ID: 1150142088

View in Genome Browser
Species Human (GRCh38)
Location 17:62738814-62738836
Sequence AAACCCAGGAGGGGCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150142088_1150142096 14 Left 1150142088 17:62738814-62738836 CCTCTCAGGCCCCTCCTGGGTTT 0: 1
1: 0
2: 1
3: 38
4: 295
Right 1150142096 17:62738851-62738873 AGAGATGCAGCAGCAATTCAAGG 0: 1
1: 0
2: 2
3: 28
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150142088 Original CRISPR AAACCCAGGAGGGGCCTGAG AGG (reversed) Intronic
900320553 1:2081471-2081493 ACCCCCAGAAGGGGCCTGTGTGG + Intronic
900552951 1:3265606-3265628 AGACCCAAGAGGGGCCTCTGCGG - Intronic
900989725 1:6092783-6092805 ACCCCCAGGAGGGGACAGAGAGG + Intronic
901531184 1:9853485-9853507 AGAGCCAGGAGGGACCTCAGAGG + Intronic
901626671 1:10628873-10628895 AATTCCAGGAGGGACCTGGGAGG - Intronic
902149207 1:14429247-14429269 AGACCCAGGAGGGCCCTGTGGGG - Intergenic
902343750 1:15800908-15800930 AAACCCAAGAGGGCCCTTAGTGG - Intergenic
902663833 1:17923767-17923789 AGAGCCAGGAGGGGCCAGAGTGG + Intergenic
903300358 1:22374485-22374507 AACCCCAGGAGGGGGCAGGGTGG - Intergenic
903664502 1:24998022-24998044 AGGCCCAGCAGGGGCTTGAGAGG + Intergenic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
906357881 1:45123041-45123063 TAAGCATGGAGGGGCCTGAGTGG + Intronic
906860916 1:49358170-49358192 AAACCCAGGTGGGGCCTTAATGG - Intronic
907508229 1:54937897-54937919 AAAACCAGTAGGGTCCTGATGGG + Intergenic
908414380 1:63898729-63898751 GAACACAGGAGGTTCCTGAGAGG + Intronic
910061785 1:83102595-83102617 AGACACAGGAGGGGGCTGAATGG + Intergenic
911503869 1:98724268-98724290 AAACCCAGCAATGGCCAGAGTGG - Intronic
911886170 1:103302340-103302362 AAACGCAGGAGAGGTCAGAGAGG - Intergenic
912431600 1:109630971-109630993 ATACCAAGGAAGGCCCTGAGGGG + Exonic
912804132 1:112742551-112742573 AAAACCAGGAGCAGCGTGAGCGG + Intergenic
913135456 1:115884175-115884197 AAACCCAGGTGGGGCCAGGTGGG - Intergenic
913143837 1:115969671-115969693 AAATCCAGCAGGGGCCTGGGTGG + Intergenic
915446041 1:155975598-155975620 GAGCCCAGGAGGGAGCTGAGAGG - Intronic
915839346 1:159202440-159202462 ACGCCAAGGAGAGGCCTGAGAGG - Intronic
915981867 1:160425403-160425425 AAACTCTGGGGGGTCCTGAGGGG + Exonic
917121927 1:171652255-171652277 AGACCCAGGAGGGGCTGCAGAGG - Exonic
918124393 1:181570036-181570058 AGAGCCAGGAGGGGTCTGAGAGG + Intronic
921041773 1:211439698-211439720 CAACCCAGGAGGTGCCTTTGAGG - Intergenic
921809634 1:219497858-219497880 AACCACGGGAGGGGACTGAGAGG + Intergenic
922705100 1:227786511-227786533 AAAGCCAGGATGGGCCAGGGAGG + Intergenic
924601941 1:245498747-245498769 AAACCCAGGAGGGCAGTGGGTGG - Intronic
1063120292 10:3101137-3101159 ACACCCAGGAGGAGCCAGGGAGG - Intronic
1063367973 10:5502775-5502797 AAACCCAGCAGGGAAGTGAGAGG + Intergenic
1065898500 10:30184892-30184914 AAACTCAGGAGAGACCTGAGTGG - Intergenic
1066187877 10:33028102-33028124 ACACCCAGGAGGTGAGTGAGCGG + Intergenic
1066430696 10:35348658-35348680 AAGCCCGGCAGGGCCCTGAGAGG + Intronic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1068966665 10:62918592-62918614 AGATCCAGGAGGGCCATGAGGGG - Intronic
1069863868 10:71488203-71488225 AAAGTCAGGAGGTGCCTGGGTGG + Intronic
1070537056 10:77387027-77387049 GAACCCGGGAGTGGGCTGAGGGG + Intronic
1071294184 10:84207283-84207305 AAACCCAGGAGGGATCAGAGAGG + Intronic
1071294808 10:84211791-84211813 AGAGGCAGGAGGGGCCTGGGAGG + Intronic
1072717334 10:97760578-97760600 GGACCCATGAGGGGGCTGAGAGG + Exonic
1074929180 10:118106198-118106220 AAACACAGGAGGACTCTGAGTGG + Intergenic
1074940983 10:118235971-118235993 ATAGCCAGGAGGAGGCTGAGGGG - Intergenic
1075100063 10:119500044-119500066 AAACCCGGCACGGTCCTGAGAGG + Exonic
1076132349 10:128022201-128022223 CGACTCAGGAGGGGCCTGGGTGG - Intronic
1076621604 10:131792547-131792569 AAACCCAGCAGAAGCCAGAGGGG + Intergenic
1076745276 10:132509808-132509830 AAGCTCAGGAGGGCCCTGTGTGG - Intergenic
1077337883 11:2013594-2013616 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1077407500 11:2389169-2389191 AACCCCAGGAGAGGTCTGAAGGG + Intronic
1077434671 11:2533046-2533068 GAACCCAGGAGGGGCCGGGCGGG + Intronic
1079677143 11:23243423-23243445 TATACCAGGAGAGGCCTGAGTGG + Intergenic
1081587623 11:44398247-44398269 AGACGCAGGAGGGGCATGTGAGG - Intergenic
1081626157 11:44656380-44656402 AAACCAAAAAGGGGGCTGAGGGG + Intergenic
1081655182 11:44852536-44852558 ACACTCAGGAGTGGCCTCAGGGG + Intronic
1081896799 11:46593803-46593825 AGGCCCAGGAGGAGCCTGGGAGG - Intronic
1083882432 11:65555179-65555201 AAGCCAAGGAGGGGTCTGGGTGG - Intronic
1083963299 11:66026424-66026446 AAATCCAGGCGGGGCCTGTTGGG - Exonic
1084444115 11:69193532-69193554 AAACCCTGGTGGGGCCTGTGTGG + Intergenic
1084888998 11:72227608-72227630 AAGCCAAGGAGGGGCAAGAGGGG - Intronic
1084962609 11:72725172-72725194 AGTCACAGGAAGGGCCTGAGAGG + Intronic
1085275762 11:75298665-75298687 ATACCCAGGAGGGGACTTACTGG - Intronic
1086890754 11:92255213-92255235 AACCCAGGGAGGGGCCTGTGAGG - Intergenic
1087398285 11:97631689-97631711 AAACTCAGGTGTGGTCTGAGGGG - Intergenic
1089012728 11:115143909-115143931 AAGGCCACCAGGGGCCTGAGAGG - Intergenic
1089417325 11:118303025-118303047 AAACTCAGCAGGGGCCAGATGGG - Intergenic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1089638615 11:119832481-119832503 GAACCCAGGAGAGACCTGGGTGG + Intergenic
1089850762 11:121494454-121494476 AAGACCTGGAGGGGGCTGAGGGG + Intronic
1090977214 11:131688292-131688314 AAACCCAGGAGGGGCACGGAAGG - Intronic
1091347858 11:134867234-134867256 AAAGGCAGGAGGGGACTGAGAGG + Intergenic
1202820867 11_KI270721v1_random:68776-68798 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095053935 12:37578633-37578655 AAACCCAGGCGGGGTCTCAATGG - Intergenic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1096414276 12:51400102-51400124 AAACCCAGGAGAGGGCCAAGGGG - Intronic
1096672616 12:53209252-53209274 ACACGGAGGAGGGGCTTGAGGGG + Intergenic
1097160554 12:57043727-57043749 GAACTCAGGAGTGGGCTGAGTGG + Intronic
1097575799 12:61390852-61390874 AAACCCAGGCGGGGTCTTAATGG - Intergenic
1098311900 12:69156993-69157015 GACCCCAGAAGGGGTCTGAGGGG - Intergenic
1098354685 12:69600988-69601010 ACACAGAGGAGGGGGCTGAGTGG + Intronic
1102775733 12:115517118-115517140 AAACTCAAGAGTGGCCTGACTGG + Intergenic
1103535360 12:121630063-121630085 AAATCCTGGAGGGGATTGAGAGG + Intronic
1103863779 12:124034994-124035016 AAAGGCAGGAGGGGTCGGAGGGG + Intronic
1103931580 12:124453544-124453566 AAAGCCAGCAGGGGCCAGGGAGG + Intronic
1103996589 12:124834141-124834163 ACAGCCAGCAGGGGCCTGAGGGG + Intronic
1105705175 13:22963869-22963891 GAACCCAGCAGGAGCCTGGGAGG + Intergenic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1107429311 13:40325764-40325786 GAACCCAGGAGGGGACTGGTGGG - Intergenic
1107542354 13:41403079-41403101 AATCCCAGGAGGCACCAGAGGGG - Intergenic
1108041574 13:46344173-46344195 CAACACTGGAGTGGCCTGAGAGG + Intronic
1108387336 13:49912015-49912037 ACACCCAGGAGGAGCTTAAGAGG - Intergenic
1110017619 13:70427648-70427670 AATCCCAGGAGGGACCTGGTGGG - Intergenic
1110139485 13:72110196-72110218 AAACACAGGAGGTGCCAAAGAGG - Intergenic
1111204038 13:84980321-84980343 AGCCCCAGGAGGGGCCTGGTAGG - Intergenic
1112243151 13:97702095-97702117 TAACCCTGGAGGGGCCAGAAAGG + Intergenic
1115470572 14:33764678-33764700 TAAGCCATGAGGGGCCTCAGGGG + Intronic
1115822117 14:37223790-37223812 ACACCCAGGAGGGGCCAGGCAGG - Intronic
1116241658 14:42351374-42351396 AAACACAGGAGAGGCCGGCGCGG - Intergenic
1116860128 14:49988514-49988536 AAACCCTGGATGGGCCTCTGAGG - Intronic
1119856870 14:77907664-77907686 AGGCCCAGGAGGGACCTCAGCGG - Intronic
1120348787 14:83326530-83326552 TAACCCAGGAGTTTCCTGAGAGG + Intergenic
1120686465 14:87543520-87543542 AAAGCCAGCAAGGGCCTGATGGG + Intergenic
1124217364 15:27818535-27818557 AAACCCTGGAGAGTCTTGAGAGG + Intronic
1124399115 15:29333194-29333216 AAACCAGGGAGAGGCCAGAGAGG + Intronic
1124604509 15:31160634-31160656 AAACCCGGGAGGCGTCTGAGTGG - Intronic
1124640308 15:31392609-31392631 ACCCCCAGGACAGGCCTGAGGGG - Intronic
1125552464 15:40556260-40556282 AAAGCCAGGAGGGAGCTCAGTGG + Intronic
1125658581 15:41378312-41378334 AAACCCAGGACGGTCCTTAGAGG + Intronic
1127794923 15:62429231-62429253 AAACTGAGGAGAGGCCTGTGTGG + Intronic
1129456378 15:75677968-75677990 ACACCCAGGAGAGCCCAGAGTGG - Intronic
1130234598 15:82122473-82122495 AAACCCAGTAGGGACCAGAAAGG - Intergenic
1131820635 15:96269918-96269940 AAACCTAGGAAGGGTTTGAGAGG - Intergenic
1132086038 15:98908981-98909003 GAAACCAGGAGGGGCCGCAGAGG - Intronic
1132115681 15:99134267-99134289 ATACCCAGGACGGGCCTGGGGGG + Exonic
1132676954 16:1124864-1124886 CCACCCAGCAGGGTCCTGAGTGG + Intergenic
1132743560 16:1427647-1427669 GAACCCAGGGGTGGCCGGAGGGG - Intergenic
1132752354 16:1464645-1464667 AGAGCCAGGTGGGGCCTGATGGG + Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1133184970 16:4089585-4089607 AAACCCAGGAGTGGCATGGCTGG + Intronic
1135204929 16:20475578-20475600 AAACCCAGTCTAGGCCTGAGTGG + Intronic
1136007676 16:27342092-27342114 AGACACAGGAGCAGCCTGAGCGG - Intronic
1136538578 16:30914959-30914981 AAGCCCAGGAGAGGCCTCATAGG - Intergenic
1136573320 16:31109269-31109291 GGTCCCAGGAGGGGCCGGAGCGG - Exonic
1137557626 16:49482784-49482806 AAACCCAGGAAGCACCTGAGGGG + Intergenic
1141171676 16:81695674-81695696 AATCACAGCAGGGGCCAGAGTGG + Intronic
1141477104 16:84281422-84281444 AAACTCATGAGGGTCTTGAGGGG - Intergenic
1141611807 16:85185840-85185862 AAACTCTGGAGGGCCCTGCGGGG + Intergenic
1141702534 16:85649060-85649082 CAACCCAGGAGAGGCCTCTGGGG - Intronic
1142165329 16:88583841-88583863 AGGACAAGGAGGGGCCTGAGTGG - Intronic
1142611505 17:1111129-1111151 GAACACAGCAGGGGCCTGTGGGG - Intronic
1143248557 17:5505319-5505341 AACCCCAGCAGGGGATTGAGTGG - Intronic
1143840675 17:9728841-9728863 AAAGCCAGCAGGGCCCCGAGAGG + Exonic
1145976313 17:28986263-28986285 AATCCCAAGAGGGGCCATAGCGG - Intronic
1146902043 17:36594943-36594965 AAACCCAACAGGGGTCTGACTGG - Intronic
1147556251 17:41481028-41481050 GAGCCCAGGAGGGGCCAGTGGGG - Exonic
1149685071 17:58530657-58530679 AAGCCCAGCAGGGGCTAGAGGGG - Intronic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1152594948 17:81233461-81233483 AAACCCTGGAGGGTGCTGTGCGG + Exonic
1152636805 17:81433541-81433563 AAGCACAGGAGGGGCCTCGGTGG - Intronic
1152659294 17:81535007-81535029 CTACCCAGGAGAGGCGTGAGGGG + Intronic
1160524535 18:79527124-79527146 AAAATCAGGAAGAGCCTGAGAGG + Intronic
1160780544 19:876079-876101 AGACCCAGGCGGGGGCTGCGAGG - Intronic
1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG + Intronic
1160955073 19:1687512-1687534 AAACCACGGAGGGGTCAGAGAGG + Intergenic
1161116680 19:2500957-2500979 AATCCCACGAGGGGCCTGGGAGG - Intergenic
1161231341 19:3176556-3176578 CCACCAAGGAGGGTCCTGAGGGG - Intronic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1161471003 19:4456829-4456851 TTACCCGGGAGGGGCCTGAGAGG - Intronic
1161858453 19:6779562-6779584 AAACCAGGGAGGGGCCTGGCTGG + Intronic
1162029065 19:7909643-7909665 AAACCCAGGAGGGGAAGGTGAGG + Intronic
1163312281 19:16521697-16521719 AGACCCTGGGTGGGCCTGAGAGG - Intronic
1163424687 19:17235064-17235086 GAGCCCAGTGGGGGCCTGAGGGG + Intronic
1165632291 19:37312195-37312217 CGACCCAGAAGGGGCCTGATGGG - Intergenic
1166323095 19:42031503-42031525 TAACTCAGAAGGGGCCTGATGGG - Intronic
1167128120 19:47565611-47565633 AAACCCAAAAGGGCCCAGAGTGG + Intergenic
1167712296 19:51119893-51119915 AGACCCAGAGGGGTCCTGAGCGG + Intergenic
1168097732 19:54125091-54125113 ACACACAGGAGGGGCAGGAGAGG + Intronic
1168254266 19:55157321-55157343 AAACCAAGGAGGGGGGTTAGTGG + Intronic
1168468824 19:56624934-56624956 AGAAACAGGAGGGACCTGAGAGG - Exonic
925170779 2:1749163-1749185 ATGCCCAGGAGGGGTCTCAGTGG - Intergenic
925606411 2:5665282-5665304 AAAGCCAGAAGGGGCCTGACAGG - Intergenic
926478322 2:13356639-13356661 AAACACAGCATGGGCCTGAAGGG + Intergenic
928784181 2:34862154-34862176 AAGCCAAGGAGCGGCCTCAGAGG - Intergenic
929557692 2:42935902-42935924 AGATCCAGGTGGGGCATGAGAGG - Intergenic
933352555 2:81173263-81173285 GAACACAGGAGAGGCCAGAGTGG + Intergenic
934773627 2:96923614-96923636 AAACCCAGGAGGGGGCACAGGGG + Intronic
935350998 2:102151824-102151846 AGACCCAGGAGGTGCCATAGAGG + Intronic
938198915 2:129357080-129357102 ACACCCATGAGGGGCATTAGAGG - Intergenic
939634992 2:144571277-144571299 AAACCTAGGCTGGGCCTGGGTGG + Intergenic
941393180 2:164941970-164941992 AAAAACAGGAGGGGGCTGAAAGG + Intronic
943479151 2:188396277-188396299 AAAGCCAGGTGGGGGCTGGGTGG + Intronic
946025867 2:216671335-216671357 AAACACAGGAGGGGCCGTAGGGG + Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948429975 2:237912808-237912830 ACACCCAGGAGGAGGCTCAGGGG - Intergenic
948583407 2:239003391-239003413 AAACCCAGGAGGCGAGTGGGAGG - Intergenic
948740739 2:240044212-240044234 AAACCCAGGTGGGGGCTGCAGGG - Intergenic
948746300 2:240096283-240096305 AAAGCCAGGAGGGGGCTGGACGG - Intergenic
1168857157 20:1016756-1016778 GAAGAGAGGAGGGGCCTGAGAGG - Intergenic
1169463976 20:5821653-5821675 AAATCCAGGAGGGGCTTAATAGG + Intronic
1170112084 20:12816272-12816294 AAACCAAGGAGGTGTCTAAGTGG + Intergenic
1170897966 20:20433408-20433430 AAACCCTGCAAGGGGCTGAGGGG + Intronic
1171407135 20:24918956-24918978 GGGCCCAGCAGGGGCCTGAGTGG + Intergenic
1171528328 20:25833706-25833728 AAACCCAGACGGGGTCTCAGTGG + Intronic
1171548498 20:26022172-26022194 AAACCCAGACGGGGTCTCAGTGG - Intergenic
1172479036 20:35260221-35260243 AAACCCAAGAGAGCCCTGAGGGG - Intronic
1173253004 20:41374538-41374560 AGCCCCAGGAGGGGCCAGAAAGG + Intergenic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1174311609 20:49660049-49660071 ACACATAGAAGGGGCCTGAGTGG - Intronic
1174387701 20:50197140-50197162 AGACCCAGGAGAGGCCAGAGTGG + Intergenic
1174493674 20:50922870-50922892 AAACCCAGGAGGGCCAGGCGCGG - Intronic
1174701687 20:52615641-52615663 AAATCAAAGAAGGGCCTGAGTGG - Intergenic
1176093539 20:63329395-63329417 GAGCCCAGGAGGCGCCTGTGTGG + Intronic
1176093714 20:63330068-63330090 AGTCCCAGGAGGGGCCTGTGAGG + Intronic
1176104421 20:63379209-63379231 AAATGCAGAAGGAGCCTGAGTGG - Intergenic
1176241123 20:64076446-64076468 AGACCCAGGAGGGGACCCAGTGG - Intronic
1176415981 21:6475056-6475078 GGAACCAGGAGGAGCCTGAGGGG + Intergenic
1178639752 21:34336392-34336414 AAAGCCACGTGGGGCCTGGGGGG + Intergenic
1178914021 21:36697214-36697236 AAGCCCAGGAGGTGCCAGAGCGG + Intergenic
1179552306 21:42151025-42151047 TTGCCCAGGAGGGGCCTGATGGG - Intergenic
1179603538 21:42496774-42496796 CATCCCCGGAGGGGCCTGCGAGG - Intronic
1179667404 21:42922321-42922343 AAGCCCTGGAGGGGTCTGGGTGG + Intergenic
1179691481 21:43083390-43083412 GGAACCAGGAGGAGCCTGAGGGG + Intergenic
1181314875 22:21964537-21964559 ACACCCAGGATGGGCCTGATGGG + Intronic
1181636096 22:24175579-24175601 AAGGCCGGGATGGGCCTGAGGGG - Intronic
1181763408 22:25073684-25073706 AAACCCAGAATGGGGCAGAGGGG - Intronic
1181948381 22:26536521-26536543 AGACCCAGATGGCGCCTGAGCGG + Intronic
1182022658 22:27094203-27094225 AAGACCAGGAGGGGCTTGAAAGG + Intergenic
1182522098 22:30890545-30890567 ACAGCCAGGAGGGGCCAGGGAGG + Intronic
1182770870 22:32795431-32795453 TAACCCCGGAGGGGACTGAGGGG + Intronic
1183692830 22:39400548-39400570 AAACCCATGAGGGTCCAGACCGG - Intronic
1184100166 22:42337911-42337933 AAATCCAGAATGGGCCTGGGAGG + Intronic
1184952147 22:47851013-47851035 TCACTCAGGAGGGGGCTGAGTGG + Intergenic
1185292145 22:50032487-50032509 ACACCCAGAAGAGGCCTGGGAGG - Intronic
950430036 3:12945269-12945291 GAACCCAGGAGTGCCCAGAGCGG - Intronic
950495601 3:13332467-13332489 GAGCCGAGGAGGGGCCAGAGAGG + Intronic
950788881 3:15456544-15456566 ACAACCAGGAGGAGCTTGAGAGG - Exonic
950929195 3:16772148-16772170 AAACCCAGGTGGGGTCTTAATGG - Intergenic
953152179 3:40334554-40334576 AAACCCAAGTGGGGCCTAAGGGG + Intergenic
953906830 3:46872578-46872600 CAGGCGAGGAGGGGCCTGAGAGG - Intronic
954107210 3:48415812-48415834 GAAGCCAGTTGGGGCCTGAGTGG - Intronic
954966500 3:54616164-54616186 GAACCCAGGAGTAGCCTGACTGG + Intronic
959122547 3:102249462-102249484 AAACTCAGGAGGCTCTTGAGTGG - Intronic
960742551 3:120851005-120851027 AAAACCAGAAGGGGCCTTAGAGG + Intergenic
962754399 3:138457053-138457075 AAGCCCAGGAGGGTCGTGTGAGG - Intronic
963476176 3:145807621-145807643 AAAGCCTGGAGGAGCCTTAGCGG - Intergenic
968316263 3:197728281-197728303 GAACCCAGGAGGGGACTGCAAGG - Intronic
968697589 4:2040711-2040733 AAACGCACGCGGGGCCCGAGGGG - Intronic
969892577 4:10273511-10273533 ACACATAGGTGGGGCCTGAGGGG + Intergenic
970191871 4:13525146-13525168 GGAGCCAGGAGGGGCCTCAGGGG + Intergenic
970597637 4:17614701-17614723 AAGGCCCGGCGGGGCCTGAGGGG - Exonic
970808273 4:20061290-20061312 AAATGCAGCTGGGGCCTGAGAGG + Intergenic
972194689 4:36639358-36639380 AAACCCAGGTGGGGTCTAAATGG + Intergenic
974972145 4:68843770-68843792 AAACCAAGGTGGGGTCTGAATGG - Intergenic
975605031 4:76147148-76147170 AATCCCAGGATGGGCTTGACTGG + Intronic
975632895 4:76420396-76420418 AAAACCTGGAGCAGCCTGAGTGG + Intronic
976812048 4:89108678-89108700 AAGCCCAGCTGGGGTCTGAGGGG - Intronic
977780569 4:100976526-100976548 AAAAACAGGAGAGACCTGAGGGG - Intergenic
980339575 4:131526898-131526920 AAACCCAGGTGGGGTCTTAATGG - Intergenic
982157266 4:152535383-152535405 GACCCCCGGAGGGGGCTGAGGGG + Exonic
982656570 4:158157069-158157091 AAACTCAGGAGTGGTTTGAGAGG - Intronic
982761438 4:159289101-159289123 AAAGAGAGGAGGGGCTTGAGGGG - Intronic
984894883 4:184529563-184529585 AAAGGCAGGAAGGGCCTCAGGGG - Intergenic
985120883 4:186640898-186640920 AAAACCAGGTGGAGCCTGTGTGG + Intronic
985174569 4:187187651-187187673 AAACCCAGGAGGATTCTGATGGG - Intergenic
985548799 5:523100-523122 AAACACACAAGGGGCCTGAAGGG + Intronic
985771494 5:1814717-1814739 AAACCGAGAAGGGCCCAGAGAGG - Intronic
985905656 5:2833848-2833870 TAACCCAGGAAAGGCCTCAGAGG + Intergenic
986132376 5:4943123-4943145 AAAGCCAGGAGAGGCCAGAGAGG + Intergenic
989146525 5:38256354-38256376 AAACACAGCAGTGGACTGAGAGG - Intergenic
990807187 5:59677800-59677822 ACACCTAGGAGGGGCCAAAGGGG - Intronic
994692433 5:103034908-103034930 AAATCCAGAGGGGGCCAGAGTGG + Intergenic
995547977 5:113251877-113251899 AAACCCACTGGTGGCCTGAGGGG + Intronic
998680851 5:144465510-144465532 AGACCCAGAAGAGACCTGAGAGG - Intronic
999127861 5:149259603-149259625 AAATCCAGGATGGCCATGAGCGG - Exonic
1001214857 5:169846172-169846194 AATCCCAGGAGGGCCCCAAGTGG + Intronic
1001264309 5:170261605-170261627 ACACCAAGGTGGGCCCTGAGAGG - Intronic
1001897533 5:175394295-175394317 ATAACCAGGAGGGACCTGGGAGG + Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1002851954 6:1004100-1004122 AGACCCAGGAGGGGCCTGGCAGG - Intergenic
1003981923 6:11397864-11397886 AGACTAAGGAGTGGCCTGAGAGG + Intergenic
1005930170 6:30477291-30477313 GAACCCAGGAGGCGGGTGAGCGG + Intergenic
1007739681 6:44002938-44002960 AAGCCCAGGAGGGGACGCAGGGG - Exonic
1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG + Intronic
1009686603 6:66966371-66966393 AAACCCAGGTGGGGTCTTAATGG - Intergenic
1013056368 6:106587070-106587092 AATCCCAGCAGAGGCATGAGTGG + Intronic
1015120093 6:129691961-129691983 AAGCCCAGGTGGCCCCTGAGAGG - Intronic
1017468116 6:154713716-154713738 AAACCCAAGAGTGGTTTGAGGGG + Intergenic
1018473479 6:164117607-164117629 AAACGGAGCAGGTGCCTGAGGGG - Intergenic
1018746729 6:166768158-166768180 AAACCCAGAGAGGGCCTCAGCGG + Intronic
1019335369 7:480238-480260 AAAGCCAGGAAGGGCCGGGGAGG - Intergenic
1019393759 7:805373-805395 AACCCCAGGCGGGGGCAGAGCGG - Intergenic
1019453630 7:1113191-1113213 AAAAGCATGAGGGGCCTGTGTGG - Intronic
1019996265 7:4726316-4726338 GAATCCAGGAGGGGCCTGCCAGG - Intronic
1020007509 7:4790360-4790382 AAACCCGGGAAGCGTCTGAGTGG - Intronic
1022282713 7:28927120-28927142 AAACCCAGGAGGGAACTGGCTGG - Intergenic
1022341731 7:29474932-29474954 AAGCCCAGAAGGGACCTTAGAGG - Intronic
1023874748 7:44280909-44280931 AAAACCAGGAGAGGGATGAGGGG + Intronic
1024187816 7:46971252-46971274 AAACCCAGGAGAGGCACGACTGG + Intergenic
1026124861 7:67570612-67570634 AAACCAAGGAGAGGACTTAGGGG - Intergenic
1026566400 7:71493184-71493206 AAACCCAGGAGAGCCTTGAAAGG - Intronic
1028319055 7:89437779-89437801 AATCCGAGCTGGGGCCTGAGAGG - Intergenic
1032804224 7:135339428-135339450 AAACCCAGGCAGGGCCTGAGTGG - Intergenic
1033301748 7:140192388-140192410 AGTTCCAGGAGGGGCCGGAGAGG + Intergenic
1034426277 7:151015914-151015936 ACACCCAGAAGGAGCCTGACCGG - Exonic
1034531425 7:151698295-151698317 AAAACCAGGAGGAGGCTCAGAGG - Intronic
1034958819 7:155351664-155351686 AGACCCAGGAGGGCCCTGGCTGG - Intergenic
1034992181 7:155554945-155554967 AGAGTCAGGAGGTGCCTGAGGGG - Intergenic
1035119003 7:156549368-156549390 GAGCCCAGGAGGGGACTGGGCGG - Intergenic
1036953917 8:13166832-13166854 GGACCTAGGTGGGGCCTGAGAGG + Intronic
1037905442 8:22713589-22713611 AAAGCTGGCAGGGGCCTGAGAGG + Intronic
1039559219 8:38499296-38499318 ACAGCCAAGAGGAGCCTGAGGGG - Intergenic
1040905908 8:52469793-52469815 AACCCCTGGAGGGTCCTGAGTGG - Intergenic
1046704945 8:117439300-117439322 AAGCCAAGGAGAGGCCTCAGAGG + Intergenic
1047803177 8:128331047-128331069 ACAGCAAGGAGGGGCCAGAGGGG + Intergenic
1049193291 8:141300978-141301000 AAACACAGGAGCATCCTGAGGGG + Intronic
1049602748 8:143515523-143515545 AAACAGTGGAGGGGCCTGGGAGG - Intronic
1049606059 8:143529724-143529746 GGACCCAGGTGGGACCTGAGAGG - Intronic
1050610762 9:7350397-7350419 GTACCCAGGTGGGGCCTGGGAGG + Intergenic
1052975399 9:34406301-34406323 GTACACAGGAAGGGCCTGAGGGG - Intronic
1052993610 9:34537421-34537443 AAGCCGAGGAGGGGCCCAAGAGG - Intergenic
1053796293 9:41729835-41729857 AAACCCAGGTGGGGTCTCAATGG + Intergenic
1054184698 9:61941905-61941927 AAACCCAGGTGGGGTCTCAATGG + Intergenic
1054456618 9:65434550-65434572 AGGTCCAGGAGGGGCCTGTGGGG - Intergenic
1054468652 9:65516140-65516162 AAACCCAGGTGGGGTCTCAATGG - Intergenic
1054653809 9:67646592-67646614 AAACCCAGGTGGGGTCTCAATGG - Intergenic
1056292581 9:85158669-85158691 AATCCCAGCAGGAACCTGAGGGG + Intergenic
1056546771 9:87620183-87620205 AGACCAAGGAGGGGCACGAGCGG - Intronic
1056911448 9:90704615-90704637 GAACCCAGCAGGGTCCTTAGAGG + Intergenic
1056918225 9:90762974-90762996 AAAACCAGGAGGGGGGAGAGGGG + Intergenic
1060831671 9:126721528-126721550 TGACCCAGCAGGGGCCTGAATGG - Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061251575 9:129429347-129429369 AAAATCAGGAAGGGGCTGAGTGG + Intergenic
1061281737 9:129601527-129601549 AACCCCAGGAGAGTCCTGACTGG + Intergenic
1061444139 9:130628254-130628276 AAATCCAGCAGGGGCCAGGGAGG - Intronic
1061727279 9:132588807-132588829 TCACCCTGGAGAGGCCTGAGGGG - Intronic
1061811497 9:133164759-133164781 ACACCCCTGAGGGGCCTGGGAGG - Intergenic
1061991291 9:134160084-134160106 AAACCCAGGACTGTCCTGCGGGG - Intergenic
1062339001 9:136085586-136085608 AAGGCCAGGAGGGGCCTGGGAGG + Intronic
1062498047 9:136840817-136840839 AGGCCCAGGAGGGACCTGTGAGG + Exonic
1185460423 X:330740-330762 GCAACCAGGACGGGCCTGAGCGG - Intergenic
1185562369 X:1069590-1069612 GACCCCAGGATGGGGCTGAGAGG + Intergenic
1186190054 X:7059359-7059381 AAACCCAGCAAGGCCCTGAAAGG + Intronic
1187956914 X:24528223-24528245 AAACACAGGAAGGGGCTCAGAGG + Intronic
1190325431 X:49204435-49204457 AAAGCCAGGTGGGCCCTGAGTGG + Intergenic
1192258940 X:69492255-69492277 AAACCAAGGAAGGCTCTGAGAGG - Intergenic
1192528295 X:71866836-71866858 AAACCCAGCTGGAGCCTGAAGGG + Intergenic
1200767741 Y:7094586-7094608 TAACCAAGGAATGGCCTGAGCGG + Intergenic
1201562239 Y:15330488-15330510 AAACCCAGCAAGGCCCTGAAAGG + Intergenic
1201579061 Y:15492307-15492329 AAAGCCAGGAGCGGCCTGGGAGG - Intergenic
1201755706 Y:17483665-17483687 AATCCCAGGGTCGGCCTGAGTGG + Intergenic
1201845846 Y:18422320-18422342 AATCCCAGGGTCGGCCTGAGTGG - Intergenic