ID: 1150137888 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:62705650-62705672 |
| Sequence | CCTAGTCGCAGCAACGTTCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 36 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150137885_1150137888 | 7 | Left | 1150137885 | 17:62705620-62705642 | CCAATACGATTGTGAACAGATGT | 0: 1 1: 0 2: 0 3: 3 4: 151 |
||
| Right | 1150137888 | 17:62705650-62705672 | CCTAGTCGCAGCAACGTTCTAGG | 0: 1 1: 0 2: 0 3: 2 4: 33 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150137888 | Original CRISPR | CCTAGTCGCAGCAACGTTCT AGG | Intronic | ||