ID: 1150140302

View in Genome Browser
Species Human (GRCh38)
Location 17:62722730-62722752
Sequence CATTTTCTACAGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 551}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150140302 Original CRISPR CATTTTCTACAGAAGATGGC TGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902113775 1:14104429-14104451 CCTTATCTAAACAAGATGGCAGG - Intergenic
902311799 1:15586750-15586772 CATTTGTTCCAGAAAATGGCTGG - Intronic
904132002 1:28282082-28282104 CATTTGCTACAGAAAGTGCCTGG - Exonic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904746329 1:32713435-32713457 GTTTTTCTGGAGAAGATGGCTGG - Intergenic
905326968 1:37160050-37160072 CACCTTCTTCACAAGATGGCAGG - Intergenic
905350722 1:37344520-37344542 CATGTGATACAGAACATGGCTGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906123418 1:43410983-43411005 CATTTTCTACAGAAGAGGAATGG - Intronic
907615431 1:55919757-55919779 CACCTTCTTCACAAGATGGCCGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910045745 1:82912962-82912984 AATTTTCTACAGAATTTGACAGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911128130 1:94360633-94360655 CACTTTCTTCACAAGGTGGCAGG + Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911383945 1:97151092-97151114 CATTTTGAACATAAGATAGCTGG - Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912968383 1:114257522-114257544 CCTTTTCTACTGATGATTGCAGG - Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
915792856 1:158693945-158693967 CATATTCAACAGAAAATGGCAGG - Intergenic
916359230 1:163949444-163949466 CACCTTCTTCACAAGATGGCAGG - Intergenic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917709470 1:177669991-177670013 CATTTTCTTCTGAAGACAGCTGG - Intergenic
918512655 1:185328365-185328387 CACTTTCTTCACAAGGTGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
923754541 1:236779062-236779084 CACCTTCTTCATAAGATGGCAGG + Intergenic
924002576 1:239570251-239570273 CACTTTCTTCACAAGGTGGCAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062901358 10:1149078-1149100 CATTCTCTCCAGAAGGAGGCTGG - Intergenic
1063356900 10:5409633-5409655 AATTTTCATCAGAAAATGGCTGG - Intergenic
1064507267 10:16046589-16046611 TATTTTCTAAAGAAGTTTGCTGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064969739 10:21052753-21052775 GCATTTCTACAGAACATGGCTGG - Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067745611 10:48933514-48933536 CATGTTCTGCAGATGCTGGCAGG + Intronic
1068158199 10:53228525-53228547 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1068463642 10:57358518-57358540 GATTTTCTCCAGAAAATGACTGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069175081 10:65280239-65280261 CATCTTCTTCATAAGGTGGCAGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070750658 10:78962263-78962285 CATTTACTCCAGGAGATGGCTGG - Intergenic
1070766067 10:79057061-79057083 CAGTTCTTACAGAAGACGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072360467 10:94654141-94654163 AATTGTCTACAGAAGATGGCAGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074031162 10:109689865-109689887 AGTTTTCTAGAGAAGATTGCAGG - Intergenic
1075408805 10:122212281-122212303 CTTTGTCTACAAAAGATGACTGG - Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1076748830 10:132530016-132530038 CAAAATCTACAGAACATGGCAGG - Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078265347 11:9751937-9751959 CATTTTATTCAGTAGCTGGCAGG + Exonic
1078813035 11:14790063-14790085 CATTTGAAACAGTAGATGGCAGG + Intronic
1079100560 11:17538980-17539002 CAGGTTCTACAGAAAAGGGCAGG - Intronic
1079351754 11:19697763-19697785 CATTGTCTTCAGAAGAGAGCAGG + Intronic
1079533036 11:21478125-21478147 CACTTTCTTCACAAGGTGGCAGG + Intronic
1080328133 11:31102172-31102194 CATTTTCTACAGAACAAGGTGGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081048542 11:38308399-38308421 CATTTTATTGAGAAGATAGCTGG + Intergenic
1081461049 11:43273297-43273319 CCTTTTCCACAGAAGATCACTGG + Intergenic
1081678157 11:44983034-44983056 CATTTGCTATATAAGGTGGCAGG - Intergenic
1082220990 11:49636351-49636373 CATCTTATATAGAAGCTGGCCGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1084335929 11:68457855-68457877 CATACTCTAGAGAAGATGGCTGG - Intergenic
1084434574 11:69131395-69131417 GGTTTTCCACAGAAGATGTCTGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1086628054 11:88982768-88982790 CATCTTATATAGAAGTTGGCCGG + Intronic
1086749468 11:90473108-90473130 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1087480544 11:98694192-98694214 CACCTTCTTCACAAGATGGCAGG - Intergenic
1088733325 11:112703403-112703425 CACCTTCTTCACAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089070030 11:115692744-115692766 CATTATCCACTGAAGATGTCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091092047 11:132780518-132780540 CATTTTTGAAAGCAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093068329 12:14682392-14682414 CACTTTCTTCAAAAGGTGGCAGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095859300 12:46897883-46897905 CATCTTCTTCACAAGATGGCAGG - Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096327159 12:50674178-50674200 CATTTTCTACACAGAAAGGCTGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096981574 12:55730569-55730591 CATTTTGTAAAGTACATGGCAGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097971576 12:65638784-65638806 CACCTTCTTCACAAGATGGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099216519 12:79860545-79860567 CATTTATTACAAAAGATGGGGGG + Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099731212 12:86505907-86505929 GATTTTAAACAGAAGAAGGCAGG + Intronic
1099778502 12:87165045-87165067 CATTTTCTTCATAAGGTGGCAGG + Intergenic
1100086116 12:90913129-90913151 CAATTTCTTCACAAGGTGGCAGG + Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102014580 12:109639332-109639354 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1102839982 12:116108477-116108499 CATTGTCAACAGAAGTTGGAAGG - Intronic
1102972433 12:117180210-117180232 CATTTTCCACAAAAGAAGCCAGG - Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104832239 12:131761302-131761324 TATTTGCTATGGAAGATGGCGGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107313303 13:39103754-39103776 GATTTTCTAAAGAAAATGGTGGG - Intergenic
1107864500 13:44690594-44690616 CATTTTCCAGAGAAGATGGGTGG + Intergenic
1108003760 13:45927488-45927510 TAATTTCCACAGAAGATGACAGG + Intergenic
1108253393 13:48588780-48588802 TGTGTTCTACAGAAGGTGGCTGG - Intergenic
1108929975 13:55806438-55806460 CACATTCTACACAAGAAGGCAGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109496845 13:63182557-63182579 CACCTTCTTCAGAAGGTGGCAGG - Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1110156188 13:72319779-72319801 CACCTTCTTCATAAGATGGCAGG - Intergenic
1110474787 13:75901278-75901300 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111678335 13:91414300-91414322 CACTTTCTTCACAAGGTGGCAGG - Intronic
1112161503 13:96873093-96873115 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112460114 13:99596489-99596511 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1112789659 13:102988907-102988929 CATGTTCTTCACATGATGGCAGG + Intergenic
1113166865 13:107452401-107452423 CATCTTCTTCACAAGGTGGCAGG + Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114214241 14:20643849-20643871 CAATTTCTATAGAAGCTGGAGGG - Intergenic
1115117517 14:29899989-29900011 CACCTTCTTCACAAGATGGCAGG - Intronic
1115721773 14:36169679-36169701 CATTTTGTACAGAAACTGGGAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116802639 14:49459144-49459166 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117762068 14:59039503-59039525 CATCTTCTTCACAAGGTGGCGGG - Intergenic
1117786926 14:59295704-59295726 CATTTTCTACACAAAGTAGCTGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1123692484 15:22850079-22850101 CATTTTCTACAGAAAATTTTTGG + Intronic
1123699142 15:22901943-22901965 CATTTTCTGCAGAAGAGCTCCGG - Intronic
1125209613 15:37197868-37197890 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129070313 15:72945497-72945519 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1129482523 15:75839225-75839247 AAATTTCTAGAGCAGATGGCAGG - Intergenic
1129673673 15:77620987-77621009 CCTTTTCTAAAGAAGGTGTCTGG - Intronic
1131060240 15:89399998-89400020 CACTTTGTCCGGAAGATGGCGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1132779722 16:1616018-1616040 CATTCTCAACCGAAGAAGGCTGG + Intronic
1133925299 16:10187382-10187404 CATTTCCTACAGGAGACGCCTGG - Intergenic
1134447189 16:14339535-14339557 ACTTTTCTACAGAAGTTAGCTGG - Intergenic
1135380577 16:21993007-21993029 CATTTTCTTCACAAGGCGGCAGG - Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137781244 16:51099369-51099391 CACTTTCTTCACAAGATGGCAGG - Intergenic
1137904015 16:52300600-52300622 CATTTTATAGAGAAGGTGACTGG - Intergenic
1138797384 16:59985529-59985551 CACCTTCTTCACAAGATGGCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1138918622 16:61499495-61499517 CAGTTTCTACAGAAGATACTGGG - Intergenic
1140347312 16:74226805-74226827 TATTTTCTCCACAAGAGGGCAGG - Intergenic
1140585557 16:76287540-76287562 CATTCTCTAGAGAAGATGTCAGG + Intronic
1140647152 16:77045057-77045079 CAATTTCCACAGAAGCTAGCTGG - Intergenic
1141305948 16:82864476-82864498 CACCTTCTTCAGAAGGTGGCAGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142647669 17:1325546-1325568 CATTTTCAACAGAAGATTGCTGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143974239 17:10818437-10818459 CAATGTCCACAGAAGACGGCTGG - Intergenic
1144874770 17:18391641-18391663 CACCTTCTTCACAAGATGGCAGG - Intergenic
1145095654 17:20023471-20023493 CAATTACTAAAGAGGATGGCAGG + Intronic
1145157455 17:20552780-20552802 CACCTTCTTCACAAGATGGCAGG + Intergenic
1146159335 17:30551471-30551493 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146857544 17:36266263-36266285 CACCTTCTTCACAAGATGGCAGG + Intronic
1147076337 17:37990799-37990821 CACCTTCTTCACAAGATGGCAGG + Intronic
1147077466 17:38002260-38002282 CACCTTCTTCACAAGATGGCAGG - Intronic
1147087862 17:38070344-38070366 CACCTTCTTCACAAGATGGCAGG + Intergenic
1149076665 17:52603709-52603731 CACCTTCTTCACAAGATGGCAGG + Intergenic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1150155977 17:62853471-62853493 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1150376101 17:64683002-64683024 CACCTTCTTCACAAGATGGCGGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151855446 17:76718276-76718298 CAGGTTCTGCAGAAGATGCCGGG + Intronic
1151874867 17:76862009-76862031 CATCTTCTTCACAAGGTGGCAGG + Intergenic
1152414587 17:80151075-80151097 CACCTTCTTCACAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153540931 18:6153803-6153825 CATCTTCTTCACAAGGTGGCAGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155691571 18:28631029-28631051 CACCTTCTTCACAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1158448030 18:57537934-57537956 CACCTTCTTCACAAGATGGCAGG - Intergenic
1158665095 18:59425435-59425457 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1159390198 18:67783009-67783031 CATTTTTCAAAGAATATGGCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159736794 18:72109754-72109776 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1159943705 18:74428005-74428027 CAGTTGCTACAGAAGCTGGCAGG + Intergenic
1160953548 19:1679185-1679207 CAGTTTCCCCAGAAGATGGGGGG - Intergenic
1164310979 19:24046033-24046055 CATATTCTAAAGAAGCTGGTAGG + Intronic
1165897114 19:39148894-39148916 CATTTTCAACAAATGCTGGCTGG - Intronic
1167039777 19:47016648-47016670 CAGCTTTTATAGAAGATGGCTGG + Intergenic
1167767665 19:51495106-51495128 TATTTTCCACCGTAGATGGCTGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925358066 2:3256662-3256684 TATTTTCTAAAGGAGATTGCGGG - Intronic
925490632 2:4389190-4389212 CACTTTCTTCACAAGGTGGCAGG - Intergenic
926134401 2:10326379-10326401 CAGGTTCTAAAGCAGATGGCAGG + Intronic
926647500 2:15305305-15305327 CACTTTCTTCACAAAATGGCAGG - Intronic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927744538 2:25605013-25605035 CATTTTAAACAGAACTTGGCTGG - Intronic
928202097 2:29254111-29254133 CATGTTCTTCACATGATGGCAGG - Intronic
929100883 2:38312400-38312422 CACCTTCTTCACAAGATGGCAGG - Intronic
929434166 2:41914629-41914651 CAATTTCTTCACAAGGTGGCAGG - Intergenic
930622471 2:53658632-53658654 CATCTTCTTCACAAGGTGGCAGG + Intronic
930790194 2:55317754-55317776 CATTTTCTAAGGAAGACTGCTGG + Exonic
932355752 2:71067638-71067660 GGGTTTCTCCAGAAGATGGCAGG + Intronic
932661049 2:73652359-73652381 AATTCTCTACAGAAGATATCAGG + Intergenic
933521218 2:83376776-83376798 CATTTAATTCAGTAGATGGCAGG - Intergenic
935324835 2:101926479-101926501 CACTTTCTTCACAAGGTGGCAGG - Intergenic
935325076 2:101928430-101928452 CACTTTCTTCACAAGATGGCAGG - Intergenic
935425911 2:102918123-102918145 CACCTTCTTCACAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935942985 2:108260627-108260649 CATTATGAAAAGAAGATGGCAGG + Intronic
936906870 2:117546451-117546473 CACTTTCTTCACAAGGTGGCAGG - Intergenic
937752147 2:125489168-125489190 CATTTTCTCCAGGAGTTTGCTGG + Intergenic
938018868 2:127889689-127889711 CATTTTCTACAAAAATTAGCTGG - Intergenic
938241553 2:129746088-129746110 CACCTTCTTCACAAGATGGCAGG - Intergenic
939004255 2:136766760-136766782 CATATTCTACGGAAGATACCAGG + Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939093005 2:137800390-137800412 CACCTTCTTCACAAGATGGCAGG - Intergenic
939123195 2:138142966-138142988 TATTTTCTACAGAACATGTGAGG - Intergenic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939535111 2:143417988-143418010 CTTGTTCTACAGATGATGGCAGG - Intronic
939716167 2:145586920-145586942 TATTTTCTAAAGTAGATGGTTGG - Intergenic
939757159 2:146128922-146128944 CACTTTTTTCACAAGATGGCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941915792 2:170813112-170813134 CTTTTTCTAAAGAAGAGAGCTGG - Intergenic
942022196 2:171877158-171877180 TATTGTCTATAAAAGATGGCAGG + Intronic
943134632 2:183893975-183893997 CACCTTCTTCACAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943256621 2:185601954-185601976 CACTTTCTTCACAAGATGGCTGG + Intergenic
943487411 2:188503394-188503416 CACCTTCTTCAGAAGGTGGCAGG + Intronic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944147289 2:196519443-196519465 CATTTTCTTCAGAACATAGACGG - Intronic
944972290 2:205007173-205007195 CACTTTCTTCACAAGGTGGCAGG - Intronic
945001487 2:205355821-205355843 CATCTTCTTCACAAGGTGGCAGG + Intronic
945130626 2:206567879-206567901 CATCTTCTTCACAAGGTGGCAGG + Intronic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
945208324 2:207356013-207356035 CATTTTCTAGGGAAGAAGGTTGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947454105 2:230237416-230237438 CATTTACTACAGAAGAAGGGAGG - Intronic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
948294634 2:236851448-236851470 CATCTTCTTCACAAGGTGGCAGG + Intergenic
1169245075 20:4018678-4018700 CAGTTTCTACAACATATGGCAGG + Intergenic
1171088419 20:22261422-22261444 CATTTGGTACAGATGAAGGCTGG + Intergenic
1173258813 20:41415022-41415044 CTAGTTCTACAGAAGATGGAGGG + Intronic
1174869792 20:54172452-54172474 CATTTTCTGCAGAGGATTGGGGG - Intronic
1175007395 20:55699782-55699804 CAAATTCTACAGAAGTTGGATGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177899656 21:26898798-26898820 CACTTTCTTCACAAGATGGCTGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178322869 21:31619017-31619039 TATTTTCTTCACAAGGTGGCAGG - Intergenic
1178713123 21:34937811-34937833 GATTTTCAACAGAAAATGCCAGG + Intronic
1179635361 21:42705148-42705170 ATTTTTCTACAGAAGATGCTTGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182057568 22:27371826-27371848 CACTTTCTTGAGAACATGGCAGG - Intergenic
1182868087 22:33622336-33622358 CATCTTCTTCACAAGATGGCAGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184931658 22:47685845-47685867 CACTTTCTTCACATGATGGCAGG + Intergenic
949112976 3:285328-285350 CATTTTATAGAGAAAATGGTGGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949768371 3:7551944-7551966 CATCTTCTTCACAAGGTGGCAGG + Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951753328 3:26061306-26061328 CATTTTCTCCACATGGTGGCTGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953378116 3:42445820-42445842 CACCTTCTTCACAAGATGGCAGG - Intergenic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957505792 3:81118858-81118880 CTTTTTCTTCACATGATGGCAGG + Intergenic
957601428 3:82339540-82339562 CTTTTTCAACTGATGATGGCTGG - Intergenic
957698204 3:83671964-83671986 TATTTTGTACAGAATTTGGCAGG + Intergenic
957740605 3:84263097-84263119 GAATTTCTACAGAAAATGGGAGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959082293 3:101815106-101815128 CATTTTCTACAGGAGGTGTTAGG + Intronic
959141167 3:102487869-102487891 CACTTTCTTCACAAGGTGGCAGG - Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959507271 3:107170294-107170316 CACTTTCTTCACAAGGTGGCAGG - Intergenic
959588439 3:108048759-108048781 ACTTTGCTACAGAAGAGGGCAGG + Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
961305283 3:125955265-125955287 CATATTCCCCAGAGGATGGCTGG + Intergenic
962118601 3:132538231-132538253 CATGGTCTACAGGAGGTGGCAGG - Exonic
962121264 3:132562453-132562475 CATTTTTTAAAGCAGATAGCAGG + Intronic
963774809 3:149427966-149427988 AATTCTATATAGAAGATGGCAGG - Intergenic
964324575 3:155532643-155532665 CACCTTCTTCAGAAGATGGCAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966613664 3:181892305-181892327 CTTTTTTTAAAGAAGAGGGCCGG - Intergenic
967585942 3:191215147-191215169 CATATTCTTCACAAGGTGGCGGG + Intronic
968312544 3:197695971-197695993 CATTTCCCACAGAAGGTGGTCGG - Exonic
968704570 4:2071976-2071998 CATTTACTCCAGGGGATGGCGGG + Exonic
969266141 4:6065294-6065316 CATTTGCTAGAGAAGGAGGCTGG - Intronic
969431765 4:7159272-7159294 CATTTTCTCCAGCACCTGGCTGG + Intergenic
970693930 4:18653654-18653676 CATTTCCTACAGAAGCTTGGAGG - Intergenic
970792068 4:19869160-19869182 CAATTTCTACAGAAAATTTCTGG + Intergenic
970924959 4:21441059-21441081 AATTTGATACAGAAGATGACAGG - Intronic
971409396 4:26354225-26354247 CATGATCTAAAGAATATGGCCGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971991814 4:33908376-33908398 CATCTTCTTCACAAGGTGGCAGG + Intergenic
972716891 4:41655691-41655713 CATTCTCTACAAAAGGTGGGGGG - Intronic
972773990 4:42224679-42224701 CATTTTCCAAAAAACATGGCAGG - Intergenic
972777948 4:42260725-42260747 CATTTTCTACACAAAAGGGAGGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973772711 4:54221231-54221253 CAATTTCTACGGGAGAAGGCTGG + Intronic
974361350 4:60884819-60884841 CATTTTGTACAAAACATTGCTGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975460064 4:74641269-74641291 CATTTACAACAGACAATGGCAGG - Intergenic
976782610 4:88777769-88777791 CATTTTCAGGAGAAGATGGTAGG - Intronic
977015852 4:91692769-91692791 CACTTTCTTCACAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978809899 4:112838217-112838239 CACTTTCTTCACAAGGTGGCAGG - Intronic
978826437 4:113029570-113029592 CATTTTCTAAAGAAGAACTCCGG - Intronic
978928526 4:114281485-114281507 CACTTTCTACAGAAAATGTTAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980607009 4:135105354-135105376 CACCTTCTTCACAAGATGGCAGG - Intergenic
981294944 4:143120998-143121020 CACTTTCTTCACAAGGTGGCAGG - Intergenic
982069629 4:151683840-151683862 CATTTGAGACAGAAGATGGGTGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984133966 4:175913040-175913062 AATTTTCTACAGAAAATGCTAGG - Intronic
984520607 4:180796876-180796898 CACTTTCTTCAGAAGACGTCAGG - Intergenic
984571779 4:181403825-181403847 CATCTTCTTCACAAGGTGGCCGG + Intergenic
984747890 4:183240820-183240842 CGTTTGCTACTGAAGTTGGCTGG + Intronic
985946940 5:3193099-3193121 GATTTTCTTCAGAATATGGGGGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987011284 5:13768310-13768332 CACTTTCTTCACAAGATGGCGGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987693856 5:21302656-21302678 CACTTTCTTCACAAAATGGCAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988349024 5:30076398-30076420 CACCTTCTTCACAAGATGGCAGG - Intergenic
988459920 5:31425754-31425776 CATCTGTTACAGAAGACGGCAGG + Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989325781 5:40192541-40192563 CATTTAATCCAGAAGCTGGCTGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991746400 5:69746885-69746907 CACTTTCTTCACAAAATGGCAGG + Intergenic
991751305 5:69808356-69808378 CACTTTCTTCACAAAATGGCAGG - Intergenic
991798002 5:70326830-70326852 CACTTTCTTCACAAAATGGCAGG + Intergenic
991825778 5:70622199-70622221 CACTTTCTTCACAAAATGGCAGG + Intergenic
991830593 5:70683250-70683272 CACTTTCTTCACAAAATGGCAGG - Intergenic
991890343 5:71326150-71326172 CACTTTCTTCACAAAATGGCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993104174 5:83579990-83580012 CATTTTCTACAACAGGGGGCTGG - Exonic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993713657 5:91252983-91253005 CATCTTCTTCACAAGTTGGCAGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994968343 5:106702809-106702831 CACTTTCTTCAGGAGGTGGCAGG - Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996663949 5:126035992-126036014 CATCTTCTTCACAAGGTGGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997079641 5:130723417-130723439 CACCTTCTTCACAAGATGGCAGG + Intergenic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
999082925 5:148861237-148861259 CACTTTCTTCACAAGGTGGCAGG + Intergenic
999935404 5:156480696-156480718 CATTATCTCCAGAAGAGAGCAGG - Intronic
1000046623 5:157527155-157527177 CACCTTCTTCACAAGATGGCAGG + Intronic
1000244269 5:159436432-159436454 CATCTTCTTCACCAGATGGCGGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000574923 5:162965815-162965837 CACCTTCTTCACAAGATGGCAGG + Intergenic
1000581501 5:163040107-163040129 CATCTTCTTCACGAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001464858 5:171954759-171954781 TTTTTTCTACAGAATTTGGCAGG + Intronic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004197632 6:13519300-13519322 CAGTTTATACAGAAAAAGGCAGG - Intergenic
1004565349 6:16790661-16790683 CATTTTCTCCATGAGATAGCAGG + Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005258576 6:24031990-24032012 CAACTTCTTCATAAGATGGCAGG + Intergenic
1005557054 6:26997283-26997305 CACTTTCTTCACAAAATGGCAGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006693399 6:35909788-35909810 CATCTTCTTCACAAGTTGGCAGG - Intronic
1007425894 6:41745860-41745882 CATTTTTAACAGAAGATTTCAGG + Intronic
1008018550 6:46549075-46549097 CAGGTTCTACTGAATATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009710362 6:67309575-67309597 CATTTTCTTCACAAGGGGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1009972671 6:70641589-70641611 CATTTTTTAATGGAGATGGCGGG + Intergenic
1010005409 6:70990579-70990601 CACCTTCTTCACAAGATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011886603 6:92104181-92104203 CACTTTCTTCACAAGATGGCAGG - Intergenic
1011890721 6:92156206-92156228 CGTCTTCTTCAGAAGGTGGCAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012883066 6:104814813-104814835 CATCTTCTTCAGATGGTGGCAGG - Intronic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013497799 6:110715781-110715803 AAGTTTCTGCCGAAGATGGCAGG - Intronic
1013891000 6:115027137-115027159 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014892105 6:126855328-126855350 CATAAACTACAGAAGATGGCCGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015814877 6:137198546-137198568 CCTTTTCTAAGGAAAATGGCTGG + Exonic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016342028 6:143072948-143072970 CATTTTGTACATTAGATGTCTGG + Intronic
1016928302 6:149376459-149376481 CATGTTCCAAACAAGATGGCTGG - Intronic
1017083961 6:150696372-150696394 GATTTTCTTCTGAAGCTGGCAGG - Intronic
1017763408 6:157588475-157588497 CATTTTTTAAAGAAGACTGCAGG + Intronic
1017766439 6:157610746-157610768 CATTTTCAACAGATGACTGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018629318 6:165808501-165808523 CATTTTCCAGAGAAGACAGCTGG - Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020706501 7:11550564-11550586 CACCTTCTTCACAAGATGGCAGG - Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021787031 7:24162798-24162820 CACTGTCTTCAAAAGATGGCAGG - Intergenic
1022395089 7:29980610-29980632 CATTTTCTACAGAAGAAATAAGG + Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022976135 7:35558466-35558488 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1023220365 7:37915936-37915958 CATTTTCTTCAGAAAAAGTCTGG - Intronic
1023489535 7:40724032-40724054 CATTTTCTTCACATGATGTCTGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024120344 7:46230783-46230805 CATTTTTTAAAGAAGAAGGGTGG + Intergenic
1027887685 7:83930455-83930477 CATCTTCTACACAATGTGGCAGG + Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028875665 7:95820674-95820696 CACTTGGTAGAGAAGATGGCTGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030261609 7:107570693-107570715 CTTTTTCTACAGTATTTGGCTGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030471411 7:109967315-109967337 CATTTTCTAGAGAAGAAGAATGG + Intergenic
1030692998 7:112553877-112553899 TATTTACTACAGCAGAGGGCAGG + Intergenic
1030967637 7:116012993-116013015 CATTTTCTAAAGAATATGATTGG + Intronic
1031445939 7:121854021-121854043 CATTTTATACAGATAATGGTAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032779497 7:135152477-135152499 CATTTTCCAGAGAAGAAGACAGG - Intronic
1033672460 7:143505942-143505964 CATCTTCTTCATAAGGTGGCAGG - Intergenic
1034001248 7:147415517-147415539 CACTTTCTTCAGAAGGCGGCAGG - Intronic
1036030966 8:4972473-4972495 CACCTTCTTCACAAGATGGCAGG - Intronic
1036078349 8:5525360-5525382 CATTTTCTAGAGAAGCTGTGAGG + Intergenic
1037072825 8:14673480-14673502 CACCTACTTCAGAAGATGGCAGG - Intronic
1037085957 8:14850848-14850870 CATCTTCTTCAGAAGGTGGCAGG - Intronic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039631094 8:39111801-39111823 CATTTTCAACAAAACATGGTAGG - Intronic
1040802055 8:51352583-51352605 CACCTTCTTCAGAAGGTGGCGGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041601732 8:59725931-59725953 CATTTTTTCCAGAACCTGGCAGG - Intergenic
1041803465 8:61824478-61824500 CATCTTCTTCACAAGGTGGCAGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042412236 8:68478698-68478720 CACCTTCTTCACAAGATGGCAGG + Intronic
1042525244 8:69757880-69757902 CACTCTCTCCAGAAGACGGCAGG + Intronic
1042813539 8:72852629-72852651 CATTTTTTGCACAGGATGGCAGG + Intronic
1043644490 8:82499735-82499757 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1043763943 8:84105254-84105276 TATTTTCTTCACAAGGTGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044773661 8:95664649-95664671 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1044954171 8:97462390-97462412 CATTTTCAATAGAAGAGAGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046365657 8:113227680-113227702 CATCTTCTTCACAAGGTGGCAGG - Intronic
1046635969 8:116676414-116676436 CAACTTCTTCACAAGATGGCAGG + Intronic
1046903557 8:119547858-119547880 CCTTAATTACAGAAGATGGCTGG - Intergenic
1047372588 8:124268119-124268141 AAGTTTCTGCAGCAGATGGCAGG - Intergenic
1047500344 8:125435635-125435657 CATTCTCTACAAAAGCTAGCAGG - Intronic
1048870841 8:138796526-138796548 CATTTCCAACAGAATATGCCTGG + Intronic
1049220635 8:141427295-141427317 CCTTTCCTACACAAGATGTCAGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051396559 9:16628318-16628340 CTTTCTCTAAACAAGATGGCTGG - Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052008746 9:23381761-23381783 CACCTTCTTCAGAAGGTGGCAGG - Intergenic
1052103522 9:24481142-24481164 CACCTTCTTCACAAGATGGCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056927590 9:90847982-90848004 CATCTCCTACAGAACCTGGCTGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1060213883 9:121726776-121726798 TTTTTTCTACAGAAGGTGTCTGG + Intronic
1060623718 9:125091335-125091357 CATTTTCTGCTTAAGTTGGCTGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062328960 9:136028262-136028284 CAGGTTCTACAGAACAGGGCTGG + Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186299828 X:8188148-8188170 CATTTTGTACATAATGTGGCTGG + Intergenic
1186306793 X:8269451-8269473 CAATTTCAATGGAAGATGGCAGG + Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189122406 X:38408606-38408628 CATATTCTACTGAACATGGTGGG + Intronic
1189570320 X:42288502-42288524 CATCTTCTTCACAAGGTGGCAGG + Intergenic
1190637393 X:52449685-52449707 CATTTTCTAAAACAGAAGGCGGG + Intergenic
1190679666 X:52814114-52814136 CATTTTCTAAAATAGATGGCAGG - Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192752894 X:74012808-74012830 AATTTTCCACACATGATGGCAGG - Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193012418 X:76691580-76691602 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193357016 X:80532391-80532413 CATTTTCTACATAACAAGTCAGG + Intergenic
1193747683 X:85301708-85301730 TATTTTACACAGAAGAAGGCAGG + Intronic
1193765357 X:85522035-85522057 CACCTTCTTCACAAGATGGCAGG - Intergenic
1193888958 X:87018811-87018833 CATTTTGTATAGTAGCTGGCTGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193998702 X:88400069-88400091 CATCTTCTTCACAAGGTGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194518203 X:94885364-94885386 CACCTTCTACACAAGGTGGCAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195050752 X:101094601-101094623 CATTTTCTTCAGCAGAGGGAGGG - Exonic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196390505 X:115203130-115203152 CACCTTCTTCACAAGATGGCAGG + Intronic
1196998668 X:121413600-121413622 CACCTTCTTCACAAGATGGCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197563968 X:128058129-128058151 TAATTTCTACAGATGATGGGTGG - Intergenic
1198017430 X:132625352-132625374 CATCTTCTTCACAAGGTGGCAGG - Intergenic
1198765678 X:140077211-140077233 CATTTTGTAAAGAAGCTTGCTGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202356704 Y:24059153-24059175 CAGAGTCTACAGAAGCTGGCAGG - Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202514074 Y:25610957-25610979 CAGAGTCTACAGAAGCTGGCAGG + Intergenic