ID: 1150137887

View in Genome Browser
Species Human (GRCh38)
Location 17:62705650-62705672
Sequence CCTAGAACGTTGCTGCGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150137887_1150137899 28 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137899 17:62705701-62705723 GAAAATGGGCAGAGGTGCTGAGG 0: 1
1: 0
2: 2
3: 45
4: 425
1150137887_1150137900 29 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137900 17:62705702-62705724 AAAATGGGCAGAGGTGCTGAGGG 0: 1
1: 0
2: 2
3: 35
4: 338
1150137887_1150137889 0 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1150137887_1150137898 20 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137898 17:62705693-62705715 AGGGGCAGGAAAATGGGCAGAGG 0: 1
1: 0
2: 5
3: 101
4: 928
1150137887_1150137890 1 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137890 17:62705674-62705696 ATCCCTTACACCACTTTAAAGGG 0: 1
1: 0
2: 1
3: 5
4: 120
1150137887_1150137891 2 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137891 17:62705675-62705697 TCCCTTACACCACTTTAAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 102
1150137887_1150137897 14 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137897 17:62705687-62705709 CTTTAAAGGGGCAGGAAAATGGG 0: 1
1: 0
2: 1
3: 24
4: 294
1150137887_1150137896 13 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137896 17:62705686-62705708 ACTTTAAAGGGGCAGGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 379
1150137887_1150137894 6 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137894 17:62705679-62705701 TTACACCACTTTAAAGGGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150137887 Original CRISPR CCTAGAACGTTGCTGCGACT AGG (reversed) Intronic