ID: 1150137886

View in Genome Browser
Species Human (GRCh38)
Location 17:62705647-62705669
Sequence AGAACGTTGCTGCGACTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150137886_1150137897 17 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137897 17:62705687-62705709 CTTTAAAGGGGCAGGAAAATGGG 0: 1
1: 0
2: 1
3: 24
4: 294
1150137886_1150137889 3 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1150137886_1150137894 9 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137894 17:62705679-62705701 TTACACCACTTTAAAGGGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 95
1150137886_1150137891 5 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137891 17:62705675-62705697 TCCCTTACACCACTTTAAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 102
1150137886_1150137890 4 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137890 17:62705674-62705696 ATCCCTTACACCACTTTAAAGGG 0: 1
1: 0
2: 1
3: 5
4: 120
1150137886_1150137896 16 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137896 17:62705686-62705708 ACTTTAAAGGGGCAGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 379
1150137886_1150137898 23 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137898 17:62705693-62705715 AGGGGCAGGAAAATGGGCAGAGG 0: 1
1: 0
2: 5
3: 101
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150137886 Original CRISPR AGAACGTTGCTGCGACTAGG AGG (reversed) Intronic