ID: 1150139773

View in Genome Browser
Species Human (GRCh38)
Location 17:62717830-62717852
Sequence AGGATCTGGGTGGGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150139773_1150139780 14 Left 1150139773 17:62717830-62717852 CCATCTCTTCCCACCCAGATCCT 0: 1
1: 0
2: 8
3: 81
4: 654
Right 1150139780 17:62717867-62717889 CTGTCATAGTTCTTTCTAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150139773 Original CRISPR AGGATCTGGGTGGGAAGAGA TGG (reversed) Intronic
900615707 1:3564807-3564829 AGGACCTGGGTGGGCCCAGATGG - Intronic
900660241 1:3778433-3778455 AAGATCTGGGTGGGGACAGGAGG + Intergenic
900742176 1:4337315-4337337 TGGGGCTGGGTGGGAAGAGGGGG + Intergenic
901144848 1:7057904-7057926 AGGATCTGGGGGTCCAGAGAAGG - Intronic
901843081 1:11965741-11965763 AGGATTTGGGTAGGGAGAGAAGG + Intronic
902171305 1:14613735-14613757 AGACTCTGGGTGGCCAGAGAAGG - Intronic
902598263 1:17523678-17523700 AGGCACTGAGTGGGAAGAGCAGG - Intergenic
903000660 1:20263177-20263199 AGAATGTGGGTGGGGAAAGAGGG + Intergenic
903211447 1:21821625-21821647 ATGATTTTGGTGGGAAGAGTAGG - Intronic
903354918 1:22740738-22740760 GGGCTCTGGGAGGGATGAGACGG - Intronic
903474557 1:23610707-23610729 AGGCTCTGGCAGGGAACAGATGG + Intronic
903545708 1:24122109-24122131 AGGGTCAGGGTGGGAAAAGAAGG + Intronic
903714949 1:25358439-25358461 TGGAGGTGGGTGGGAAGGGAAGG - Intronic
904263492 1:29304669-29304691 AGGATGGGGGTGGGATGATAAGG - Intronic
904699760 1:32351453-32351475 CGGAACTGGGTGGGAAGGGCGGG - Intergenic
904927082 1:34057724-34057746 AGAGTCTGGGTGGGCAGAGCTGG - Intronic
904989061 1:34576663-34576685 GGGATCTGGGGGAGAAGGGATGG - Intergenic
905203783 1:36331187-36331209 AGAAGCTGGGTGGTTAGAGAGGG - Intergenic
905365594 1:37449619-37449641 AGGCTCTGGGAAGGCAGAGATGG - Intergenic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905654691 1:39678593-39678615 AGGATTGGGGTGGGGAGAAAGGG - Intergenic
906220194 1:44072242-44072264 TGGGTTTGGGTGGGAAGACAAGG + Intergenic
906509220 1:46401235-46401257 AGAATCAGAGAGGGAAGAGAAGG + Intronic
907105410 1:51878385-51878407 AGGATCTGGGCGAGAACAGCCGG - Exonic
907425357 1:54375919-54375941 AGGCTCTGGGAGGAAAGGGAGGG + Intronic
907475400 1:54701960-54701982 GGGGTCTGGCTGGGAAGAGTCGG + Intronic
907475526 1:54702818-54702840 AGGATGCTGGTGGGAAAAGAAGG - Intronic
907903701 1:58764950-58764972 CGGATTTGGGTGAGAAAAGAGGG - Intergenic
909150614 1:71998587-71998609 AGAATCTGTGTAGCAAGAGAAGG - Intronic
909495141 1:76269838-76269860 AGAATCTGGGAGAGAAGACAGGG - Intronic
910705578 1:90126032-90126054 AGGGGCGGGGTGGGAAGGGATGG + Intergenic
911042065 1:93598942-93598964 AGGTTCTGGCTAGGAGGAGAGGG + Intronic
911190726 1:94946013-94946035 AAGATCTGTGTGGGAAAACAAGG + Intergenic
911254794 1:95621164-95621186 AGGAACTGGGTGGGAAGGAAAGG + Intergenic
912091498 1:106081735-106081757 GGGATCAGGGTGGGTAGAGAGGG - Intergenic
912259604 1:108097226-108097248 AGGATGTGGGTAGAAAGAAAGGG - Intergenic
912681244 1:111730301-111730323 AGGCTCTAGTTGGGAAGACAAGG - Intronic
912709083 1:111937084-111937106 TGGATCTGGGTGTGGGGAGAGGG + Intronic
912763554 1:112389019-112389041 AGGGGAGGGGTGGGAAGAGAGGG + Intergenic
912844540 1:113067645-113067667 AGGAAATGGGAAGGAAGAGATGG + Intergenic
913219859 1:116650684-116650706 AGGATGGGGGTGGCAAGTGAGGG - Intronic
914754441 1:150554651-150554673 AGGGTCGGGGTGGGAGGAGGAGG + Intronic
915708963 1:157875078-157875100 AGGCTCTGGGTGGTGAGAGGAGG - Intronic
916018747 1:160775076-160775098 AGGATGTGGTGGGGAAGAGGAGG + Intergenic
916492581 1:165314986-165315008 AGGGTCTGGGAAGCAAGAGAAGG - Intronic
917238370 1:172919217-172919239 GGGACCTGCCTGGGAAGAGATGG - Intergenic
917485046 1:175448168-175448190 AGGATGTGGGAGGTAAGATAAGG - Intronic
917931653 1:179826640-179826662 AGGATTTGGGTGGGTGGAGGAGG - Intergenic
918208776 1:182332614-182332636 TGCATCTGGGAGTGAAGAGAGGG - Intergenic
918301984 1:183212957-183212979 GGGGTCTGAGTGAGAAGAGAAGG - Intronic
918302561 1:183217156-183217178 AGGATTTGGGTGGGATCATAGGG + Intronic
918334882 1:183498914-183498936 AGGAGTTGGAGGGGAAGAGAGGG - Intronic
918423758 1:184387704-184387726 AGGGTGCGGGTGGGAAGGGAGGG - Intronic
919098078 1:193060161-193060183 AGGATCTTTGTGGGAAGACAGGG + Exonic
919359840 1:196578719-196578741 GGGATTTGGATGGGAGGAGAGGG + Intronic
919659907 1:200234194-200234216 AGGAGTAGGGTGGGGAGAGAGGG - Intergenic
919920840 1:202165636-202165658 GGGATGAGGGTGGGATGAGAAGG + Intergenic
921299874 1:213741787-213741809 AGGGTCGGGGTGGGAAGTGGAGG + Intergenic
922002496 1:221494318-221494340 AGGGTAAGAGTGGGAAGAGATGG - Intergenic
922190816 1:223316854-223316876 AGGATCTGGTTGGCCAAAGAAGG + Intronic
922314197 1:224427412-224427434 AAGATCTTGGTGGGAAAATAAGG - Intronic
923239990 1:232074336-232074358 AAGAACTTGGTGGGAAGAGTAGG + Intergenic
923418307 1:233787217-233787239 GTGATCTGGGTGGGAAGAATGGG - Intergenic
924172977 1:241360314-241360336 AAGATCTGGGTGTGAAGTGGGGG - Intergenic
924410042 1:243795238-243795260 AAGATCTGTGTGGGAAAACAGGG + Intronic
924474517 1:244371451-244371473 AGGAGATGGGTGTGGAGAGAGGG - Intronic
924604156 1:245517776-245517798 AGGAGGTGGCTGGGAAGGGAGGG + Intronic
1062904371 10:1169894-1169916 AGCACCTGAGTGGGAAGAGGGGG + Intergenic
1063576900 10:7270267-7270289 AGGCTCTGGGTGGAAGCAGAGGG - Intronic
1063605960 10:7523121-7523143 AGAATGTGGGTAGGAAAAGATGG - Intergenic
1064031365 10:11885358-11885380 AGGAGATGGGTGGGTAGAGATGG + Intergenic
1064031375 10:11885397-11885419 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064031396 10:11885475-11885497 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064638715 10:17394220-17394242 AGGATCTGGGATAGAAGTGAAGG + Intronic
1064865472 10:19873987-19874009 TGGATCTGGGTGGCCAAAGAAGG + Intronic
1065133167 10:22643164-22643186 AGGAGATGGGTGGGAAGAAGGGG - Intronic
1065596229 10:27314592-27314614 AGGTTTTGAGTGGGAGGAGAAGG - Intergenic
1065920981 10:30392609-30392631 AGGATCAGGGTGGGGAGGCAGGG + Intergenic
1067156014 10:43781970-43781992 GGGATCCGGGTGGGAGCAGAGGG + Intergenic
1068144953 10:53057197-53057219 TGGAACTGGGTGGCTAGAGATGG + Intergenic
1068407956 10:56617110-56617132 ATGAACTGGGTGGGGAGCGATGG - Intergenic
1069164963 10:65143481-65143503 GGTATCTGGGTGGCAGGAGAAGG - Intergenic
1069874166 10:71551532-71551554 AGGTTCTGGTAGGGAAGAGAAGG + Intronic
1070051597 10:72895293-72895315 AGGAGAAGGGTGGGAAGAAAGGG - Intronic
1070432677 10:76357112-76357134 AGGAGCAGGGTTGGAAGAGAGGG - Intronic
1070753605 10:78977971-78977993 GGGATGTGTGTGGGATGAGAGGG - Intergenic
1070761027 10:79024536-79024558 AAGTACAGGGTGGGAAGAGAGGG - Intergenic
1070921730 10:80191452-80191474 AGGATCTGGAAGGAAAGAGAAGG - Intronic
1071856628 10:89632282-89632304 AGGATCTGTGTGGCAAAAAAGGG - Intronic
1072677352 10:97477925-97477947 AGGCTCTGGGGGAGAGGAGAAGG + Exonic
1073318002 10:102596457-102596479 AGGGTCTCGATGGGGAGAGAAGG + Intronic
1073498878 10:103918339-103918361 GGGGTCTGGGTGGGATGAGGCGG - Intergenic
1074764020 10:116687276-116687298 AGGATGCAGGTGGGAAGCGAAGG + Intronic
1075038260 10:119087299-119087321 AGAATCTGAGTGGGAAAAGGGGG - Intergenic
1075228877 10:120654627-120654649 AGAAGCTGGGGGAGAAGAGAAGG + Intergenic
1075271460 10:121055444-121055466 AGGATATGGGAGGGAAAAAAAGG + Intergenic
1075621993 10:123934765-123934787 AGGAAATGGGTGGGGAGAAAGGG - Intronic
1075819936 10:125298411-125298433 AGGATCTGGGTGGCCAGGGTGGG - Intergenic
1076508869 10:130998311-130998333 TAGATCTGTGTGGGCAGAGAGGG + Intergenic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077243992 11:1527027-1527049 AGGAATTGGGTGGGAACAGCGGG + Intergenic
1077360566 11:2138726-2138748 AGGAGCTGGGGGGGACGGGAGGG + Intronic
1077417525 11:2431697-2431719 GAGATCTGAGTGGGAAGAGGGGG - Intergenic
1078507647 11:11964678-11964700 AGGCTGTGGCTGGGGAGAGATGG + Exonic
1078536124 11:12175870-12175892 AGGCTGGGGGTGGTAAGAGATGG + Intronic
1078582260 11:12547592-12547614 TAGATCTGTGTGGGAATAGAAGG + Intergenic
1078641212 11:13098434-13098456 AGGATTTGGGTCAGAACAGATGG + Intergenic
1078778394 11:14414725-14414747 AGGATCTGGGTTAGGAGACATGG + Intergenic
1078790805 11:14540118-14540140 CAGAGCTGGGTGGGTAGAGAGGG - Intronic
1078850407 11:15158024-15158046 AGGATATGAGTGTGAAGAAAAGG - Intronic
1078855759 11:15205581-15205603 AGGGTCTGGTGGGGAAGGGAGGG + Intronic
1079318284 11:19428745-19428767 AGAATCAGGGTGGGAAGAGAAGG + Intronic
1080590619 11:33720349-33720371 TTGACCTGAGTGGGAAGAGAAGG + Intronic
1081709093 11:45205536-45205558 TGGATCTGGGTGGGAGGGGAAGG + Intronic
1083197904 11:61102128-61102150 GGGGTCTGGGTGGGGAGAGGCGG - Intergenic
1083427267 11:62594661-62594683 GGGAACTGCGTGGGAAGAAAAGG - Intronic
1083573199 11:63770801-63770823 AGAATGTGGGTGGGAAGGGGAGG - Intergenic
1084013830 11:66367368-66367390 GGGCTCTGGCTGGGAACAGATGG + Intronic
1084361003 11:68668446-68668468 AGGACCTGGGTAGGAAAGGAGGG - Intergenic
1085395353 11:76204475-76204497 AGGATTTGGATGGTCAGAGACGG - Intronic
1085554285 11:77405715-77405737 AGGATGTGGGTGTCAAGGGAAGG - Intronic
1085817448 11:79755144-79755166 AGGATCAGAGTGGAAAGAGACGG - Intergenic
1087029536 11:93689073-93689095 AGGATGTAGGTGGAAAGAAATGG - Intronic
1087242243 11:95791977-95791999 AGGATCTAGGGGGAAAGAGTTGG + Intronic
1088752483 11:112856303-112856325 AGGATCAGTGTGGGAAAAGGTGG + Intergenic
1088840778 11:113625905-113625927 AGAATCTGGGTGGTCAGAGAGGG + Intergenic
1089514566 11:119024394-119024416 TGGATATAGGTGGGAAGAAAAGG - Exonic
1089538180 11:119173461-119173483 AGCTTCTGAGTGGGAAGATAAGG - Exonic
1089697666 11:120225939-120225961 AGGAGCTGGGTGGGAGGCTAAGG - Intronic
1089769434 11:120792735-120792757 AGAATCTAGGAGGGAAGAGGTGG + Intronic
1089848915 11:121480592-121480614 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089848939 11:121480700-121480722 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089848951 11:121480754-121480776 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089848963 11:121480808-121480830 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089848995 11:121480970-121480992 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849039 11:121481186-121481208 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849049 11:121481240-121481262 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849062 11:121481294-121481316 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849083 11:121481402-121481424 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849139 11:121481666-121481688 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1089849163 11:121481774-121481796 AGGAGCTGGGGAGGAGGAGATGG - Intronic
1090075354 11:123577323-123577345 GGGAGCGGGGTGGAAAGAGAAGG - Intronic
1090437968 11:126702704-126702726 AGGAGGTGGCTGGGCAGAGAGGG - Intronic
1090521046 11:127479807-127479829 AGGAGCTGGGTGGTCAGAAATGG - Intergenic
1090768785 11:129900185-129900207 AGGACCTGGATTTGAAGAGATGG - Exonic
1091219595 11:133922218-133922240 AGGGTCTGGAAGGAAAGAGAAGG + Exonic
1091413753 12:262141-262163 AGGGTCTGGGAGGGTGGAGAAGG - Intronic
1091737891 12:2938299-2938321 AGGGGTTGGGTGGGAAGAGGAGG + Intronic
1091962872 12:4713432-4713454 ATGAGCTGGGTGGGAGGAGGTGG - Intronic
1092255926 12:6926980-6927002 AGGTTCTGGGTGAGAAAGGAGGG - Intronic
1095773350 12:45986856-45986878 AGAATCTTGGTGGGAGGAGAAGG - Intronic
1095952499 12:47789487-47789509 AAGACCTGGGTGGGATGAGGTGG - Intronic
1096353095 12:50916559-50916581 AGGAGATGGGAGGAAAGAGAAGG + Intergenic
1096496011 12:52039897-52039919 AGGCCCTGAGTGGGGAGAGAAGG + Intronic
1096631325 12:52928476-52928498 AGGTTCTGTGTGTGAAGGGAGGG - Intronic
1097895817 12:64824404-64824426 AAGATCTGGGAGGGAACAGAGGG - Intronic
1098790306 12:74814682-74814704 AGGATGTGGGTGGGAACAAAAGG + Intergenic
1098975248 12:76895735-76895757 AGAATCTGTGTGCTAAGAGAGGG + Intergenic
1100371714 12:93974821-93974843 AGGATCTTGCAGGAAAGAGATGG + Intergenic
1100493033 12:95099368-95099390 AGTGTGTTGGTGGGAAGAGATGG + Intronic
1101021392 12:100557842-100557864 TGGATCTGGTTTGGAAGAAATGG + Intronic
1101217566 12:102600034-102600056 AGGAGCTGGTTGGGAAGACAGGG - Intergenic
1101422428 12:104560514-104560536 GAGATAGGGGTGGGAAGAGACGG + Intronic
1101698596 12:107150748-107150770 AGCATCTGGGAGGGAGGAGATGG - Intergenic
1102042602 12:109810324-109810346 AGGGTCTGGGAGGGAGAAGAGGG + Intronic
1102490203 12:113286019-113286041 GGGATCAGGGTGTGCAGAGAAGG - Intronic
1102717481 12:114986644-114986666 AGGACATGAGTGGGGAGAGAAGG - Intergenic
1102983940 12:117263966-117263988 GGGATCAGGCTGGGAAGAGAAGG + Exonic
1103187764 12:118975851-118975873 AGAATCTCAGTGGGAGGAGAAGG - Intergenic
1103662041 12:122527864-122527886 AGGATTTGTTTGGGAAGGGAAGG - Intronic
1104304057 12:127593406-127593428 AGGAGCTGAGAGGGAACAGAGGG + Intergenic
1104502336 12:129298012-129298034 ACAATCTGGGTGGGGAGACATGG + Intronic
1104842615 12:131832082-131832104 AGGATCTGGGGGGGACGGGAAGG + Intronic
1104842646 12:131832155-131832177 AGGATCTGGGGGGGAAGGGAAGG + Intronic
1104842661 12:131832191-131832213 AGGATCTGGGGGGGACGGGAAGG + Intronic
1104842674 12:131832227-131832249 AGGATCTGGAGGGGAAGGGAAGG + Intronic
1104842689 12:131832263-131832285 AGGATCTGGGGGGGACGGGAAGG + Intronic
1105362710 13:19735346-19735368 AGTAAATGGGTGGAAAGAGAAGG + Intronic
1105431482 13:20341119-20341141 AGGCTGTGGGTGGGAAGACCGGG - Intergenic
1106512279 13:30421997-30422019 GGGATGTGGGAGGGGAGAGAAGG + Intergenic
1107052761 13:36069648-36069670 AGGATCCAGGTGGGAAGAGGTGG - Intronic
1109546265 13:63840667-63840689 AGAGTCTGGGGGGGAAGAGGGGG - Intergenic
1110130807 13:72007253-72007275 AGGATATGGGGGGAATGAGAGGG + Intergenic
1110160649 13:72374167-72374189 ACGATGTTGGTTGGAAGAGAAGG - Intergenic
1110234797 13:73205467-73205489 AGGAGCTGAGTGGGATCAGAAGG + Intergenic
1110535139 13:76642533-76642555 ATGACCTAGGTGGTAAGAGAGGG + Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1111647964 13:91055955-91055977 AGGATCAGGGTGTGAGGAGTGGG + Intergenic
1112527355 13:100164005-100164027 AGGATAGTGATGGGAAGAGAAGG - Intronic
1112547164 13:100382207-100382229 TGGCTCTCAGTGGGAAGAGAGGG + Intronic
1112565425 13:100547831-100547853 GGGGCCTGGGTGGGCAGAGAAGG - Intronic
1112894211 13:104278425-104278447 AGGAACTAGGTGGGAGGTGATGG - Intergenic
1113149116 13:107242302-107242324 AGAAGCTGGGTGGGAGGAGGAGG + Intronic
1113333343 13:109353540-109353562 ATGATCTTGGTAGGAAAAGACGG + Intergenic
1113399254 13:109976154-109976176 AGGTTGTGGGCAGGAAGAGAGGG + Intergenic
1113701218 13:112390103-112390125 AGGGGCTGAGTGGGAAGAGAAGG + Intronic
1114008635 14:18342508-18342530 AGGTTTTGGGTGTGAGGAGAAGG - Intergenic
1114568222 14:23647776-23647798 AAGAACTTAGTGGGAAGAGAAGG - Intergenic
1114595460 14:23908287-23908309 GGGATCTGGGTGGGAAGAAGTGG - Intergenic
1115461083 14:33661873-33661895 TGGGAGTGGGTGGGAAGAGAGGG - Intronic
1115941698 14:38617619-38617641 AGGATCTGCATGGGAAGGGAGGG - Intergenic
1117502403 14:56366407-56366429 AGCACCTGGGTGGGAAGGGAAGG + Intergenic
1117724903 14:58663510-58663532 AGGAGCTGAGTGGGAGCAGAAGG + Intergenic
1117872825 14:60218701-60218723 AAGATCAGGGTGGGAAGGGGTGG - Intergenic
1118736855 14:68707142-68707164 AGGATCTGGAAGGGCAGAAAGGG - Intronic
1118755804 14:68843193-68843215 AGGCTGTAGTTGGGAAGAGAGGG - Intergenic
1119117171 14:72035003-72035025 AAGTTCTGGGTGGGATGAAATGG - Intronic
1119279665 14:73394684-73394706 AGGATCTAGGGAGGAAGAGAGGG - Intronic
1119672468 14:76530053-76530075 AGAATCTGGATGTGAAGAGGAGG - Intergenic
1119743371 14:77028012-77028034 AGGAGGTGGGGGCGAAGAGAGGG - Exonic
1119876099 14:78060704-78060726 AGACCATGGGTGGGAAGAGAAGG + Intergenic
1120074347 14:80138727-80138749 AGCTTCTGGGTGGCAAGAGAGGG - Intergenic
1120248111 14:82029329-82029351 AGGTATTGGGTGGGAAGAGGTGG - Intergenic
1120680322 14:87472963-87472985 AGGACAGGGGTGGGAAGAGTGGG - Intergenic
1120713740 14:87818687-87818709 ATCATCTGGCTGGGAAAAGAAGG + Intergenic
1120944817 14:89984254-89984276 GGGATGTGGGTTGGAAGAGGTGG + Intronic
1121023604 14:90598333-90598355 AGGATCTAGGTGGGAGGGCAAGG - Intronic
1121157634 14:91701486-91701508 AGGATTTGGGTGGATAGAGCGGG + Intronic
1122183707 14:99972754-99972776 AGGATCTGGAGAGGAAGGGAGGG - Intronic
1122301851 14:100735870-100735892 GGGTTCTGGGTGGGCAAAGAGGG - Exonic
1122438950 14:101717130-101717152 AGGACCTGGGAAGGAAGGGAGGG + Intergenic
1123780478 15:23622001-23622023 AGGGCATGGGTGGGAAGAAATGG - Intronic
1124362042 15:29044683-29044705 AGGCTCTGGGAGGGGAGAAAAGG + Intronic
1124589428 15:31040342-31040364 AGTCTCTGGGGGGAAAGAGAAGG + Exonic
1124707545 15:31978026-31978048 AGGATCGGGGTGTGGACAGAGGG - Intergenic
1125269945 15:37927883-37927905 AGGCTGGGGGTGGGAAAAGAGGG + Intronic
1125440118 15:39692840-39692862 TGGATCTGAATGGGAAGAAAGGG + Intronic
1125549699 15:40536337-40536359 AGGTTCAGAGTGGGAAGACAGGG - Intronic
1126561902 15:50053067-50053089 TGGATCAGGGTGGGGACAGAAGG + Intronic
1126778539 15:52119397-52119419 AGGAGATGGGAGGGAGGAGATGG + Exonic
1127005068 15:54559630-54559652 AGGATGGGGGAGGGCAGAGAGGG + Intronic
1127332629 15:57953949-57953971 AGTATGTGGATGGGAAGAAAGGG + Exonic
1127688984 15:61376098-61376120 AGAAGCAGGGTGGGAAGAAAAGG + Intergenic
1127690542 15:61391814-61391836 TGGAACTGGGAGTGAAGAGATGG + Intergenic
1127710881 15:61596964-61596986 GGTATCTGGGAGGGAGGAGAGGG - Intergenic
1128566831 15:68706289-68706311 AGGAGCAGTGTTGGAAGAGAGGG - Intronic
1128662824 15:69514696-69514718 AGGGACTGAGAGGGAAGAGATGG - Intergenic
1129609087 15:77038749-77038771 GGGAGATGGGTGGGAAGAGAGGG + Intergenic
1130895614 15:88168360-88168382 TGGAGATGGGTGGGAAGGGAAGG + Intronic
1130901245 15:88208228-88208250 GGGATGTGGGAGGGAAGAAATGG - Intronic
1131021814 15:89105640-89105662 AGGACCTGGTTTGTAAGAGATGG + Intronic
1131046996 15:89322683-89322705 GGTCCCTGGGTGGGAAGAGAGGG + Intronic
1132298875 15:100764248-100764270 AGGAACTGGGGGTGAAGGGAAGG - Intergenic
1132397272 15:101483055-101483077 AGGTTCTGGGTGTGAACTGAGGG - Intronic
1132699471 16:1216176-1216198 AGGAAATGGGTGGGAACAGGAGG - Intronic
1132976904 16:2715571-2715593 AGCATCTGGGTGGGAGGGGCTGG + Intronic
1133217123 16:4299347-4299369 CGGGTCTGGCTGGGAAGAGGTGG - Intergenic
1133568724 16:7020761-7020783 AGGATGTGGGTGGGAATGCAGGG - Intronic
1133590788 16:7241043-7241065 TGGATTTGGGTTGGAAAAGAAGG + Intronic
1134641099 16:15829793-15829815 AGGAACAGGGAGGGAAGGGAGGG + Intronic
1135131523 16:19857862-19857884 AGGTGGAGGGTGGGAAGAGAAGG - Exonic
1135150611 16:20002204-20002226 GGGCTGAGGGTGGGAAGAGAAGG - Intergenic
1135374508 16:21934182-21934204 AGGATGAGGGTGGGGTGAGAGGG - Intergenic
1135424322 16:22324786-22324808 TGGATCTGGGTGTGAAGGGCAGG + Intronic
1135612062 16:23876981-23877003 AGGATATGGGGGGGGAGGGATGG + Intronic
1135668598 16:24356100-24356122 AGGAGTGGGGTAGGAAGAGATGG - Intronic
1136046413 16:27618725-27618747 AGGAGCAGGGAGGGAAGAGGCGG - Intronic
1136222300 16:28836246-28836268 GGGTTCTGGGTGGGGAGTGAGGG + Intronic
1136922370 16:34343793-34343815 AGGATGTGGGAGGGAAGAGGCGG - Intergenic
1136982203 16:35068013-35068035 AGGATGTGGGAGGGAAGAGGCGG + Intergenic
1137368651 16:47883845-47883867 GGCATCTGGGTGGGAGGAAATGG - Intergenic
1137766227 16:50979630-50979652 AGAATCTGAATGGGAAGAGGTGG - Intergenic
1137813374 16:51374719-51374741 AGGATGTGGGTGGAACCAGAGGG + Intergenic
1138153803 16:54684546-54684568 AGGAGAGTGGTGGGAAGAGAAGG + Intergenic
1138274025 16:55718055-55718077 TGGATCTGGGAAAGAAGAGATGG + Intergenic
1138589246 16:57990682-57990704 GGGATTTGGGTAGGAAGAGGTGG - Intergenic
1139446375 16:67001038-67001060 GGGGACTGGGTGGGAAGGGAGGG + Intronic
1139967663 16:70754643-70754665 AGGAGCTGGGTGGGCACTGATGG - Intronic
1140246250 16:73252621-73252643 AAGCTCAGGGTGGGAGGAGACGG + Intergenic
1142033602 16:87850574-87850596 AGGCTCTGGGAGAGAAGAGAAGG + Intronic
1142246656 16:88973278-88973300 AAGATTTGGGAGGGAGGAGACGG + Intronic
1142292847 16:89200764-89200786 ACGATCTGCGTGAGAAGAGATGG - Intronic
1142482803 17:229184-229206 AGCATCTGGGTGGGGAGAGGAGG - Intronic
1142762143 17:2049039-2049061 AGGAGCCGGGTGGGGAGTGAAGG + Intergenic
1143012477 17:3873504-3873526 TGGAGCTGGGTGGGCAGAGGTGG - Intronic
1143033348 17:3980475-3980497 AGGACCTCGGAGGGTAGAGACGG + Intergenic
1143213981 17:5210332-5210354 AGGAGGTGGGTGGGGTGAGAGGG + Exonic
1143619712 17:8073919-8073941 ATGATCTGGGTGAGGGGAGATGG - Intronic
1143681263 17:8477639-8477661 AGGGTGGGGGTGGGAAGGGAAGG + Intronic
1143744973 17:8986293-8986315 AGGAAGTGGGTGGGCAGAGGTGG + Intergenic
1143953703 17:10653146-10653168 AGGATCTGTGTGGGTGGATATGG + Intronic
1145106997 17:20126095-20126117 AGGACCTGGATGGAAAGAGTTGG - Intronic
1145172744 17:20673741-20673763 AGGGACTTGGTGGGAAGTGATGG + Intergenic
1145836340 17:27956868-27956890 AGGCTCAGGGAGGGGAGAGAGGG - Intergenic
1145935143 17:28710968-28710990 AGGAGTAGGGTGGGAAGGGAGGG + Intronic
1146486864 17:33249899-33249921 GGGATCATGGTGGGAGGAGAAGG + Intronic
1146673329 17:34756823-34756845 AGGCTGTGGGTGGGAGGAGGGGG - Intergenic
1146676003 17:34774354-34774376 AGGCTCTGGGAGGGCAGGGAAGG - Intergenic
1147057568 17:37846082-37846104 AGGAACTGGGTGGGCAGGCAAGG + Intergenic
1147197598 17:38777961-38777983 AGGCTTTGGGTGGGCAGGGAGGG + Intronic
1147394722 17:40133082-40133104 TGGAGCTGGATGAGAAGAGAAGG + Exonic
1147567705 17:41547855-41547877 TGGGTCTGTGTGGGGAGAGACGG - Intergenic
1147725862 17:42565870-42565892 AGGATGTTGGGAGGAAGAGAGGG - Intronic
1147744521 17:42687150-42687172 AGCATCTGGCTGGGGACAGAGGG - Intronic
1147845597 17:43402119-43402141 AGGACCTGGGGAGAAAGAGAAGG + Intergenic
1147965666 17:44193119-44193141 AGGAGTTGGGTGGGAAGAGAGGG - Exonic
1148346954 17:46909789-46909811 AGGTGCTGGGTGGGAGGAGGAGG - Intergenic
1148575378 17:48706874-48706896 AGGCAGGGGGTGGGAAGAGAGGG - Intergenic
1149525577 17:57352904-57352926 AGGATCAGGGTGTGGAGAGTAGG + Intronic
1149657903 17:58319873-58319895 ATGATCAGGGTGGCTAGAGAGGG + Intronic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1150215482 17:63466476-63466498 AGCATGGGGGTGGGAAGAGAAGG + Intergenic
1150534094 17:66017349-66017371 ATTATCTGGGTGGGAAAATAAGG + Intronic
1150642538 17:66959207-66959229 AGGAGCAGGGGAGGAAGAGACGG + Intergenic
1150724578 17:67641007-67641029 ATGATCTGGTTGGGAGGATATGG + Intronic
1151143319 17:72016187-72016209 AGATGCTGCGTGGGAAGAGATGG + Intergenic
1151556563 17:74849754-74849776 AGGCCCAGGGTGGGCAGAGACGG - Intronic
1151701055 17:75742763-75742785 TGGGTCTGGGTGGGGAGAGTGGG + Intronic
1151824997 17:76519228-76519250 AGGATGTGGGGGGGAAGCCAGGG - Intergenic
1151899601 17:77003096-77003118 AGGAGCGGGGAGGGGAGAGAGGG - Intergenic
1152706571 17:81846625-81846647 AGGATCTGGGGGAGAAAAGGAGG + Exonic
1153658558 18:7306466-7306488 AAGATCTGGGTGCTACGAGAGGG + Intergenic
1154257812 18:12799550-12799572 AGGATCAGGGTGTGAAGTAAAGG - Intronic
1155012361 18:21792403-21792425 TGGGGCTGGATGGGAAGAGAAGG - Intronic
1156588835 18:38462886-38462908 AGTTTATGGGTGTGAAGAGAAGG + Intergenic
1156674912 18:39515888-39515910 TGGATCTGGCTGGGGAAAGAGGG - Intergenic
1157896823 18:51477268-51477290 AGTATTTGGGTGGCAAGAGAAGG - Intergenic
1159415482 18:68142308-68142330 AGGATATGGGTGGGCAAAGAAGG + Intergenic
1160701300 19:508651-508673 AGGAAGGGGGTGGGAAGAGCAGG + Intronic
1160874643 19:1291372-1291394 AGGACCTGGGTGGGACCTGAAGG - Intronic
1161627877 19:5337713-5337735 AGCATCTGGGTGGGGAGACCTGG - Intronic
1161640364 19:5418903-5418925 AGGATGTGGGTGGGAGGAAGAGG + Intergenic
1161962319 19:7529572-7529594 AGGATCTGGGTTGGGGCAGAGGG - Exonic
1161964300 19:7539901-7539923 AGGATCCTGGTGGGAGGGGAGGG - Exonic
1162099777 19:8332960-8332982 AGGAAATGGGTGGGGGGAGAGGG - Intronic
1163090975 19:15020443-15020465 AGGGTCTGGGTGGGGAGGGGAGG - Exonic
1163184748 19:15629506-15629528 AGGGCCTGGCTGGGAAGAGGCGG + Exonic
1163586713 19:18168375-18168397 AGGGTCTGGCTGAGGAGAGAGGG - Intronic
1164983703 19:32632722-32632744 AGGGTCTTGGTGGGAAGTCAAGG + Intronic
1165264222 19:34646962-34646984 AGGACTTGGGTAGGAGGAGATGG - Intronic
1165426178 19:35746620-35746642 GGGCTCTGGGTGAGAAGGGAAGG + Intronic
1165433254 19:35784154-35784176 TGGACCTGGGTGGGAGGAGCGGG - Exonic
1165762137 19:38327546-38327568 AGCATCTGGCTGGGATGTGAAGG + Exonic
1165793106 19:38504202-38504224 AGGAGCTGGGTGGGAACAAGAGG - Exonic
1166118467 19:40670103-40670125 AGGATCCAGGTCAGAAGAGAGGG - Intronic
1166328259 19:42064450-42064472 GGGATCGGGGTGGGAGCAGAGGG - Intronic
1166561249 19:43733731-43733753 AGACTGAGGGTGGGAAGAGACGG + Exonic
1167019537 19:46863092-46863114 AGGAACTAAATGGGAAGAGAAGG - Intergenic
1168607245 19:57769905-57769927 AGGGTCTGGGTGGGTAGGGTGGG - Intronic
925118899 2:1402379-1402401 AGGACCTGCTTAGGAAGAGACGG + Intronic
925146815 2:1587713-1587735 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146876 2:1587922-1587944 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925200619 2:1965292-1965314 AGGATCAGGCAGGGAAGAGGAGG + Intronic
925689904 2:6511233-6511255 AGGGGTGGGGTGGGAAGAGATGG - Intergenic
925853676 2:8108748-8108770 AGGGTCTGGGAGTGGAGAGATGG - Intergenic
926062490 2:9813137-9813159 AGAAGCTGGTTGGGAAGAAAGGG + Intergenic
926062498 2:9813197-9813219 AGAAGCTGGTTGGGAAGAAAGGG + Intergenic
926077587 2:9953218-9953240 GGGATGTGGGTGGGAGAAGAAGG + Intronic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
927715323 2:25348219-25348241 AGGATCAGGGTTGGGAGTGAGGG - Intergenic
928050666 2:27991545-27991567 TGGATCAGGGTGGGAATATAGGG - Intronic
928260983 2:29766478-29766500 AGGAGGTGGTGGGGAAGAGAAGG - Intronic
929272562 2:39988629-39988651 AGGATCAGAGTGGTGAGAGAGGG - Intergenic
929570455 2:43019569-43019591 AGGATCTGGGTGGGATCCTAGGG + Intergenic
929572134 2:43029331-43029353 AACATCTGGGTGATAAGAGAAGG - Intergenic
929869093 2:45743098-45743120 AGGGGCTGGGTGGGGAGTGAGGG + Intronic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
930714933 2:54584644-54584666 TGGATCTGGGTGGGAAGGGCTGG - Intronic
931634311 2:64328061-64328083 AGGAGCCGTGTGGGCAGAGAAGG - Intergenic
931759674 2:65405825-65405847 GTGCTCTGGGTGGGAGGAGAAGG - Intronic
931768032 2:65474185-65474207 AGGATTGGGGTGGGGAGACAAGG + Intergenic
931862008 2:66365026-66365048 AGGGTCTGGAAAGGAAGAGAAGG - Intergenic
932419050 2:71590726-71590748 TGGATCTGGGTGGGGGGAGCTGG - Intronic
932884926 2:75541077-75541099 AGGATCTGGAAGTGCAGAGAGGG + Intronic
933280438 2:80327056-80327078 AGGATCTAGCTGGTAGGAGAAGG - Intronic
933837856 2:86260298-86260320 AGTTTGTGGGTGGGAAGTGAGGG - Intronic
933839440 2:86274806-86274828 AGGATCTAGGAGTGAAGAGATGG + Intronic
934576768 2:95406895-95406917 AGGGTCTGGCTGGGAACAGGTGG - Intronic
934602733 2:95670551-95670573 AGAATCTGCTGGGGAAGAGAAGG + Intergenic
934638987 2:96015063-96015085 AGGGTCTGGCTGGGAACAGGTGG - Intergenic
934794661 2:97090349-97090371 AGGGTCTGGCTGGGAACAGGTGG + Intronic
934929046 2:98405126-98405148 AGGAAATGGGAGGGAAGAGAGGG + Intergenic
936043237 2:109165731-109165753 AGGATCTGAGTGGGGAGAGTGGG - Intronic
936263583 2:110982349-110982371 AGGAGCGGGGAGAGAAGAGAGGG - Intronic
936497593 2:113035890-113035912 AGGATTTGGTGGGGAAGAAATGG + Intronic
936536115 2:113312743-113312765 AGAATCTGCTGGGGAAGAGAAGG + Intergenic
936578395 2:113674245-113674267 GGGATCAAGGTGGAAAGAGATGG + Intergenic
936970580 2:118172822-118172844 AGTTTCTGGGTGGGAAGGGCGGG + Intergenic
937036489 2:118786584-118786606 ATGATATGGGTGGGAGGAAATGG + Intergenic
937069238 2:119050234-119050256 AGTACCAGGGTGGGAAGGGAAGG + Intergenic
937305953 2:120870938-120870960 AGGAGCTGGGTGGGAAGGCAAGG + Intronic
937901099 2:127019775-127019797 TGGCTCTGGGAGGGAAGAGAAGG + Intergenic
938229972 2:129649828-129649850 AGGAGGTGGGTGGGAAAGGAGGG + Intergenic
938244029 2:129763681-129763703 ACCATCTGGGTGGAAGGAGATGG + Intergenic
938244272 2:129765185-129765207 ACCATCTGGGTGGAAAGAGATGG - Intergenic
938658313 2:133458733-133458755 AGGATCTGGGTGGCAGGAGGGGG + Intronic
938815108 2:134894766-134894788 AGCATCTAGATTGGAAGAGAAGG + Intronic
939888869 2:147711763-147711785 AAGATCTTGGTGGCAAGAGAGGG + Intergenic
940641727 2:156351413-156351435 TGAATCTGGGTGAGGAGAGATGG + Intergenic
941402263 2:165045215-165045237 AGAATCTGGGTGGGGGGTGAGGG - Intergenic
941674008 2:168324666-168324688 AGGATCTGAATGGGCAGAAAGGG + Intergenic
942017757 2:171833688-171833710 AGGAAAGGGGAGGGAAGAGAAGG - Intronic
942080416 2:172394892-172394914 AGGCTCTGGGTGGGGGGAGGGGG + Intergenic
942247081 2:174017842-174017864 AGGGTCTGGGGGTGCAGAGAGGG + Intergenic
943313393 2:186354693-186354715 AGGATATGAGTGGGAAGGGGAGG + Intergenic
943484758 2:188465399-188465421 AGGATCAGAGAGGGAAGAGTGGG - Intronic
943520128 2:188938820-188938842 ACAATCTGGGTTGGCAGAGAAGG - Intergenic
944418997 2:199508651-199508673 ATGGACTGGGTGGCAAGAGATGG + Intergenic
944832802 2:203549700-203549722 AGGATTTGGATGGGCAGGGAGGG - Intergenic
945154553 2:206825031-206825053 AGACTCTGGTTGGGTAGAGAGGG + Intergenic
946023722 2:216659395-216659417 AAGATCTGGGTGGGTGCAGAGGG - Intronic
946060452 2:216936600-216936622 AGGCTATGGATGGGCAGAGATGG + Intergenic
946402672 2:219476835-219476857 GGGATAGGGGTGGGAAGAGAAGG - Intronic
946442994 2:219712743-219712765 TGGATCTGGTTGGGAAAGGAGGG + Intergenic
946766348 2:223044572-223044594 AGGAGCGGGGTGGGAAGTCATGG - Intergenic
947312949 2:228823975-228823997 GGGGTCTGCATGGGAAGAGAGGG + Intergenic
948974737 2:241457354-241457376 AAGATCTGGGTGCTAAGGGAGGG + Intronic
948974756 2:241457435-241457457 AAGATCTGGGTGCTAAGGGAGGG + Intronic
948974776 2:241457516-241457538 AAGATCTGGGTGCTAAGGGAGGG + Intronic
948974796 2:241457597-241457619 AAGATCTGGGTGCTAAGGGAGGG + Intronic
948974816 2:241457678-241457700 AAGATCTGGGTGCTAAGGGAGGG + Intronic
1169084008 20:2815876-2815898 AGGTTCAGGCTGGGAAGAAAGGG - Intergenic
1169266024 20:4167833-4167855 AGGGTCTGGCTGGGAGGAGTTGG + Intronic
1169341693 20:4801167-4801189 TGGATCTGGGTGGGGAGGAACGG - Intronic
1170771157 20:19333455-19333477 AAGAGCGGTGTGGGAAGAGAAGG + Intronic
1171170188 20:23008946-23008968 GGAATCAGGGTGGGTAGAGATGG + Intergenic
1171216033 20:23352989-23353011 AGGAACTGGGAAGGCAGAGAAGG - Intronic
1171509882 20:25673473-25673495 ACCATCTGGGTGTGTAGAGATGG - Intergenic
1171948579 20:31400626-31400648 GGGAAGTGGGTGGGAAGGGAGGG - Intergenic
1172053097 20:32134254-32134276 ACGCCTTGGGTGGGAAGAGAGGG + Intronic
1172159241 20:32854053-32854075 AGCATTTGGGGAGGAAGAGATGG - Intergenic
1172160659 20:32865846-32865868 GGGAGGTGGATGGGAAGAGAGGG + Intronic
1172198103 20:33105824-33105846 CTGACCTGGGAGGGAAGAGACGG + Intronic
1172241003 20:33412450-33412472 AGGATGGGTGGGGGAAGAGAGGG + Intronic
1172376106 20:34441884-34441906 AGGATTTGAGTGGAAAGAAATGG - Intronic
1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG + Exonic
1172945540 20:38685426-38685448 AGGCACTGAGTGGGAAGAGAGGG + Intergenic
1173238202 20:41267539-41267561 AGGTACTGGGTGTGAAGGGAAGG + Intronic
1174109655 20:48189879-48189901 GGGAAGTGGGTGGGAAGAGGAGG + Intergenic
1174114753 20:48219274-48219296 AGGACCGGGCTGGGAAGACAGGG + Intergenic
1175892011 20:62319837-62319859 AGGGTCGGGGTGGCAAGGGAGGG + Intronic
1176985965 21:15436554-15436576 AGGATCAGGGTGGGCACAGCAGG - Intergenic
1178124595 21:29503170-29503192 AGAATCTGGATGGCAACAGATGG - Intronic
1178507845 21:33177265-33177287 ACAATCATGGTGGGAAGAGAAGG - Intergenic
1178859642 21:36278100-36278122 TGCATATGGGTGGGAAGAAATGG - Intronic
1180433140 22:15273325-15273347 AGGTTTTGGGTGTGAGGAGAAGG - Intergenic
1180611584 22:17101705-17101727 AAGCTGTGGGTGGGCAGAGAAGG + Intronic
1180796252 22:18607184-18607206 AAGCTCTGGGGGTGAAGAGAGGG - Exonic
1180821153 22:18828715-18828737 AGGATGGGGGTGGCAAGTGAGGG - Intergenic
1180980927 22:19877647-19877669 AGGCTCTGGGTGGGTTGACAGGG - Intronic
1181191825 22:21147330-21147352 AGGATGGGGGTGGCAAGTGAGGG + Intergenic
1181207371 22:21263180-21263202 AGGATGGGGGTGGCAAGTGAGGG - Intergenic
1181225470 22:21388087-21388109 AAGCTCTGGGGGTGAAGAGAGGG + Exonic
1181253163 22:21546726-21546748 AAGCTCTGGGGGTGAAGAGAGGG - Exonic
1181440057 22:22931146-22931168 GGGAACTGGGTGGGCAGGGAGGG - Intergenic
1181822029 22:25483951-25483973 AGGGTCTGGGAAGGAAGGGATGG + Intergenic
1182461298 22:30485816-30485838 TGCATCTCGGTGGGAAGTGATGG - Intergenic
1182893222 22:33836572-33836594 TGGAACTTGGTGGGAACAGAGGG - Intronic
1183246914 22:36701054-36701076 AGGAGATGGGGGAGAAGAGAGGG - Intronic
1183308897 22:37098617-37098639 AGGGTGTGGGTGGCAGGAGAAGG - Intronic
1183329547 22:37212033-37212055 AGGCTCTGGTTGGGAAGTCAGGG - Exonic
1183668791 22:39260046-39260068 AGGACCTGCCTGGGAAGGGAAGG - Intergenic
1183689737 22:39381954-39381976 AGGGGCTGGGTGTGGAGAGAGGG - Exonic
1183714495 22:39525809-39525831 AGGATATGGGTGTGAAGAGAGGG + Intergenic
1184323049 22:43757654-43757676 AGGATGTGATTGGGAAGGGAAGG - Intronic
1184381809 22:44149482-44149504 TGGATGTGGGTGGGATGGGAAGG - Intronic
1185006178 22:48278235-48278257 AGATTCTGGGTGGGAGGAGGGGG - Intergenic
1185169210 22:49282703-49282725 GGGACCTGGGTGGGGAGTGATGG - Intergenic
1203219547 22_KI270731v1_random:32236-32258 AGGATGGGGGTGGCAAGTGAGGG + Intergenic
1203271278 22_KI270734v1_random:54591-54613 AGGATGGGGGTGGCAAGTGAGGG - Intergenic
950358988 3:12437157-12437179 AGGCTCAGGGTCGGAAGAGGTGG + Intergenic
950624181 3:14232290-14232312 AGGGTTTGAGAGGGAAGAGAAGG - Intergenic
951093479 3:18601459-18601481 AGGATATGGGTGGGAAGATAAGG + Intergenic
951520915 3:23610042-23610064 AGGATATGGGTGGCAAGGGTGGG + Intergenic
952337944 3:32421061-32421083 AGGAGCTGGGTGGGAGAGGAGGG - Intronic
952610120 3:35198686-35198708 AGAAGCTGGGTGGGATGTGAAGG + Intergenic
952979074 3:38720701-38720723 TGGACCGGGGTGTGAAGAGAAGG + Intronic
953144840 3:40265505-40265527 GGGATGTGGGTGGGAAGATGAGG - Intergenic
953194351 3:40718216-40718238 AGAAACAGGGTGGGGAGAGAGGG + Intergenic
953586923 3:44210045-44210067 AGGACCTGGGAGGGAACAGATGG - Intergenic
953839183 3:46374970-46374992 TGGATTTGGGTTGGAAGTGAGGG + Exonic
954316186 3:49803135-49803157 CGGTTCTGGGTGGGAAGGGCGGG - Intergenic
954730262 3:52654587-52654609 AGGAGCTGGTTGGGAAAAGCAGG - Intronic
956623591 3:71245549-71245571 AGGGGGTGGGTGGGTAGAGAAGG - Intronic
956696385 3:71922501-71922523 AGGTTCTGAGTGGTAAGATAAGG + Intergenic
958111477 3:89152378-89152400 AGGTTGTGGGTGGAAAGAGAAGG - Intronic
960591361 3:119368937-119368959 AAGAGGTGGGTGGGTAGAGAGGG + Intronic
960593501 3:119387790-119387812 ATGGTCTGGTTGGGAAGACAAGG + Intronic
960869600 3:122235294-122235316 TGCATGTGGCTGGGAAGAGAGGG + Intronic
960942400 3:122943398-122943420 AGGGTCGGGGTGGGAAGTGCAGG - Intronic
961108977 3:124267677-124267699 AGGAGAGGGGTGGAAAGAGAAGG + Intronic
961253948 3:125530756-125530778 AGGATTTAGGTGAGAAGACATGG + Intronic
961593476 3:127998210-127998232 AGGATCTGGAAGGGAAGAGGAGG + Intergenic
961615116 3:128173139-128173161 AGGGTCTGGGTAGGAAAAGAAGG + Intronic
961793368 3:129392457-129392479 AGGACCTGAGAAGGAAGAGATGG - Intergenic
961807368 3:129499075-129499097 AGGACCTGAGAAGGAAGAGATGG - Intronic
962346850 3:134624895-134624917 AGCATATGGGTGGGGACAGAAGG - Intronic
962375269 3:134853770-134853792 AGGCTTTGGGGAGGAAGAGAAGG + Intronic
962659068 3:137582508-137582530 ACAATCTAGCTGGGAAGAGAAGG + Intergenic
962839118 3:139217757-139217779 AGGGTGAGGGTGGGAAGAGGAGG - Intronic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
963355626 3:144206590-144206612 AGGCCATGGGTGCGAAGAGAAGG + Intergenic
963727357 3:148937384-148937406 GGGATCTGGGTGGGTGGAGTGGG - Intergenic
963855592 3:150250066-150250088 AGCATCTGGGAGGGAGAAGATGG - Intergenic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
964739534 3:159950961-159950983 AGGACCTGGGAGTGAAAAGATGG + Intergenic
965673518 3:171171722-171171744 ATGAGCAGGGTGGCAAGAGAAGG + Intronic
966381428 3:179348162-179348184 AGGAGCTGCGTGGGAAAAGCCGG - Intronic
966657800 3:182379022-182379044 AAGATCAGGGTGGAAAGACAGGG + Intergenic
967186609 3:186949595-186949617 TGGATCTGGCTGGGGAGACAAGG - Intronic
967945749 3:194802397-194802419 AGGATCTGGGTGAGGATGGAGGG - Intergenic
968073383 3:195802054-195802076 AGCATATGGGTGGGAAGTCAGGG - Intronic
968271598 3:197407516-197407538 AGGATCTGGGAATGAACAGAGGG + Intergenic
968978232 4:3833012-3833034 AGCCTGTGGGTGGGGAGAGAGGG + Intergenic
969444453 4:7236275-7236297 AGATTCTGGGAGGGAAGTGAGGG + Intronic
971593244 4:28496260-28496282 ATGTTCTGGGAGGGACGAGATGG + Intergenic
972265569 4:37455712-37455734 AGGGTCTGGGTGGGACGTCAAGG - Intronic
972285924 4:37648229-37648251 AGCATCTGGGAAGGAGGAGAGGG + Intronic
974008754 4:56587470-56587492 AGGACTTGGGGGGGAAGAGTGGG - Intronic
974848063 4:67375631-67375653 AGAATATGGATGGGAAGAGCAGG - Intergenic
975380100 4:73690100-73690122 AGGATTTGGGTGGTGAGACAGGG + Intergenic
976599832 4:86927994-86928016 TGCAGCTGGGTGGAAAGAGATGG + Intronic
977068540 4:92351648-92351670 AGTAAATGGGAGGGAAGAGAAGG - Intronic
977915358 4:102586348-102586370 TAGATTTGGGTGGGAAAAGAAGG + Intronic
978165064 4:105597021-105597043 AGGAGCTGGGCTGGGAGAGAAGG - Intronic
978514743 4:109558301-109558323 AGGATGTGGGTGGGGCCAGATGG + Intergenic
980693308 4:136323700-136323722 AGGATGTGTGTGTGGAGAGAGGG + Intergenic
980991858 4:139745118-139745140 TGGATTTGAGTGAGAAGAGAAGG + Intronic
981523828 4:145692817-145692839 AGGGACTGGGTGGGAAGTGCAGG - Intronic
981907036 4:149933094-149933116 AGGAGCTGAGTGAAAAGAGAAGG + Intergenic
981919259 4:150068583-150068605 AGGGTCTGAGTGGGATGTGAGGG + Intergenic
981991728 4:150929669-150929691 AGGCTCTGGGTGAGATGACAAGG - Intronic
982088734 4:151862197-151862219 AGGATATGGGTAGGATGAGGAGG - Intergenic
983115157 4:163806401-163806423 AGAAGCTGGGTGGAAAGAAAGGG - Intronic
983200345 4:164854332-164854354 TGCATCTGGGTGTGAAGAAATGG - Intergenic
983290340 4:165795292-165795314 AGTATGTGTGTGGGGAGAGATGG - Intergenic
985634858 5:1030985-1031007 AGAACTTGGGTGGGGAGAGAGGG - Intronic
985739498 5:1606774-1606796 AGCAGCTGGGTGGGAACAGCTGG + Intergenic
985909394 5:2867032-2867054 AGGCTTTGGCTGGGAAGAGCAGG - Intergenic
986474116 5:8108098-8108120 AGGACCTGGGAGGGAATGGAAGG + Intergenic
986684035 5:10260092-10260114 AGGGTCAGGGAAGGAAGAGAGGG + Intronic
986773459 5:10994246-10994268 AGGAGCGGGGTGGGGGGAGATGG + Intronic
988119053 5:26936087-26936109 AGGATTTGGTGGGGAAGAGTGGG + Intronic
989140542 5:38197169-38197191 GGGAGCTGGTTGGGAAGTGATGG + Intergenic
989177697 5:38544702-38544724 AGCATCTAGGTGGGGAGGGAGGG - Intronic
990201777 5:53383867-53383889 AGAATCAGGGTGGGAGGTGATGG - Intergenic
990448014 5:55910837-55910859 AGGAGATGGGAGGGAAGAGCAGG + Intronic
990561698 5:56990129-56990151 AGAGTCTGGGAGAGAAGAGATGG - Intergenic
991247331 5:64521874-64521896 AAAATGTGGGTGGGAAGAAATGG + Intronic
992322603 5:75628720-75628742 GGAATTTGGGTGGGGAGAGATGG + Intronic
992503586 5:77364735-77364757 AGGGTCTGGGGAGGAAGAAAAGG + Intronic
992545018 5:77805390-77805412 AGTATGTGGGTGGGAGAAGAGGG - Intronic
993169484 5:84399410-84399432 AGGATCAAGGTAGGAAGGGAGGG - Intergenic
993527538 5:88984885-88984907 AAGATTTGGGTGGGAACACAGGG - Intergenic
994152632 5:96466228-96466250 AGGAGGTGGGAGGGGAGAGAAGG - Intergenic
995626546 5:114083843-114083865 AGGTTTGGAGTGGGAAGAGAGGG - Intergenic
995754591 5:115489599-115489621 ACCATCTTGGTGGGCAGAGAGGG - Intergenic
996948655 5:129098869-129098891 AGGTTCATGGTGGGAAGGGAGGG + Intronic
997292118 5:132745085-132745107 AGGAGCTGGGTAGGATGAGGTGG - Intergenic
997418629 5:133748819-133748841 AGCATTTGGAAGGGAAGAGAAGG + Intergenic
997657214 5:135564264-135564286 AGGAGCTGGGGTGAAAGAGAGGG - Intergenic
997669827 5:135661599-135661621 AGGACCGGGGAGGGAAGAAAAGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998483731 5:142484205-142484227 AAGATACGGGTGGGAAGAGGGGG + Intergenic
998674836 5:144395724-144395746 AGGACCATGGTGGGAAGAGATGG - Intronic
999225469 5:150019672-150019694 AGAATTTGGGTGGGTAGAAAAGG + Intronic
999325154 5:150639247-150639269 GGGATCAGGGAGGGCAGAGATGG - Intronic
999329644 5:150663492-150663514 TGGAGCAGGGTGGGAAGAGCAGG + Intronic
999389184 5:151177740-151177762 GGGCTCTGGGTGGGCAGGGAAGG + Intergenic
999486645 5:152003865-152003887 GGTCTCTGGGTGGGAGGAGAAGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1001667466 5:173445112-173445134 AGAAGATGGGTGGTAAGAGAAGG + Intergenic
1001990971 5:176115167-176115189 AGGATCTGGGTGGCAAGGCAGGG + Intronic
1002065996 5:176651934-176651956 AAGAACTGGATGGGAGGAGATGG - Intronic
1002225901 5:177722973-177722995 AGGATCTGGGTGGCAAGGCAGGG - Intronic
1002267946 5:178048239-178048261 AGGATCTGGGTGGCAAGGCAGGG + Intronic
1002317272 5:178351228-178351250 AAGATCTAGGTGGGGAGAAAGGG + Intronic
1002603864 5:180370582-180370604 GGGACCTGGATGGGAAGAGGTGG + Intergenic
1003359522 6:5411365-5411387 AGGCACTGAATGGGAAGAGAAGG - Intronic
1003623468 6:7723096-7723118 AACATCTGGGTGGAAAGAGGAGG - Intergenic
1003902666 6:10669159-10669181 TGGTTCTGGAGGGGAAGAGAGGG + Intergenic
1004045250 6:12017570-12017592 AGGATGTGGGTGGGGCCAGACGG - Intronic
1004159522 6:13201147-13201169 AGGAACTAGCTGGGAAGACAGGG + Intronic
1004729373 6:18342793-18342815 AGAATGAGGGTGGGAATAGAGGG + Intergenic
1004984594 6:21066959-21066981 AGGAACTGGGTGTGAATGGAGGG - Intronic
1005289373 6:24363987-24364009 AAGATTTGCGTGAGAAGAGATGG - Intergenic
1005806164 6:29476160-29476182 AGAATCTGGGAGGGAAGGGATGG - Intergenic
1006003913 6:30987735-30987757 AGGAAATGGGTGTGAATAGAAGG + Intronic
1006186083 6:32182456-32182478 AGGAGCTGAGGAGGAAGAGAGGG - Intronic
1006203919 6:32322599-32322621 AGGACTTGGGTGGGCAGTGAAGG + Intronic
1006300423 6:33191064-33191086 AGGGGCTGAGTGGGTAGAGATGG - Intronic
1007397307 6:41585259-41585281 AGGGTCTGGGTGCGGAGGGAGGG - Intronic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1007483698 6:42166515-42166537 AGGATCTGGAAGGGAAGGGACGG - Intronic
1007776041 6:44224912-44224934 AGGATATGGGCAGGAGGAGAGGG + Intronic
1008847292 6:55983425-55983447 AGGATGGGCGTGGGTAGAGAGGG - Intergenic
1010255196 6:73749380-73749402 AGGATTTGGATGGGAAGTGGTGG + Intronic
1010377634 6:75190721-75190743 AGTATTTGGCTAGGAAGAGAAGG + Intronic
1010946911 6:81985552-81985574 AGGAAATGGGTGGGAAGCCATGG + Intergenic
1011227202 6:85120401-85120423 TGGGTCTGGGTGGGAAGAGGAGG - Intergenic
1011761798 6:90575394-90575416 GGGATCTAAGTGAGAAGAGAAGG - Intronic
1012320465 6:97838517-97838539 AGGGTCTTGGGGGGAAGAGTGGG + Intergenic
1012430342 6:99157626-99157648 TGAAGGTGGGTGGGAAGAGAAGG - Intergenic
1013455047 6:110322911-110322933 AGGAACTGGGTGGGAGGAGAAGG + Intronic
1014566627 6:122956773-122956795 AGGCTCTGGGCTGGTAGAGAGGG - Intergenic
1015190509 6:130466992-130467014 AGGTTAAGGATGGGAAGAGAAGG - Intergenic
1015921522 6:138270802-138270824 AGCCTATGGGTGGGAAGAGGCGG + Intronic
1016764294 6:147774858-147774880 AGGAGGTGGGTGTGAAGGGAAGG - Intergenic
1017313337 6:153000651-153000673 GAAATCTGGGTGGGAAAAGAGGG - Intronic
1017651099 6:156583314-156583336 TGGATGTGGGTGGGAGGGGAAGG - Intergenic
1018463600 6:164022128-164022150 AGGAACTGGGGGAGCAGAGAAGG + Intergenic
1018489423 6:164276314-164276336 AGGAGCTGGGGAGGAAGACAAGG - Intergenic
1018560054 6:165092816-165092838 AGGGTTTGGGTGGGAGGAAAAGG + Intergenic
1019007756 6:168816575-168816597 ATGATGTGGGTGGGAAGTGATGG + Intergenic
1019289278 7:242451-242473 AGGAGGAGGGTGGGAAGGGAGGG + Intronic
1019350363 7:551565-551587 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350382 7:551627-551649 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350440 7:551812-551834 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350500 7:551997-552019 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350518 7:552058-552080 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350537 7:552119-552141 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350574 7:552241-552263 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350632 7:552425-552447 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019350651 7:552487-552509 AGGACCTGGGTGGGAGGTGGGGG - Intronic
1019459872 7:1152000-1152022 AGGATCTTGGAGGGCAGAAAAGG + Intergenic
1019819634 7:3232740-3232762 AAGCGGTGGGTGGGAAGAGAAGG - Intergenic
1020110172 7:5443443-5443465 GGGCTCTGGGTGGGAGGAGGGGG - Intronic
1020352293 7:7234028-7234050 AGGATCCTGGTGGGAAGAATAGG + Intronic
1021123285 7:16821190-16821212 AAGAAATGGGTGGCAAGAGAGGG + Intronic
1021415942 7:20385079-20385101 AGAAGCTGGGTGGGGAGACAGGG - Intronic
1021886815 7:25147386-25147408 GAGATCTCAGTGGGAAGAGAAGG + Intronic
1022260430 7:28699034-28699056 AGGGACTGGGTGGGAAGCCATGG + Intronic
1022297061 7:29066117-29066139 AGTATCTAGGTTGGGAGAGAGGG + Exonic
1022702029 7:32770686-32770708 AGGATGGGGGTGGGGAGAGTGGG - Intergenic
1023081349 7:36529551-36529573 AGCATCTGGGTTGGAGCAGATGG - Intronic
1023086676 7:36577220-36577242 AAGTTCTGGGTGAGATGAGATGG + Intronic
1023359251 7:39399211-39399233 AAAATTTGGGTGGGAAGAGAAGG - Intronic
1023575624 7:41623254-41623276 AGGCTCTGGGTGTAAAGTGAGGG - Intergenic
1024668239 7:51566592-51566614 TTGACCTGGGTGGGAGGAGAAGG - Intergenic
1027208907 7:76127789-76127811 AGGAACTGGGGAGCAAGAGAGGG + Intergenic
1027595893 7:80173596-80173618 AGCAGGTGGGTGGGAAGGGAGGG + Intronic
1028589317 7:92479330-92479352 AGGATTTGGGTGGGTAGTGGAGG + Intergenic
1028848611 7:95511411-95511433 AAGACCTGGGTGGTAAGAGTAGG + Intronic
1029045633 7:97625225-97625247 AGGTTTGGGGAGGGAAGAGAGGG - Intergenic
1029155824 7:98517293-98517315 AGGATGGGGGTGGGAGGACAGGG - Intergenic
1029241016 7:99162534-99162556 ATGGTCTGGGTGCAAAGAGATGG - Intergenic
1029481409 7:100815488-100815510 AAGATCTGGGTGGGGGGTGATGG + Intronic
1029618882 7:101677672-101677694 AGGATCTGGGAGGGAACACAGGG - Intergenic
1029970485 7:104783766-104783788 AGGAACTGGTTGGGCAGAAATGG - Intronic
1030455135 7:109762768-109762790 AGGAAATGGTTGGGAAGAGTGGG - Intergenic
1031291577 7:119944070-119944092 ATGATCATGGTGGGAAGCGAAGG + Intergenic
1031389611 7:121197779-121197801 AGGAGCTGGATGTGCAGAGATGG + Intronic
1032217639 7:129969915-129969937 GGGATGGGGGTGGGGAGAGAAGG - Intergenic
1032539249 7:132689713-132689735 AGAGCCAGGGTGGGAAGAGAAGG + Intronic
1032861000 7:135879148-135879170 GTGATCTGGGCTGGAAGAGATGG - Intergenic
1032951374 7:136918125-136918147 ATGATCTGGTTGGGAAGACAAGG - Intronic
1034095594 7:148405034-148405056 AGCATTTGGGTGGGAAAACAGGG + Intronic
1034102444 7:148461516-148461538 AGCAGCTGGGTGGGAGCAGAGGG + Intergenic
1034273213 7:149813172-149813194 AGGATCTCGAAGAGAAGAGAAGG + Intergenic
1034702374 7:153107743-153107765 AGGATCAGGGTGGGATGGGATGG + Intergenic
1035096500 7:156360253-156360275 AGGGTGTGGGAGGAAAGAGAGGG + Intergenic
1035987368 8:4449670-4449692 AGGAATGGGATGGGAAGAGAGGG + Intronic
1036410324 8:8493984-8494006 AGACACTGGGTTGGAAGAGAGGG + Intergenic
1036595401 8:10207232-10207254 AGGACCTGGGTGGGGGGATAAGG + Intronic
1037649580 8:20824286-20824308 ATGATCTGGCTGGGCAGGGAAGG - Intergenic
1037704749 8:21309654-21309676 AGGAGATGGGTTGGAAGTGATGG + Intergenic
1037819340 8:22128242-22128264 AGGAGATGGGTGGGCAGACAAGG - Intronic
1038350436 8:26771469-26771491 AGGGTTTGGGTAGGTAGAGAAGG - Intronic
1038884321 8:31646855-31646877 AGGCTCTGGATGGGAAGAGAAGG - Intronic
1040464984 8:47686114-47686136 AGGAGCTGGGTGGGGAGCCATGG - Intronic
1041253841 8:55961870-55961892 AGGGTGTGGGTGGGAGGGGATGG - Intronic
1041368624 8:57135378-57135400 AGAGTTTGGGTGGGAAAAGAAGG - Intergenic
1041691684 8:60693618-60693640 AGAATGTGGGTGGGAAGAGGAGG + Intronic
1042582325 8:70293588-70293610 AAGATTTGGGTGGGAGGATAGGG - Intronic
1043392012 8:79800951-79800973 AGGCTCTAGGTGTGCAGAGAGGG + Intergenic
1043674194 8:82929617-82929639 AGGAGCTGGGTGGTAAGAAGGGG - Intergenic
1043998519 8:86848657-86848679 ACGATCTGGGTGGGAGGATTGGG + Intergenic
1044881935 8:96731973-96731995 AATGTCTGGGTGGGAAGAGGAGG - Intronic
1045063341 8:98426557-98426579 AGGAGCTGGAGGGGAAAAGAGGG - Intronic
1045112289 8:98947402-98947424 AGGGGTTGGGTGGGAAGGGAAGG + Intronic
1046474967 8:114730241-114730263 ATCATCTAGGTGGGAAAAGATGG - Intergenic
1046821996 8:118643965-118643987 GGAATCTGAGTGAGAAGAGAAGG - Intergenic
1047309230 8:123677714-123677736 AGCATCTGGGTGGCAGGAGCTGG + Intergenic
1047716583 8:127601427-127601449 AAGACCTTGGTGGGGAGAGATGG - Intergenic
1047922992 8:129654392-129654414 AGCATATGGATGTGAAGAGAGGG - Intergenic
1048291432 8:133184612-133184634 AGGATCTGAGTGGTAAGAAGGGG + Intergenic
1048382070 8:133874086-133874108 AGGATGTGGGTGGGCAGCCAGGG + Intergenic
1048405139 8:134111394-134111416 AGGAACTGGGTGGGTAGTGGTGG - Intergenic
1048481258 8:134795857-134795879 AGGATTTGGGTGAGGAGAGCTGG + Intergenic
1048574103 8:135677602-135677624 TGCATCTGGGTGGGGAGAGGAGG + Intergenic
1049429049 8:142550794-142550816 AGGTGGGGGGTGGGAAGAGAAGG - Intergenic
1049453975 8:142677733-142677755 AAGTTCTGGGTGGGCAGAGTGGG + Intronic
1049543378 8:143218440-143218462 AGGCTCTGAGCAGGAAGAGAGGG + Intergenic
1050558726 9:6811851-6811873 AGGTTCTGGGTAAGAAGATATGG + Intronic
1050560153 9:6826960-6826982 AGGATGTGGGTGGGTGGAGGCGG + Intronic
1051062061 9:13056072-13056094 AGGACCTGGGAGAGAGGAGAGGG - Intergenic
1051149057 9:14061170-14061192 AGGATTTTGGTGGAAAGAGGTGG - Intergenic
1051729553 9:20125943-20125965 AGGATCTGGGAGGGGAGGGCTGG + Intergenic
1053346048 9:37378870-37378892 AGGATTTGGCTGGGCAGAGACGG - Intergenic
1053551671 9:39086548-39086570 AGGATCTGGGAGAGAGGAGGTGG - Intronic
1053815800 9:41906682-41906704 AGGATCTGGGAGAGAGGAGGTGG - Intronic
1054614796 9:67280759-67280781 AGGATCTGGGAGAGAGGAGGTGG + Intergenic
1055416101 9:76085146-76085168 AGGAGCTGAGTGTGAACAGATGG - Intronic
1055601792 9:77927103-77927125 AAGATCTTGGGGGGAAGAAAAGG - Intronic
1055793920 9:79954146-79954168 AAGATTTGGGTGGGAAGACAAGG - Intergenic
1055958228 9:81794286-81794308 GGGAGGTGGGTGGGCAGAGAAGG - Intergenic
1056136281 9:83632225-83632247 AGAATATGGGTGGAGAGAGACGG - Intronic
1057337442 9:94166644-94166666 AGGAGCTGGGCGGGAAGCGGAGG - Intergenic
1057387547 9:94617545-94617567 AAAATATGGGTGGGAAGAGAAGG - Intronic
1058510157 9:105709635-105709657 AGGATAGAGGTGAGAAGAGATGG + Intronic
1058591642 9:106571678-106571700 AGGATGGTGGAGGGAAGAGATGG - Intergenic
1058614997 9:106816774-106816796 AGGCTCTGGGTTGGAAGAAATGG - Intergenic
1058643875 9:107112516-107112538 TGGATTTGGGTGGGAAAAGGAGG - Intergenic
1059350506 9:113661091-113661113 AGGATGTGGGGAGGAAGGGATGG + Intergenic
1060413670 9:123415958-123415980 GTGATTTGGGTGGGAAGAGGGGG + Intronic
1061119256 9:128633191-128633213 AGGTTCTGTGGGGTAAGAGATGG - Exonic
1061281818 9:129601970-129601992 AGGCTCTGGGTGGGAAGGTCTGG + Intergenic
1061390020 9:130312355-130312377 AGGTTCTGGGTGAGCAGATAGGG + Intronic
1061479809 9:130891905-130891927 AGTTTCTGTGTGGGAAGCGATGG + Intergenic
1061574916 9:131500331-131500353 AGAAGCTGTGTGGGTAGAGAAGG + Intergenic
1062622345 9:137428682-137428704 AGGAGCTGGGTGGGGAGACGGGG + Intronic
1062723900 9:138060416-138060438 GGGAAATGGGTGGGAAGAGAAGG + Intronic
1185462638 X:339902-339924 AGGAGCTGGGGGGGGTGAGAGGG + Intronic
1186330212 X:8524509-8524531 AAGATAAGGGTGGGGAGAGAAGG - Intergenic
1186661030 X:11667121-11667143 AAGCTCAGGGTGAGAAGAGATGG - Intergenic
1187354315 X:18552723-18552745 AGGATCTGGGGGATGAGAGAGGG + Intronic
1187372024 X:18717445-18717467 AGGAACTGGAGGGGATGAGAGGG - Intronic
1187505356 X:19874633-19874655 AGGAACGGGCTGGGAAGAAAGGG + Intronic
1188354345 X:29172857-29172879 AGAATCAGGATGGGAAGAGGAGG + Intronic
1188871427 X:35378185-35378207 AGGCTGTGGGTGTGAAGACAAGG - Intergenic
1189845900 X:45138269-45138291 AGGATGTGCATGGGAAGAGGGGG - Intergenic
1190134293 X:47781283-47781305 GGGATATGGGAGGAAAGAGATGG + Intergenic
1190287773 X:48972056-48972078 AGGAGCTGGGCAGGAAGAGAGGG - Intergenic
1190287976 X:48973074-48973096 GTGTTCCGGGTGGGAAGAGATGG - Intergenic
1190641728 X:52486790-52486812 AGGAACTGGGTGAGCAGAGGGGG + Intergenic
1190645944 X:52526075-52526097 AGGAACTGGGTGAGCAGAGGGGG - Intergenic
1191783748 X:64895422-64895444 AGGATCTAGGTGGGAATATATGG - Intergenic
1191902446 X:66054437-66054459 AGGAGTTATGTGGGAAGAGAGGG - Intergenic
1192204421 X:69086591-69086613 GGGATCTGGGTGGGATGTGCTGG + Intergenic
1192503865 X:71669312-71669334 AGGAGCTGGGATGGAAGACAGGG + Intergenic
1192522628 X:71815356-71815378 AGGAGCTGGGATGGAAGACAGGG + Intergenic
1192592891 X:72375576-72375598 AGGATTGGGGAGGGAAGGGAAGG + Intronic
1192688857 X:73337748-73337770 AGAAGATGGGTTGGAAGAGAGGG - Intergenic
1194584147 X:95712984-95713006 AGTTTCAGGATGGGAAGAGATGG - Intergenic
1194953496 X:100153514-100153536 AGAATATGGGTGGGTGGAGATGG + Intergenic
1195201682 X:102556731-102556753 AGGAGGACGGTGGGAAGAGAAGG - Intergenic
1195720093 X:107858951-107858973 AGGAGATGAGTTGGAAGAGAGGG + Intronic
1195776505 X:108411903-108411925 AGGATAGGGGTGGGATCAGAGGG + Intronic
1195780297 X:108455085-108455107 AGGATGGGGGTAGGAAGGGAGGG - Intronic
1197998247 X:132403998-132404020 GGGATGTGGGTGGGAGGGGATGG - Intronic
1199617655 X:149670673-149670695 AGGTAGTGTGTGGGAAGAGATGG - Intergenic
1199624988 X:149732576-149732598 AGGTAGTGTGTGGGAAGAGATGG + Intergenic
1200769756 Y:7112874-7112896 AGGCTCAGGGTGAGAAGAGATGG + Intergenic
1201432967 Y:13924063-13924085 AAGATAAGGGTGGGGAGAGAAGG + Intergenic