ID: 1150142299

View in Genome Browser
Species Human (GRCh38)
Location 17:62740303-62740325
Sequence GTGAAGTGCCTGCCATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150142297_1150142299 -5 Left 1150142297 17:62740285-62740307 CCTGGGCTCCAGCTGTGAGTGAA 0: 1
1: 1
2: 4
3: 20
4: 265
Right 1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 179
1150142292_1150142299 26 Left 1150142292 17:62740254-62740276 CCTGCAGATGCTGCAAATGCTTC 0: 1
1: 0
2: 2
3: 16
4: 330
Right 1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 179
1150142291_1150142299 27 Left 1150142291 17:62740253-62740275 CCCTGCAGATGCTGCAAATGCTT 0: 1
1: 0
2: 1
3: 39
4: 263
Right 1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 179
1150142296_1150142299 -4 Left 1150142296 17:62740284-62740306 CCCTGGGCTCCAGCTGTGAGTGA 0: 1
1: 0
2: 3
3: 29
4: 246
Right 1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150142299 Original CRISPR GTGAAGTGCCTGCCATCTCC AGG Intronic
900173343 1:1281204-1281226 GCCAGGCGCCTGCCATCTCCAGG + Exonic
900323553 1:2096402-2096424 GTGAGGTGCCTCCCTTCTCTGGG + Intronic
900816885 1:4854547-4854569 GTGAAGTGCCTGCCACCCCGTGG + Intergenic
902155562 1:14482731-14482753 GGGAAGTTCCTGCCATATGCTGG - Intergenic
902214475 1:14925340-14925362 GAGAAGGGGCTGCCATCACCAGG + Intronic
903227561 1:21902302-21902324 GTGAAGTTCCTGCCACCTTGGGG - Intronic
903246405 1:22019051-22019073 GTGATCTGCCTGCAAGCTCCAGG + Intergenic
904197358 1:28795765-28795787 GAGAAGTGCATGCCACCTCCTGG + Intergenic
904249984 1:29216350-29216372 GTGAAGTGCCTGCGACATGCTGG - Intronic
904412987 1:30336148-30336170 GTGAGTTGGCTGCCCTCTCCAGG + Intergenic
904617915 1:31759938-31759960 ATGAGGTGTCTGCCATCCCCAGG - Intronic
904764039 1:32828558-32828580 GTAAAGATACTGCCATCTCCTGG - Intronic
906538882 1:46569635-46569657 GTGAAGTGCCTCCCGTGGCCTGG - Intronic
912769633 1:112451858-112451880 CTGCAGTACCTGCCACCTCCAGG + Intronic
915955592 1:160217590-160217612 GTGCAGTGCATGCCATCTTGAGG - Exonic
919974593 1:202602485-202602507 CTGAGGTGCCTCCCATGTCCAGG + Exonic
922340091 1:224648062-224648084 GTGAAGAACCAGCCATGTCCAGG + Intronic
922346516 1:224700986-224701008 GTGAAGTGCCTGGGATCTCCTGG - Intronic
923413354 1:233731414-233731436 GGGAAGTTCCTGCCATTTGCAGG - Intergenic
923511721 1:234658992-234659014 GTAAAGTGCCTGCAATGTGCAGG - Intergenic
924286676 1:242494340-242494362 GTGAACTGCCTGCCACATGCAGG + Intronic
1063497975 10:6527657-6527679 GTGAAGTGACCGCTGTCTCCTGG - Intronic
1070650105 10:78229125-78229147 GTGAAGTGCTTGCCACAGCCAGG - Intergenic
1070849405 10:79551553-79551575 GTCCAGTGCCTGCCTTCTGCTGG - Intergenic
1072104382 10:92260071-92260093 GTGAAGTCCAAGCTATCTCCTGG - Intronic
1073304678 10:102493651-102493673 ATGAAGTGCATGCCACCTCGTGG - Intronic
1074560656 10:114532565-114532587 CTGAAGCACATGCCATCTCCTGG + Intronic
1075612494 10:123864975-123864997 GTGCAATGCCTGCCCTCTCACGG + Intronic
1077062177 11:622323-622345 GTGGAGCACCTGCCACCTCCTGG - Intronic
1078548615 11:12264525-12264547 GTGGGATGCCTGCCATTTCCTGG + Intergenic
1079466971 11:20740334-20740356 GAGCAGTCCCTGCCATCTCTGGG + Intronic
1080443280 11:32314505-32314527 GGGAGGAGGCTGCCATCTCCTGG + Intergenic
1080640511 11:34155740-34155762 GGGAAGAGGCTGACATCTCCAGG - Intronic
1083889015 11:65586607-65586629 GGGAACTGCCAGCCATCTCCCGG + Intronic
1084191662 11:67502198-67502220 GAGAAGTCCCAGCCCTCTCCAGG - Intronic
1088174789 11:107040343-107040365 GTGAAGTTCCTGCAAGCTTCTGG + Intergenic
1091567505 12:1659904-1659926 CTGATGTGGCTGCCATGTCCTGG - Intergenic
1092039268 12:5369176-5369198 GTGAAGGGCCAGGCATCACCTGG - Intergenic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1098382273 12:69881622-69881644 GTCAAGTCCCACCCATCTCCTGG + Intronic
1100672726 12:96834628-96834650 CTGCAGTTCCTGGCATCTCCAGG - Intronic
1102965667 12:117123630-117123652 GTGAAGTGCCTGGCACGTGCTGG + Intergenic
1103199209 12:119072780-119072802 GTGAAGTGCCTGGAATCTCAGGG - Intronic
1103204415 12:119117311-119117333 CTGAAGTGCCCGCTGTCTCCTGG + Intronic
1105779713 13:23695738-23695760 GTGAAGTCCCTGCCAGCTGCTGG + Intergenic
1107388011 13:39933440-39933462 GTCAACTGCCTGCAAGCTCCGGG + Intergenic
1112306511 13:98279697-98279719 GTGATGTCCCTGACATCCCCTGG - Intronic
1114281144 14:21193190-21193212 CTGCAGTGCCTGGCGTCTCCAGG + Intergenic
1115126801 14:30005300-30005322 GTGCTGTACCTGCCATCTACTGG + Intronic
1115797891 14:36959523-36959545 GTGAAGAGCCTACCCTCTCTAGG - Intronic
1115881998 14:37929873-37929895 GTAAACTGCTTACCATCTCCCGG + Intronic
1116058454 14:39893282-39893304 CTGAAGGGCCTGCTACCTCCTGG + Intergenic
1118326875 14:64787145-64787167 CTGAAATGCCTGCCACCTGCCGG + Exonic
1118334584 14:64842114-64842136 GCCAAGTGCCTGCCATTTCCAGG + Intronic
1119641754 14:76320564-76320586 GTCAAGTGCCTGCCGTGTCCAGG - Intronic
1119871897 14:78024944-78024966 GTAAATTGCCTGCCCACTCCTGG - Intergenic
1121504776 14:94468449-94468471 TAGAAGTGCCTGGCATCTCCAGG - Intronic
1122569263 14:102683696-102683718 GCGCACTGGCTGCCATCTCCAGG - Intronic
1122903379 14:104791122-104791144 GTCAAGGCCCTGGCATCTCCTGG + Intronic
1125089939 15:35778685-35778707 GTGAAGTTCCTGACTTCTCTTGG + Intergenic
1126331688 15:47539191-47539213 GTGATGTGCTTGTCATCACCTGG + Intronic
1126886682 15:53158408-53158430 GTGAAGTGCATGGCATGTCATGG - Intergenic
1127655177 15:61048802-61048824 TTCAAGTGCCGGCCATTTCCTGG + Intronic
1128345146 15:66848722-66848744 AGGAAGGGCCTGGCATCTCCAGG - Intergenic
1129697109 15:77746970-77746992 GGTAAGTCCCTGCCCTCTCCTGG - Intronic
1131616674 15:94023639-94023661 CTGGAGTGCCTGCCAGCCCCTGG - Intergenic
1131905243 15:97135250-97135272 TTGAAGTGGTTGCCATCTCTTGG + Intergenic
1132223939 15:100126204-100126226 GTGGATTACCAGCCATCTCCGGG - Intronic
1134888274 16:17814686-17814708 GTGAAGTATCTGCCCTCTCTAGG + Intergenic
1135514986 16:23124482-23124504 GAGAAGTGAGTGCCCTCTCCGGG + Intronic
1135698434 16:24610578-24610600 GGGAAGTGCCTGCCGGCTCTGGG + Intergenic
1137367362 16:47872441-47872463 GTGCATTTCCTGCCATCTCTAGG + Intergenic
1137415133 16:48269804-48269826 GTGTAGTGCCTACTATCTCTGGG + Intronic
1137630602 16:49941022-49941044 TTGTAGTGCTTTCCATCTCCAGG - Intergenic
1139151041 16:64381967-64381989 TTGCAGTTCCTGGCATCTCCAGG + Intergenic
1139964414 16:70737554-70737576 GTGAGGAGCCTGCCAGCCCCTGG + Intronic
1149478701 17:56984681-56984703 CTGAAGAGTCTCCCATCTCCTGG + Intronic
1150142299 17:62740303-62740325 GTGAAGTGCCTGCCATCTCCAGG + Intronic
1152241708 17:79164466-79164488 GTGAAGTGCCGCCCACCCCCAGG - Intronic
1154162567 18:11991028-11991050 GTGAGGTGGAGGCCATCTCCAGG + Intronic
1154374018 18:13793998-13794020 GTGAATAGGCTGCCATCTGCAGG + Intergenic
1158616529 18:58992684-58992706 GCTAAGTGTCTGCCATCCCCTGG + Intergenic
1159106152 18:64003339-64003361 GTGAAGTGGGGACCATCTCCAGG + Intronic
1160015321 18:75135581-75135603 GTCACGTGCCTGTCTTCTCCAGG - Intergenic
1160187492 18:76686887-76686909 AAAAAGTGGCTGCCATCTCCTGG + Intergenic
1160302933 18:77702847-77702869 GTGAATTGGCTGCCATCTGCTGG + Intergenic
1161975529 19:7606165-7606187 GTCAAGTCCCTCCCATCTGCAGG + Intronic
1167569555 19:50278334-50278356 GTGACATGCCTGCCCTCTCTGGG + Intronic
1167638909 19:50669388-50669410 GTGAAGTTCCTGGCATATACGGG - Intronic
1168271147 19:55250512-55250534 GGGAGGAGCCTGCCATTTCCAGG + Intronic
925171691 2:1754133-1754155 GTGAAGTGTCTGCCATGTTAGGG + Intergenic
925644950 2:6026322-6026344 TGTAAGTGCCTGCCATTTCCCGG - Intergenic
925905857 2:8539393-8539415 GTGAAGTGCAGGGCAACTCCTGG - Intergenic
927276037 2:21263192-21263214 GTGAAGTCTCTCCCAACTCCAGG + Intergenic
928139627 2:28717460-28717482 ATCAAGTGCCTGCCATGTGCCGG + Intergenic
928368778 2:30723559-30723581 GAGATGTTCCTCCCATCTCCAGG + Intronic
928478058 2:31651727-31651749 GTGAGGAGCTTGTCATCTCCAGG + Intergenic
929618649 2:43332801-43332823 TTGAACTAACTGCCATCTCCAGG + Intronic
931801703 2:65765248-65765270 TTGAATTGCTTGCCAACTCCAGG - Intergenic
934517323 2:94996883-94996905 GGGGCTTGCCTGCCATCTCCGGG - Intergenic
935446900 2:103166621-103166643 GGGAAGGGCCTGGCAGCTCCTGG + Intergenic
937462447 2:122101221-122101243 CTGCAGGGCCTTCCATCTCCTGG - Intergenic
937985126 2:127634945-127634967 GTGTAGAGGCTGCCTTCTCCAGG - Intronic
940500225 2:154484860-154484882 GTGAAGCGCCTGCCATGTACAGG - Intergenic
941788196 2:169521840-169521862 GAGAACTGCCTGGCACCTCCAGG - Intronic
948563207 2:238867480-238867502 GAGAAGTCCCAGCCAGCTCCCGG + Intronic
949005165 2:241641834-241641856 GTGGTCTGCCTGCCACCTCCTGG - Intronic
1168939583 20:1697253-1697275 GTGAATAGCATGACATCTCCAGG + Intergenic
1170222346 20:13953595-13953617 GGGAAGTTCCTGCCATTTGCAGG + Intronic
1174164411 20:48574674-48574696 AAGAGGTGCCTGCCATCTGCTGG + Intergenic
1174173733 20:48632358-48632380 GTGGAGGGGCTGCCTTCTCCAGG - Exonic
1175633509 20:60561312-60561334 AAGAAGTGCCTTCCATCTCCAGG + Intergenic
1176337432 21:5611972-5611994 GAGAAGTGAGTGCCATCACCTGG - Intergenic
1176471094 21:7107198-7107220 GAGAAGTGAGTGCCATCACCTGG - Intergenic
1176494655 21:7488976-7488998 GAGAAGTGAGTGCCATCACCTGG - Intergenic
1176505987 21:7649407-7649429 GAGAAGTGAGTGCCATCACCTGG + Intergenic
1177113743 21:17060516-17060538 GTGAAGAGGCTGCTATATCCTGG + Intergenic
1178394932 21:32234775-32234797 GTGTGGTGCCGGCCATCTGCTGG - Intergenic
1178498157 21:33104257-33104279 CTGAAGTCCCTGCTGTCTCCTGG - Intergenic
1179776882 21:43670329-43670351 GTGACGCGGCTGCCCTCTCCTGG - Intronic
1180599573 22:17007484-17007506 GTGAGGTGCCTGCCTTCTCGGGG + Intronic
1181332054 22:22100429-22100451 GTGAGGTTACTGCCATCTTCTGG - Intergenic
1182022479 22:27092317-27092339 GAGAAGTCCCTGCCAGCTCTCGG + Intergenic
1182518091 22:30870258-30870280 GTGAGGTGCCTGCCCCATCCTGG - Intronic
1184109507 22:42386862-42386884 GTGGAATCCCAGCCATCTCCTGG - Intronic
1184231469 22:43160381-43160403 GTGAAGTGACTGAGATCTCTTGG - Intronic
1185154879 22:49187561-49187583 GTGTAGTGACTGCCACCACCAGG - Intergenic
949884680 3:8683757-8683779 GGAAACTGCCTGCCACCTCCCGG + Intronic
950563196 3:13747955-13747977 GGGAAGCGCCTGCCCTCTCTGGG + Intergenic
951478511 3:23134416-23134438 GTGTAGTGCCTCCCGTGTCCGGG - Intergenic
953474860 3:43196467-43196489 AGGAGGTGACTGCCATCTCCAGG + Intergenic
961045994 3:123708472-123708494 CTGAAGTCCCTGCCCTCTCTGGG - Intronic
962324221 3:134419826-134419848 GTGAAGAAACTGCCATCCCCAGG + Intergenic
962410801 3:135140322-135140344 ATGAACTGACTGGCATCTCCAGG + Intronic
967747368 3:193072215-193072237 GTGAAATGCTTCCCATGTCCTGG - Intergenic
969130442 4:4987133-4987155 GTGCTGTGCCTGTCATTTCCAGG + Intergenic
971235777 4:24840963-24840985 GTGAAGTCACTGCCAACTACTGG - Intronic
972437332 4:39045920-39045942 GTTATGTGCCTGGCATCTGCTGG + Intronic
972443997 4:39126093-39126115 GTGGAATGCCTGCCATGTACCGG - Intronic
978561245 4:110035677-110035699 GTGAAGTGCCAGGGATCTCAGGG + Intergenic
984943368 4:184952875-184952897 TTGGAGTGCCTGCCATGTGCTGG - Intergenic
985909377 5:2866871-2866893 GTGACTCGCCTGCCAGCTCCGGG + Intergenic
986143402 5:5052604-5052626 GTGAAGTGGGAGCCCTCTCCAGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990522543 5:56593865-56593887 GACAACTGCCTGCCATCCCCTGG + Intronic
994781560 5:104095823-104095845 GTGAAGTGTCTGACATGCCCTGG + Intergenic
997699991 5:135890507-135890529 GTGAAGTTGCTACCCTCTCCAGG - Intergenic
998367662 5:141641228-141641250 GTGAAATGCCTGAAATCTCTGGG - Exonic
998384627 5:141749654-141749676 GGGAACTGACTGCCTTCTCCAGG - Intergenic
998638764 5:143986195-143986217 ATGAAGTGCATGCGAGCTCCAGG - Intergenic
1000698860 5:164422625-164422647 GTAAAGTGACTGCCCTCTGCTGG + Intergenic
1001399470 5:171437918-171437940 GTGAGGGGCCGGCCATTTCCAGG - Intronic
1002703477 5:181143739-181143761 GTTACGTGCCTTCCATCTTCAGG - Intergenic
1003260639 6:4512447-4512469 GAGCAGTGCCTGCGGTCTCCTGG - Intergenic
1006677335 6:35773886-35773908 GAGAAGTCCCTGCCTTCTCTGGG + Intergenic
1006860404 6:37168768-37168790 TTGAAGTGCCTGCCATTTAAAGG - Intergenic
1007072648 6:39048619-39048641 GAGCAGTGCCCGCTATCTCCTGG + Intergenic
1011354029 6:86454953-86454975 GTGGAGTCTCTGCTATCTCCAGG + Intergenic
1016824031 6:148371791-148371813 GTGAAGTACCTGCCAGTTCTTGG + Intronic
1018664809 6:166125820-166125842 GTGCAGTGGCTGCCAGCTCTTGG + Intergenic
1019146687 6:169980039-169980061 CTGCAGAGCCTGCCACCTCCGGG - Intergenic
1022370380 7:29765578-29765600 GTGAAATGCCTGCAGTCTCAGGG + Intergenic
1027139555 7:75647633-75647655 GTGAATTGCCTGAGAGCTCCGGG - Intronic
1027802268 7:82769926-82769948 ATGACTTGCCTGCCATCTCACGG - Intronic
1032356064 7:131211708-131211730 GTGTAGTGCCAGACACCTCCTGG + Intronic
1033075681 7:138248028-138248050 TTGAGGTTCCTCCCATCTCCTGG - Intergenic
1036621193 8:10425332-10425354 GTGAAGTGTCTGCCATCTTGTGG + Intronic
1039472345 8:37821327-37821349 GGGAACTGCCTGCCATATACTGG - Intronic
1041029004 8:53717176-53717198 GTGAAATGCTTGCCCTCTTCTGG - Intronic
1042896363 8:73673175-73673197 GGGGAGAGCCTGCCATCTACAGG - Exonic
1044799564 8:95940119-95940141 GTGAAGAGCTTGCCAACCCCTGG + Intergenic
1046830806 8:118743789-118743811 GTGGTGTGACTGCCATCTGCTGG - Intergenic
1048895519 8:138989040-138989062 GGGCAGGGCATGCCATCTCCAGG + Intergenic
1049278864 8:141733938-141733960 CTGAAGTGCATCCCATCCCCTGG + Intergenic
1049568896 8:143359299-143359321 GTGACCTGCCTCCCTTCTCCTGG - Intronic
1053516336 9:38733755-38733777 GTGAGGGGTCTGCCTTCTCCAGG + Intergenic
1054798490 9:69324911-69324933 GTGAGGTGCCTCCCACCTCGAGG + Intronic
1055986627 9:82060818-82060840 GTCAAGTTTCTGCCTTCTCCTGG - Intergenic
1056584777 9:87920767-87920789 GTCAAGTTTCTGCCCTCTCCTGG + Intergenic
1056612100 9:88132173-88132195 GTCAAGTTTCTGCCCTCTCCTGG - Intergenic
1056660231 9:88537764-88537786 GTTCAGTGCCTGGCATCCCCAGG + Intronic
1057160545 9:92885397-92885419 GTCAAGTTTCTGCCTTCTCCTGG + Intergenic
1059335862 9:113567980-113568002 GCAAAGAGACTGCCATCTCCAGG - Intronic
1062570045 9:137180756-137180778 GTGACGCGCTGGCCATCTCCAGG - Intronic
1186211986 X:7259465-7259487 GTGAAGACACTGCCCTCTCCGGG - Exonic
1189787166 X:44569415-44569437 GTGAATTGGCTGCCAGCTCTGGG - Intergenic
1191260992 X:58321018-58321040 GTGAAAAACCTGCTATCTCCAGG + Intergenic
1191791749 X:64978503-64978525 GTTAAGTGCCTGACATGTACTGG + Intronic
1192308845 X:69991923-69991945 GAGAAGTGCCTGCCACCCACTGG + Intronic
1192571249 X:72207678-72207700 GTGAAATGCCTTCCCTTTCCAGG - Exonic
1195014434 X:100764821-100764843 GTGAAGGGCCTGGCTTCTGCAGG + Intergenic
1196399225 X:115296877-115296899 TTGAAATGGCTGACATCTCCTGG - Intronic
1196613669 X:117742986-117743008 GAGAAGTGCCTTCCTTCACCAGG - Intergenic
1199676190 X:150191188-150191210 GTGATGATCTTGCCATCTCCTGG + Intergenic