ID: 1150139085

View in Genome Browser
Species Human (GRCh38)
Location 17:62713618-62713640
Sequence TTACACTCCTGAGCTACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150139081_1150139085 22 Left 1150139081 17:62713573-62713595 CCACCAATCAGAGCAGGCGTGTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1150139085 17:62713618-62713640 TTACACTCCTGAGCTACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 95
1150139082_1150139085 19 Left 1150139082 17:62713576-62713598 CCAATCAGAGCAGGCGTGTGATA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1150139085 17:62713618-62713640 TTACACTCCTGAGCTACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 95
1150139080_1150139085 23 Left 1150139080 17:62713572-62713594 CCCACCAATCAGAGCAGGCGTGT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1150139085 17:62713618-62713640 TTACACTCCTGAGCTACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150139085 Original CRISPR TTACACTCCTGAGCTACAAG TGG Intronic
901760003 1:11464589-11464611 TTACCCTCCTGAGCTCCTAGGGG + Intergenic
902608810 1:17585148-17585170 TTAAACTTATGAGCTACCAGGGG + Intronic
902873393 1:19327165-19327187 TTACAATCCAGAGTGACAAGAGG + Intronic
908879679 1:68716833-68716855 CTGCACTTCTGAGCTTCAAGGGG - Intergenic
915830216 1:159121848-159121870 TTAAACTCCTGTGCTGGAAGTGG - Intronic
1068930720 10:62586396-62586418 TGACACTCCTGTGTTACAAATGG + Intronic
1069838606 10:71325330-71325352 TCACACTCATGAACTACAAAAGG - Intronic
1073485129 10:103812443-103812465 TTACACTCCTGGGCTTCCAAGGG + Intronic
1073733223 10:106315925-106315947 TTCCACTCTTGATCTACTAGAGG - Intergenic
1074578120 10:114690084-114690106 GTGCTCTCCTGAGCTACAAAAGG + Intergenic
1076111345 10:127862001-127862023 GTACACTCATCAGCTCCAAGGGG + Intergenic
1079283042 11:19105089-19105111 TTACAATCCAGAGCTTCCAGTGG + Intergenic
1079306298 11:19326582-19326604 TTCAAATCCTGAGCTATAAGTGG + Intergenic
1081479062 11:43466914-43466936 GTGCTCTCCTGAGCTACAAAAGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083979264 11:66152623-66152645 TCACACTCATGAGCTGCAAAAGG - Intronic
1085975477 11:81648125-81648147 TTCCTCTGCTGAGGTACAAGCGG - Intergenic
1086364441 11:86094194-86094216 TTACACTCATGAACTACAAAAGG - Intergenic
1087398806 11:97637756-97637778 TTATACTACTGTGCTTCAAGTGG - Intergenic
1087935982 11:104035285-104035307 TTACACTCCCCACCTCCAAGGGG + Intronic
1088582221 11:111327488-111327510 TTCCCATCCTGAGCTACGAGAGG - Intergenic
1089725605 11:120476290-120476312 TCGAACTCCTGAGCTCCAAGCGG + Intronic
1099243626 12:80168175-80168197 TTGAACTCCTGAGCTCAAAGTGG + Intergenic
1100082734 12:90873276-90873298 TTACAGGCATGAGCTACCAGGGG - Intergenic
1100343847 12:93707814-93707836 TTACTCTCCTGAGGTTCAGGTGG + Intronic
1101847362 12:108373287-108373309 TTCCACTCCTGAGCCCCAGGAGG + Intergenic
1101919055 12:108918033-108918055 TTACACACCTGAGGTAGGAGGGG - Exonic
1102369951 12:112374238-112374260 TCACACTCCTGTGCTTTAAGTGG - Intronic
1105049280 12:133033932-133033954 TTACACTTCAGAGATACCAGTGG + Intergenic
1105307634 13:19180316-19180338 TTACACTCCTAGGCTTCAAGGGG - Intronic
1105815605 13:24033566-24033588 TTCCAGTCCTCAGCTTCAAGGGG + Intronic
1112262030 13:97885811-97885833 TCACACTTAGGAGCTACAAGAGG - Intergenic
1116810931 14:49539566-49539588 TTACACTCAAGAGCTCCCAGTGG + Intergenic
1120305328 14:82762509-82762531 GTGGCCTCCTGAGCTACAAGTGG + Intergenic
1121219279 14:92274040-92274062 CTCCACTCCTGACCTACTAGTGG + Intergenic
1122643971 14:103179298-103179320 TCAAACTGCTCAGCTACAAGTGG - Intergenic
1137681671 16:50352268-50352290 TTACACTTATGAACTACAAAAGG + Intronic
1139706379 16:68743583-68743605 TTGAACTCCTGAGCTCAAAGTGG + Intronic
1139823840 16:69741453-69741475 GAGCAGTCCTGAGCTACAAGAGG - Intergenic
1141345772 16:83244203-83244225 TTAGACTTGTGAGCTCCAAGAGG + Intronic
1143191161 17:5041169-5041191 TTGAACTCCTGGGCTCCAAGTGG + Intronic
1143409783 17:6701940-6701962 TGACACTCTTGAGCTAAAGGGGG - Intronic
1150139085 17:62713618-62713640 TTACACTCCTGAGCTACAAGTGG + Intronic
1150216270 17:63472132-63472154 GTGCTCTCCTGAGCTACAAAAGG - Intergenic
1150551536 17:66215227-66215249 TCACACTCCAGAGCTCCCAGTGG + Intronic
1152707859 17:81854317-81854339 TTGAACTCCTGAGCTCCGAGTGG - Intronic
1161826561 19:6570591-6570613 ATACACTCCTGAACAACCAGTGG - Intergenic
1165819038 19:38662939-38662961 CTCCACTCCTGAACAACAAGAGG - Intronic
925126642 2:1461825-1461847 ATACACTCCTGAGTTACACAGGG - Intronic
931191691 2:60007526-60007548 TGACACATCTGAGCTACAAACGG + Intergenic
931652979 2:64485208-64485230 TTACAGTCCTGAGTTAAAATCGG - Intergenic
932692032 2:73921399-73921421 TTAGACTCCAGAGCTCCCAGTGG - Intergenic
935189092 2:100761554-100761576 TCACACTCTTGAGCTGCCAGGGG - Intergenic
937896833 2:126982817-126982839 TAACACTCCTTATTTACAAGTGG + Intergenic
942477118 2:176339117-176339139 TTGCTCTCCTGAGCTACAGAAGG - Intergenic
1169237785 20:3945933-3945955 TTACATTCCTGAACTAAAAATGG + Intronic
1170462758 20:16593755-16593777 TCAAACTCCTGAGCTCAAAGTGG - Intergenic
1172805255 20:37607326-37607348 TTACACTCCAGAGCTCCCTGTGG + Intergenic
1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG + Intergenic
1183889493 22:40914881-40914903 TCACACTCATGAGCTACAAAGGG - Intronic
949745521 3:7287576-7287598 TTTCACTCCTGAGTAAGAAGGGG + Intronic
951236864 3:20246382-20246404 TTATACTCCTGGGATACAAGAGG - Intergenic
953357713 3:42268346-42268368 TTCCACTCCTGAGAGACAAGCGG - Intergenic
953958683 3:47250602-47250624 TCACACTCATGAACTACAAAAGG + Intronic
955781548 3:62490027-62490049 TTCCACATCTGAGCCACAAGAGG - Intronic
956639173 3:71398895-71398917 TTACACTCATGAAGTAAAAGCGG - Intronic
966697627 3:182808142-182808164 TTCATCTCCTGAACTACAAGGGG + Intronic
971598911 4:28568167-28568189 GTACACTGAAGAGCTACAAGGGG - Intergenic
972167166 4:36301323-36301345 TTAAACACTTGACCTACAAGAGG + Intronic
972413768 4:38818891-38818913 TTACACTCCTGAACCCCCAGGGG - Intronic
973538588 4:51910232-51910254 TTCCATTCCAGAACTACAAGCGG - Intronic
975337542 4:73197144-73197166 GTGCACTCCCCAGCTACAAGAGG + Intronic
976093436 4:81481158-81481180 TTATGCATCTGAGCTACAAGAGG - Intronic
979138246 4:117138172-117138194 ATACACTCCTAAACAACAAGTGG + Intergenic
987736568 5:21852796-21852818 GAACACTCCTGAGAGACAAGAGG - Intronic
993943281 5:94087868-94087890 TTACACACCTGGGCTACATATGG - Intronic
994422783 5:99542663-99542685 TTAGACTCCTTAGTAACAAGAGG + Intergenic
995846630 5:116500783-116500805 TCAAACTCCTGACCTTCAAGTGG - Intronic
996115188 5:119610281-119610303 TCATGCTCATGAGCTACAAGAGG + Intronic
996502373 5:124230944-124230966 TCACATTCCTGAGGTACTAGAGG + Intergenic
1001590290 5:172860167-172860189 TCACACACCTGAGCTACCTGAGG - Intronic
1002916146 6:1529380-1529402 TCACACTCCTGAGCTTCTTGGGG + Intergenic
1004033254 6:11894412-11894434 TAGCACTCCTGATTTACAAGTGG + Intergenic
1009334761 6:62473290-62473312 TGACACTCCTGCTCCACAAGTGG - Intergenic
1010261731 6:73824631-73824653 TCACACCCCTGAACTAGAAGAGG - Exonic
1010448524 6:75976339-75976361 TTAAACTCCTAAGCTCAAAGTGG - Intronic
1011114975 6:83879672-83879694 TTACACAGCTGTGCTACCAGTGG + Intronic
1011622501 6:89256180-89256202 TTAAAATCCTGACCTTCAAGGGG + Intergenic
1012094400 6:94940412-94940434 ATACACTCCTGAGTCACCAGTGG + Intergenic
1022387175 7:29912530-29912552 TCACGCTCATGAACTACAAGAGG - Intronic
1026174917 7:67988158-67988180 TCAAACTCCTGAGCTCAAAGTGG + Intergenic
1026217601 7:68363501-68363523 TTACACTCCTGAATTTCAGGAGG - Intergenic
1033760802 7:144434764-144434786 GTGCTCTCCTGAGCTACAAAAGG + Intergenic
1044891229 8:96838101-96838123 TAACTCACCTGGGCTACAAGTGG - Intronic
1045404020 8:101847336-101847358 TCACGCTCATGAGCTACAACAGG + Intronic
1047356765 8:124129478-124129500 TTGCCCTCCTGGGCTACCAGTGG - Intergenic
1049567077 8:143346217-143346239 CTTCACTCCTGAGCTTCAGGAGG - Intronic
1053490836 9:38500622-38500644 ATACACTCTTGAGCTACCAGTGG - Intergenic
1057671152 9:97089835-97089857 ATACACTCTTGAGCTACCAGTGG - Intergenic
1058465789 9:105225792-105225814 TTACACTGCTGTTCCACAAGTGG + Intergenic
1059587765 9:115624535-115624557 TTTAATTCATGAGCTACAAGTGG + Intergenic
1185780801 X:2843163-2843185 TTACACTCCTGAGGGACAGCAGG - Intronic
1192040293 X:67613183-67613205 TGACACCCCTGTTCTACAAGTGG - Intronic
1201289273 Y:12406965-12406987 TTACACTCCTGAGGGACAGCAGG + Intergenic