ID: 1150137889

View in Genome Browser
Species Human (GRCh38)
Location 17:62705673-62705695
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150137886_1150137889 3 Left 1150137886 17:62705647-62705669 CCTCCTAGTCGCAGCAACGTTCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1150137885_1150137889 30 Left 1150137885 17:62705620-62705642 CCAATACGATTGTGAACAGATGT 0: 1
1: 0
2: 0
3: 3
4: 151
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86
1150137887_1150137889 0 Left 1150137887 17:62705650-62705672 CCTAGTCGCAGCAACGTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1150137889 17:62705673-62705695 AATCCCTTACACCACTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type