ID: 1150137885

View in Genome Browser
Species Human (GRCh38)
Location 17:62705620-62705642
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150137885_1150137889 30 Left 1150137885 17:62705620-62705642 CCAATACGATTGTGAACAGATGT 0: 1
1: 0
2: 0
3: 3
4: 151
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1150137885_1150137888 7 Left 1150137885 17:62705620-62705642 CCAATACGATTGTGAACAGATGT 0: 1
1: 0
2: 0
3: 3
4: 151
Right 1150137888 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150137885 Original CRISPR ACATCTGTTCACAATCGTAT TGG (reversed) Intronic