenic
996779741 5:127172397-127172419 GTGGCAGAGGTGGAGAGGGTAGG + Intergenic
996895933 5:128482571-128482593 GGGTAGGAGGTGGAGTTTATGGG + Intronic
997141415 5:131385045-131385067 CTGGAGGGGGTGGAGGTGGGAGG - Intronic
997702585 5:135913611-135913633 GAGGTGGAGGTGGAGGTGGGAGG - Intergenic
997825581 5:137104127-137104149 GTGTTGGAGGTGGGGCTGGTGGG + Intronic
998018420 5:138751270-138751292 GTGTTGGAGGTGGGGCTGGTGGG - Intronic
998378911 5:141710102-141710124 GAGGAGGAGGTGGGGGTGGTAGG + Intergenic
998472505 5:142394172-142394194 GAGGGGGAGGTGGAGGTGGAGGG - Intergenic
998816068 5:146015289-146015311 GTGCATGTGGTGCAGTTGGTGGG - Intronic
999229628 5:150054014-150054036 ATGGAGGAGTTGAAGTTTGTGGG + Exonic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999505266 5:152188104-152188126 GTGGAAGAGGTGGAGGAGGTTGG + Intergenic
999599744 5:153249061-153249083 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
999645750 5:153715376-153715398 GAGGAGTAATTGGAGTTGGTTGG - Intronic
999725028 5:154430019-154430041 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
999850426 5:155531875-155531897 GTGAAGTATGTGGAGCTGGTAGG - Intergenic
1000005275 5:157177253-157177275 GTGGAGGGGGAGAAATTGGTAGG - Intronic
1001424825 5:171616187-171616209 GGGGAGGAGGTGGCGGGGGTGGG + Intergenic
1001436828 5:171705655-171705677 GTTGAGGAGGAGGAGTTAATGGG - Intergenic
1001603349 5:172943396-172943418 GTGGAGGAGGCAGAGGTGGGGGG - Intronic
1001733066 5:173974208-173974230 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1001897185 5:175392645-175392667 GTGATGGAGGTGGGGTTGGGGGG - Intergenic
1001991745 5:176122337-176122359 GTGCAGGAGGCTGAGTTGGGAGG + Intronic
1002292488 5:178209433-178209455 GTGGTGGAGGTGGAGGTGAGTGG + Exonic
1002307546 5:178292677-178292699 GTGGAAGTGGTGGACGTGGTTGG + Intronic
1002371177 5:178756059-178756081 GTGGGGGTGGTGGTGATGGTGGG + Intergenic
1002483914 5:179522286-179522308 GTTGAGAAGGTGGAGTGGGAAGG + Intergenic
1002500649 5:179645195-179645217 GTTGAGCAGGTGGAGTGGGAAGG - Intergenic
1003348483 6:5293428-5293450 GGGGAGGAGGTGGGGATGGAGGG + Intronic
1004065897 6:12243372-12243394 GTGGAAGAGGTGGAGGAGGTGGG + Intergenic
1004326372 6:14677420-14677442 GTTGGGGAGGTGGCGTGGGTGGG - Intergenic
1005400133 6:25423536-25423558 GTGGAGGAGGCGGTGGTGGGAGG + Intronic
1006029875 6:31170747-31170769 GTGGAGGAGAGGGAGGTGGGGGG + Intronic
1006093588 6:31642355-31642377 GTGGTGGGGGTGGAGGAGGTGGG + Exonic
1006136815 6:31900780-31900802 GTGGAGGGGGTAGAGGAGGTGGG + Exonic
1006478568 6:34273711-34273733 TTGGAGCAGGTGGAGGAGGTGGG - Intergenic
1006670366 6:35726517-35726539 GTGGAGGAGGAGGAGATGGGAGG - Intronic
1007641013 6:43339635-43339657 GTGGTGGAGGTGGTGGAGGTGGG + Exonic
1007700569 6:43763922-43763944 GTGGAGAAAGGGGAGTGGGTGGG + Intergenic
1007744547 6:44035329-44035351 GTGGAGGAGGCGGAGAGGGTTGG - Intergenic
1008446530 6:51598380-51598402 GTGGAGGGGGCGGCGCTGGTGGG + Intergenic
1008687146 6:53938242-53938264 GTGGAGGAGGTAAAGGTAGTAGG - Intronic
1009035856 6:58116441-58116463 CGGGAGGAGGAGGAGTTGGTTGG + Intergenic
1009211678 6:60870042-60870064 TGGGAGGAGGAGGAGTTGGTTGG + Intergenic
1009528016 6:64772641-64772663 GTGGAGGAGGCAGAGTACGTAGG - Intronic
1009956346 6:70459319-70459341 GTGGAGCAGGTTGAGTGGGATGG + Intronic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011348582 6:86398578-86398600 GTGGAGTAGGGGGAGTGGGGAGG + Intergenic
1011513536 6:88127418-88127440 GTGGAGGTGGAGGGGTGGGTTGG + Intergenic
1011640346 6:89411914-89411936 GAGGAGGAGGATGAGCTGGTGGG - Exonic
1012555338 6:100504935-100504957 GTGGAGGCAGTGGTGGTGGTGGG + Intergenic
1012581999 6:100881033-100881055 GAGGTGGAGGTGGAGGTGGGAGG - Intronic
1013056583 6:106589170-106589192 GTGGAGGAGGAGGAGGAGGGAGG + Intronic
1013133878 6:107261254-107261276 ATGCAGGAGGTGGGGCTGGTGGG + Intronic
1013342468 6:109228900-109228922 GTGAGGGAGTAGGAGTTGGTGGG - Intergenic
1013507417 6:110814693-110814715 GCGGTGGAGGAGGAGTTTGTGGG - Intronic
1013890340 6:115019501-115019523 GGGGATGAAGTGGAGTTGGCAGG + Intergenic
1014074452 6:117220266-117220288 GAGGAGGAGTTGGAGATGGAAGG + Intergenic
1014194845 6:118543065-118543087 GTGGAGGAGGTGGGCTTTCTAGG - Intronic
1014312800 6:119826206-119826228 TTGGATGAGGTGGGGGTGGTAGG + Intergenic
1014755973 6:125302105-125302127 GAGGAGGAGGAGGAGTTGGAAGG - Intergenic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1016064324 6:139663334-139663356 GCAGAGGAGGTGGAGGAGGTGGG + Intergenic
1016421349 6:143886787-143886809 ATGGAGGGGGTGGAGGTGGGAGG - Exonic
1016823541 6:148367703-148367725 GTTGGGGTGATGGAGTTGGTGGG + Intronic
1016835477 6:148472554-148472576 GTGGGTGATGGGGAGTTGGTTGG - Intronic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1017016914 6:150108463-150108485 AAGGAGCAGGTGGAGTTGGGGGG + Intergenic
1017025191 6:150175279-150175301 GAGAAGGTGGTGGAGTTGGAAGG + Intronic
1017071889 6:150582596-150582618 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1017150462 6:151274419-151274441 GTGGAGGAGGTGGGGGGGTTGGG + Intronic
1017311246 6:152980362-152980384 GTGGAGGAGTTCCAGATGGTGGG + Intronic
1017652473 6:156596001-156596023 CTGGAGGAGCTGGAGGTTGTAGG + Intergenic
1017672117 6:156778219-156778241 GTGGTGGTGGTGGAGGTGGTGGG - Exonic
1017814736 6:158008587-158008609 TGGGAGAAGGTGGAGTTGGTGGG + Intronic
1017910702 6:158790315-158790337 ATTGAGGAGGTGGAGATGGGAGG + Intronic
1017974312 6:159341790-159341812 GAGGTGGAGGTGGAGGTGGCAGG + Intergenic
1018689758 6:166335186-166335208 GTTGTGGAGGTGGTTTTGGTGGG + Intronic
1018944101 6:168333775-168333797 GTGTTGGAGGTGGGGCTGGTGGG - Intergenic
1018999476 6:168736782-168736804 GTGGAGGAGGAGGAAATGGATGG + Intergenic
1019390493 7:784021-784043 GTGGGGGAGGTGGGGGAGGTGGG - Intronic
1020085635 7:5308848-5308870 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1021083047 7:16386120-16386142 GTGGTGGAGGTGGTCTCGGTAGG + Intronic
1022088981 7:27095700-27095722 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1022263787 7:28733371-28733393 GTGGAGGAGAAGGGGCTGGTAGG - Intronic
1022770547 7:33467560-33467582 GTGGAGGTGGCGGAGTTGGGGGG - Intronic
1022896071 7:34751501-34751523 GAGGAGGAGCTGGGGCTGGTTGG - Intronic
1023645694 7:42312213-42312235 GTGGAGGAGGAGGTGTGGCTTGG + Intergenic
1023921778 7:44635520-44635542 GTGGCTGAGGTGGAGTAGGGAGG + Intronic
1023923527 7:44648379-44648401 GAGGAGGAGGGGGTGTAGGTGGG - Intronic
1024196446 7:47063966-47063988 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196455 7:47064001-47064023 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196559 7:47064898-47064920 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024284355 7:47744422-47744444 GGGGTGGAGGTGGAGGTGGTGGG + Intronic
1024569705 7:50713644-50713666 GTGGAGGAGGTGGAGGTGATGGG - Intronic
1024644882 7:51362708-51362730 GTGGTGGTGGTGGTGATGGTGGG - Intergenic
1024692505 7:51818422-51818444 GTGAAGCAGATGGAGTGGGTTGG + Intergenic
1024735806 7:52303038-52303060 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1024986725 7:55200605-55200627 GAGGGGGAGATGGAGTTGGGTGG - Intronic
1025016027 7:55439780-55439802 ATGGAGGAGGCGGAGGTGCTGGG + Intronic
1025176920 7:56806848-56806870 GTGTAGGAGGAGGAGGGGGTGGG - Intergenic
1025694872 7:63769538-63769560 GTGTAGGAGGAGGAGGGGGTGGG + Intergenic
1026060123 7:67018430-67018452 ACGTAGGAGGTGGAGTTGGGAGG + Intronic
1026292520 7:69020536-69020558 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026717993 7:72806757-72806779 ACGTAGGAGGTGGAGTTGGGAGG - Intronic
1026850692 7:73721457-73721479 GTGGAGGAGTGGGAGTGGGGAGG + Intergenic
1027245446 7:76364102-76364124 GTGGAGGAGATGGACTGAGTGGG + Intergenic
1027692645 7:81367764-81367786 TTGGAGGAGTTGGAGGTGGGTGG - Intergenic
1028006397 7:85574673-85574695 GAGGAGGAGGAGGAGTGGGTGGG + Intergenic
1029071877 7:97906243-97906265 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1029196800 7:98811039-98811061 GTGGTGGAGGTGGTGGTGGTTGG + Intergenic
1029196820 7:98811116-98811138 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
1029196932 7:98811591-98811613 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
1029339881 7:99934138-99934160 GTGGTGGTGGTGGTGGTGGTAGG - Intergenic
1029459689 7:100687657-100687679 GGGGTGGGGGTGGAGGTGGTTGG - Intronic
1029518461 7:101043639-101043661 GTGGAGGAGGCAGAGGTTGTTGG - Exonic
1029684334 7:102135441-102135463 GAGGAGGACGTGGAGGAGGTGGG + Intronic
1029886797 7:103881389-103881411 GTGGAGGAAGAGGAGTTTGTAGG - Intronic
1029923159 7:104287591-104287613 GAGGAGGGGGTGGAGTAGGAGGG - Intergenic
1030131306 7:106203753-106203775 GTGTAAGAGGTGGAGAAGGTGGG + Intergenic
1030679183 7:112416203-112416225 GTGAAGGAGCTGGAGATGGAAGG + Intergenic
1030881282 7:114882780-114882802 GTATGGGAGGTGGAGTTGGAAGG + Intergenic
1031122602 7:117738673-117738695 GGGGAGGAGGTGGTGGTGATGGG + Intronic
1031599758 7:123692550-123692572 GAGGTGGAGGTGGAGGCGGTGGG + Exonic
1031833782 7:126657787-126657809 GTGGTGGGGGTGGAGTGAGTGGG + Intronic
1032463153 7:132126528-132126550 ATGGGGGAGGTGGAGATGCTGGG + Exonic
1032687810 7:134253313-134253335 GTTGAGGAGGTAGAGGTGGAGGG + Intronic
1032753120 7:134862589-134862611 GTGGAGCAGGTGGGGTTTTTAGG + Intronic
1032845425 7:135747960-135747982 GAGGAGGTGGCGGAGCTGGTGGG + Intronic
1032846755 7:135757947-135757969 GTCAGAGAGGTGGAGTTGGTGGG + Intergenic
1033231343 7:139600447-139600469 CGGGAGGAGGTGGTGCTGGTTGG + Exonic
1033348746 7:140544949-140544971 GCGGAGGAGGTAGCTTTGGTAGG + Intronic
1033513507 7:142083791-142083813 GTGGTGGGGGTGGTGTTGATGGG + Intronic
1033528790 7:142243310-142243332 TTTGAGGAGGTGGAGCTGGGAGG - Intergenic
1033614850 7:143004234-143004256 CTGGAGGAGGAGGAGGGGGTTGG + Intergenic
1033773490 7:144580517-144580539 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1034014678 7:147569347-147569369 GAGGGGGAGGTGGAGGTGGGTGG - Intronic
1034021288 7:147646033-147646055 GTGGAGGAAGCAGAGGTGGTGGG + Intronic
1034085012 7:148314641-148314663 GTGAAGGAGAAGGAGTTGGGGGG + Intronic
1034226778 7:149490654-149490676 GTGCTGGAGATGGAGATGGTGGG + Intronic
1034240364 7:149606023-149606045 GTGGAGGAGCTGGAGTTTGGGGG - Intergenic
1034243950 7:149630469-149630491 GTGGAGGAGCTGGGGTTTGGGGG - Intergenic
1035035499 7:155891640-155891662 GAGGAGGTGGTGGAGGTGCTGGG + Intergenic
1035142869 7:156781731-156781753 GTGCAGAAGGTTGACTTGGTTGG - Intronic
1035378473 7:158423287-158423309 GTGAAGGAAGTGGATTTGGGGGG + Intronic
1035901655 8:3463207-3463229 GAGAAGGAAGTGGAGTTGGGTGG - Intronic
1036004361 8:4644915-4644937 GTGTGGGAGGTAGAGGTGGTCGG + Intronic
1036254973 8:7198712-7198734 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1036362514 8:8088795-8088817 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1036504081 8:9339420-9339442 GTGGAGGTGGTGGGGATGGTGGG + Intergenic
1036722422 8:11188991-11189013 GGGGATGAGGGGGAGTTGGATGG - Intronic
1037544119 8:19900856-19900878 GTGGAGGAAATGGAGATGGCAGG + Intergenic
1037645284 8:20787370-20787392 CTGGAGGATGGGGAGTGGGTGGG - Intergenic
1038276844 8:26128264-26128286 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1038490226 8:27965399-27965421 ATGAAGCAGGTGGAGTTGGTGGG - Intronic
1039936804 8:42052255-42052277 GGGGAGGAGGAGGACTTGGTGGG + Intergenic
1039984372 8:42435624-42435646 GTGGGGCAGGTGGGGTGGGTGGG + Intronic
1040514106 8:48120402-48120424 GTGGAGGAGGGAGAGGTGCTGGG + Intergenic
1040628495 8:49179989-49180011 GTGGAGGAGGTAGAGAAGGGAGG + Intergenic
1040817252 8:51520987-51521009 TGGGAGGAGGCGGAGTTGGGAGG + Intronic
1041637160 8:60156790-60156812 GTGGAGGTGATGGGGGTGGTGGG - Intergenic
1042155510 8:65841292-65841314 GTAGAGGAGGTGAAGCTGGGTGG + Intronic
1042480377 8:69295906-69295928 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1042503963 8:69539812-69539834 TTGGTGGAAGTGGAGTTGGTTGG + Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043161509 8:76853050-76853072 GAGGAGGAGGTGGTGGTGGTGGG - Exonic
1043504612 8:80890052-80890074 GTGGAGGTGGTGGGATTGGTTGG - Intergenic
1045068790 8:98478333-98478355 GTGGAAGAAGGGGAGTTGGGAGG + Intronic
1045111454 8:98941696-98941718 GAGGAGGAGGTGGAGGAGGAGGG - Intronic
1045378698 8:101601190-101601212 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1045474620 8:102542530-102542552 GGGGAGGAGGGGGAGGAGGTGGG - Intergenic
1046249014 8:111605498-111605520 GTAGAGGAAGTGGAGACGGTAGG - Intergenic
1046547214 8:115667964-115667986 GCGGAGGAGCTGGAGGTGGTTGG - Intronic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047494336 8:125398935-125398957 GAGGTGGAGGTGGAGGTGGGTGG - Intergenic
1047520433 8:125591700-125591722 GAGGAGGAGGTGGAGGAGGAAGG + Intergenic
1047862582 8:128984639-128984661 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1047977282 8:130142876-130142898 GTGGTGGGGGGGCAGTTGGTGGG + Intronic
1048170832 8:132104683-132104705 ATGAAGGAGGTGGAGGTGGTAGG + Intronic
1048182078 8:132204574-132204596 GTGGAGGATGAAGAGATGGTGGG - Intronic
1049227090 8:141459691-141459713 GTGGTGGAGGTGATTTTGGTTGG + Intergenic
1049244043 8:141551964-141551986 GAGCAGGAGGTGGAGCTGGCCGG - Intergenic
1049517246 8:143066982-143067004 GTGGTGGAGGTGGGCCTGGTGGG + Intergenic
1049585201 8:143429792-143429814 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1049924946 9:399954-399976 GTGGAGAAGGTGGTGATAGTGGG - Intronic
1049924954 9:399988-400010 GTGGAGGTGGTGGAGGTGGTGGG - Intronic
1049986268 9:954574-954596 TTGGAGGAGGAGAAGTTGGTAGG + Intronic
1049998497 9:1052175-1052197 GTGGAGGTGGGGGAGTTGGAGGG + Intronic
1050585843 9:7110568-7110590 GTAGAGGATGAGGAGGTGGTAGG - Intergenic
1050745095 9:8866968-8866990 GGGGAGTAGATGGAGTTAGTGGG + Intronic
1051193566 9:14538921-14538943 GTGAAAGAGGTGGGGTTGGGAGG - Intergenic
1051238390 9:15025699-15025721 GTGGAGGTGGTGAAAGTGGTTGG - Intergenic
1051343715 9:16133830-16133852 GTTCAAGAGGAGGAGTTGGTGGG + Intergenic
1051488123 9:17630795-17630817 GTGGGGGAGTTGGAGGTAGTAGG + Intronic
1052132284 9:24862965-24862987 GTGGAAGGAGAGGAGTTGGTAGG + Intergenic
1052360375 9:27549355-27549377 TTGCAGGGGGTGGAGTGGGTGGG + Intronic
1052769187 9:32671894-32671916 TTGGTGGAGGTGGAGGTGGCTGG - Intergenic
1053120834 9:35546613-35546635 GAGGGGCAGGTGGAGGTGGTGGG + Exonic
1053299432 9:36938556-36938578 GCAGAGGAGGTGGAGACGGTTGG - Intronic
1053385480 9:37683931-37683953 GTGAGGGAGATGAAGTTGGTGGG + Intronic
1053385514 9:37684111-37684133 GTGGGGGAGATGAAGTTGGCGGG + Intronic
1054912204 9:70465064-70465086 GTGGAGCTTGTGGAGGTGGTTGG - Intergenic
1054946904 9:70805224-70805246 GTGGGGGAGGTGGTGGTGGGGGG + Intronic
1055274201 9:74595803-74595825 GTTGAGGAGCTGGAGTTTTTTGG + Intronic
1055396393 9:75879560-75879582 GTGGTGGTGGTGGAGATGGTGGG + Intergenic
1055453598 9:76453248-76453270 GTTGAGGAGCTGGAGTGGGTAGG + Intronic
1055512954 9:77013346-77013368 GTGGTGGTGGTGGAGTTGGGGGG - Intergenic
1055528260 9:77156827-77156849 GAGGAGGAGGAGGAGTCTGTAGG - Intergenic
1056259426 9:84833098-84833120 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1056328436 9:85501677-85501699 GTGGATGAAGTGCAGGTGGTTGG - Intergenic
1056759998 9:89407717-89407739 GTGGATGAGGAGCAGTTGGATGG - Intronic
1057786461 9:98091860-98091882 GTGGAGACGGTGGAGATGGTGGG - Intronic
1057815466 9:98290710-98290732 GTGGAGGATGGGGAGCTGGAGGG + Exonic
1057971100 9:99558505-99558527 GAGGAGTGGGTGGAGTGGGTGGG + Intergenic
1058835478 9:108855698-108855720 GTGGAGGAGATGAAGTAGGTGGG + Exonic
1059401735 9:114074814-114074836 GAGGAAGAGGAGGAGTTGTTTGG + Intronic
1059440877 9:114306163-114306185 GTGGAGGAAGGGGAGGTGCTGGG - Intronic
1059522519 9:114956933-114956955 GTGGGAGAGGTGGTGATGGTAGG + Intergenic
1060006276 9:120002868-120002890 CTGGAGGAGGTGGTGTTGAGGGG - Intergenic
1060260013 9:122066224-122066246 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1060355727 9:122905300-122905322 GAGGAGGAGGCGGAGGTGGAGGG - Intronic
1060524818 9:124314476-124314498 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1060804364 9:126565183-126565205 GTGGAGATGGTGGGGTTGGGGGG - Intergenic
1060959057 9:127666109-127666131 GTGGAGAAGCCGGAGTTGGCTGG + Intronic
1061255884 9:129454054-129454076 GTGGTGGAGGTGGAGGTGGTGGG + Intergenic
1061255892 9:129454076-129454098 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255903 9:129454107-129454129 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255920 9:129454152-129454174 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255935 9:129454191-129454213 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255946 9:129454222-129454244 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255982 9:129454321-129454343 GTGGTGGAGGTGGTGGTGGGTGG + Intergenic
1061256032 9:129454452-129454474 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061256056 9:129454523-129454545 GTGGAGGTGGTGGAGACGGTGGG + Intergenic
1061792506 9:133066214-133066236 CTGGAGGGGGTGGTGTTTGTCGG - Intronic
1061883477 9:133579281-133579303 CTGAAGGAGGTGGAGGCGGTGGG + Exonic
1062212900 9:135374130-135374152 GAGGTGGAGGGGGAGTTGGGGGG - Intergenic
1062274870 9:135725943-135725965 GGGGAGGAAGAGGGGTTGGTGGG + Intronic
1062388995 9:136326758-136326780 GAGGAGGAGGAGGAGGCGGTAGG + Intergenic
1062619171 9:137411723-137411745 GTGGGGGAGGGGGAGGGGGTGGG + Intronic
1203767984 EBV:36425-36447 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767989 EBV:36434-36456 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767994 EBV:36443-36465 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767999 EBV:36452-36474 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1203768004 EBV:36461-36483 GTGAAGGTGGTGGAGGTGGTGGG - Intergenic
1203736331 Un_GL000216v2:142943-142965 GTGGAGGGCGTGGTGATGGTGGG - Intergenic
1185499055 X:583980-584002 GAGGAGGAGGTGGAGGAGGAGGG + Intergenic
1185831558 X:3307923-3307945 GTGGAGGAGGAGGTGGTGCTTGG - Intergenic
1185969601 X:4647811-4647833 GTGTAGTGGGAGGAGTTGGTGGG - Intergenic
1186059207 X:5685576-5685598 TTGGTGGTGGTAGAGTTGGTTGG - Intergenic
1186705052 X:12132139-12132161 GTGGTTGTGGTGGAGTTGGGAGG + Intergenic
1188156428 X:26748451-26748473 CTGGAGGCGGTGGTGATGGTGGG - Intergenic
1188174755 X:26975709-26975731 GTGAATGAGGTGGATTTGGCAGG - Intergenic
1188528939 X:31116198-31116220 ATGGTGGAGGTGCTGTTGGTTGG + Intronic
1188530293 X:31132867-31132889 GTGGGGGATGTGGAGGTGGGTGG + Intronic
1188701706 X:33272305-33272327 TTGGACGATGTTGAGTTGGTTGG + Intronic
1188727996 X:33608409-33608431 GAGCAGGAGGTGGAGAGGGTAGG + Intergenic
1189209802 X:39275611-39275633 GTGGAGGGAGAGGAGTGGGTGGG + Intergenic
1189430368 X:40940991-40941013 GTGGAGAAGGGGGAGATGTTAGG - Intergenic
1189605842 X:42676835-42676857 GGGGTGGACGTGGAGTGGGTAGG + Intergenic
1189907369 X:45775167-45775189 GAGGAGGCGGAGGAGGTGGTGGG + Intergenic
1190074935 X:47310000-47310022 ATGGAAGATGTGGAGTTGGGAGG + Intergenic
1190103395 X:47540498-47540520 GTGGTGGGGCTGCAGTTGGTGGG + Intergenic
1190109704 X:47582207-47582229 GTGGAGGTGGGGGAGGTGGCTGG + Intronic
1190296423 X:49030285-49030307 GAGGAGGAGGAGGGGGTGGTGGG - Exonic
1190485464 X:50919286-50919308 GTGGAGGAGGGTGCGTGGGTGGG + Intergenic
1190567230 X:51743368-51743390 GTGGAGGAGTCGGAAGTGGTTGG + Intergenic
1191896137 X:65995324-65995346 CTAGAGGAGGTGGGGTTGGATGG + Intergenic
1192053252 X:67746311-67746333 GTGGGGGCGGTGGGGGTGGTAGG + Intergenic
1192481479 X:71490039-71490061 GTGGAGGGGGTGGAGGAGGAGGG - Intronic
1192553337 X:72070729-72070751 GTGGTGGTGGTGGGGGTGGTGGG - Intergenic
1192631381 X:72780421-72780443 CTGGAGGTGGTGGTGGTGGTGGG + Intronic
1192650328 X:72940380-72940402 CTGGAGGTGGTGGTGGTGGTGGG - Intronic
1193047020 X:77064307-77064329 GTGGAGGAGGAGGAGTAGAATGG + Intergenic
1193610947 X:83631046-83631068 CTGGTGGAGGTGGGGCTGGTTGG + Intergenic
1193652458 X:84154645-84154667 GTGGTGGTGATGAAGTTGGTGGG - Intronic
1194746615 X:97635361-97635383 GTGGTGGTGGTGGTGGTGGTTGG - Intergenic
1194825658 X:98560232-98560254 GTGGGGTAGGTGGAGTGGGGAGG - Intergenic
1195023846 X:100855770-100855792 GTCGTGGAGGTGGTTTTGGTGGG - Intronic
1195370383 X:104166952-104166974 GTGGAAGCGGTGGAGCGGGTCGG - Exonic
1195381557 X:104276133-104276155 TTGGGGGAGGTGCAGTAGGTAGG - Intergenic
1196251314 X:113463469-113463491 GTTGGGGGGCTGGAGTTGGTGGG - Intergenic
1196373148 X:115001102-115001124 GTGGGGCAGGTGGTGGTGGTAGG + Intergenic
1197261958 X:124329054-124329076 GTGGTGGGGGTGGAGGTGGGAGG + Intronic
1197594632 X:128450938-128450960 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1198472215 X:136957722-136957744 TTGCAGAGGGTGGAGTTGGTGGG + Intergenic
1199599940 X:149535866-149535888 GGGGAGGAGAGGGAGTGGGTTGG - Intergenic
1200086077 X:153606559-153606581 GTGGAGGTGCTGGAGCTGGAGGG + Intergenic
1201187283 Y:11416525-11416547 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1201300286 Y:12498872-12498894 GTGGGGGAGGAGGAGGAGGTGGG - Intergenic
1201461769 Y:14233185-14233207 GAGGAGGAGGAAGAGTTGGAGGG - Intergenic
1201616532 Y:15906540-15906562 GTTCAGGAGGTGGCGTTGTTAGG + Intergenic