ID: 1150143460

View in Genome Browser
Species Human (GRCh38)
Location 17:62749464-62749486
Sequence GTGTGCTTTCTTTGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150143456_1150143460 9 Left 1150143456 17:62749432-62749454 CCCAATGGAGAGACAACTCTTTG 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 205
1150143457_1150143460 8 Left 1150143457 17:62749433-62749455 CCAATGGAGAGACAACTCTTTGA 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 205
1150143455_1150143460 16 Left 1150143455 17:62749425-62749447 CCAAGATCCCAATGGAGAGACAA 0: 1
1: 0
2: 2
3: 13
4: 167
Right 1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 205
1150143453_1150143460 27 Left 1150143453 17:62749414-62749436 CCTAGGAGGTGCCAAGATCCCAA 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150143460 Original CRISPR GTGTGCTTTCTTTGGATCCT GGG Intronic
900081773 1:863965-863987 GCGTCCTTTCTTTGCAGCCTGGG + Intergenic
901305922 1:8232623-8232645 GTGCGCTGTCTTTGGAGCCGGGG + Intergenic
902029107 1:13408461-13408483 GGGTGTTTTAATTGGATCCTGGG - Intergenic
905616289 1:39402411-39402433 GTGTGCTTTCCTTAGTGCCTGGG + Intronic
908032722 1:60018715-60018737 GTCTGCCTTCTTTGAAACCTTGG - Intronic
908934875 1:69362923-69362945 ATGAGCTTCCTTTGGTTCCTGGG + Intergenic
910834697 1:91496967-91496989 GTCTGCTTTATTTCTATCCTAGG + Intergenic
911068577 1:93813831-93813853 TTGATCTTTCATTGGATCCTGGG - Intronic
911907652 1:103589876-103589898 GTGAGCTTTCTAAGGGTCCTTGG + Intergenic
912216653 1:107621419-107621441 GAGGGCTTTCTTTGGTTTCTTGG + Intronic
912907924 1:113726907-113726929 GTTTGCTTTCTGTGTAGCCTTGG - Intronic
916123738 1:161551001-161551023 GTGTGTTTCATTTGGCTCCTGGG + Intergenic
916133624 1:161632364-161632386 GTGTGTTTCATTTGGCTCCTGGG + Intronic
916215146 1:162387465-162387487 GTGTGGGTCCTCTGGATCCTTGG - Intergenic
916874667 1:168956319-168956341 CTGGGCTTTCTTTGGTTCATAGG + Intergenic
918152645 1:181811282-181811304 GTCTGATTTCTTTTGGTCCTTGG - Intergenic
918243543 1:182640449-182640471 GTGTGGGTTCTGTGGGTCCTTGG + Intergenic
918298889 1:183184538-183184560 GTGTAATTTGTTTGAATCCTGGG + Intergenic
919576451 1:199315974-199315996 GAGTGCTTTCTCAGGCTCCTGGG + Intergenic
921601445 1:217110735-217110757 GTGGGATGTGTTTGGATCCTGGG - Intronic
922612302 1:226939750-226939772 GAGTGCTTTTTGTGGACCCTGGG + Intronic
1062829776 10:597916-597938 GGGTGCTTTCCTTGGCCCCTGGG - Intronic
1063674223 10:8125548-8125570 ATGTGACTTCTTTGGTTCCTTGG - Intergenic
1063870802 10:10415797-10415819 GTGTGCATTGTTTGTACCCTGGG - Intergenic
1064152759 10:12878564-12878586 GTATGCGTTCCTTGGATCCAAGG + Intergenic
1065563071 10:26982891-26982913 GAGTGGTTTGTTTGGATCCTGGG - Intergenic
1065564199 10:26992756-26992778 GAGTGGTTGGTTTGGATCCTGGG - Intronic
1068135480 10:52948454-52948476 GAGTCCTTTCTTTGCACCCTTGG + Intergenic
1068438477 10:57020393-57020415 ATGTCCTTTCTATTGATCCTGGG - Intergenic
1071297313 10:84231504-84231526 GTGTGTTTCATTTGGAGCCTGGG - Intergenic
1071802186 10:89076083-89076105 ATGTACTTTCTTTAGATTCTGGG + Intergenic
1072164799 10:92802756-92802778 GTGGGCTTGCTTGGCATCCTGGG + Intergenic
1073094684 10:100972409-100972431 GTGGGCGTTCTGTGGATGCTGGG + Intronic
1073524294 10:104164995-104165017 ATGTCTTTTCTTTGGAACCTGGG + Intronic
1074536741 10:114333390-114333412 GTGTGCTTTTACTGGAACCTAGG - Intronic
1075988407 10:126809655-126809677 GTGTGTTTTCTTTTTTTCCTAGG - Intergenic
1076073742 10:127514949-127514971 GCTTTCTTTCTTAGGATCCTTGG - Intergenic
1076323634 10:129602934-129602956 GTTTGCTTTGTGTGGAACCTCGG - Intronic
1076589233 10:131571859-131571881 GTGTGTTTTCATTGCAGCCTGGG + Intergenic
1077825814 11:5807367-5807389 GTGTGCTTTCTTTTTAGCTTTGG + Intronic
1077893653 11:6437704-6437726 TTGTGCTTTCTCTGGGTCCCAGG + Intronic
1079156915 11:17956558-17956580 CTTTGCTTTCTTTGGTTCCCAGG + Intronic
1079756148 11:24266390-24266412 GTGTGTTTTCCTTGAATCCAAGG - Intergenic
1079803071 11:24895830-24895852 GTTTTCTTTTTTTGGATCTTTGG + Intronic
1080300490 11:30779458-30779480 GTGTTCTTTCTCTGGCTGCTAGG + Intergenic
1080485057 11:32697424-32697446 GTGAACTTTCATTGGATCCTGGG - Intronic
1081859831 11:46326515-46326537 GTGTTCTTTCTTTAGATCTCTGG - Intergenic
1082099283 11:48158568-48158590 GGGTTGTTTCTTTGGAACCTGGG + Intronic
1085050584 11:73378046-73378068 GTGTCCTTTCTTCAGTTCCTTGG + Intronic
1088036072 11:105318074-105318096 GTGTGCTTTCTTTTGGACCTGGG - Intergenic
1089137701 11:116262996-116263018 GTGTTCTTTGATTGGATCCCAGG + Intergenic
1090512557 11:127391317-127391339 GTGTGTTGTCTTGGAATCCTAGG + Intergenic
1092745462 12:11668550-11668572 CTGTGCTGTCTTTGGAAACTGGG - Intronic
1092748444 12:11695432-11695454 GTCTGCTTTTACTGGATCCTGGG + Intronic
1093635356 12:21460107-21460129 GTGTGATTTCTTTAGAGCATTGG + Intronic
1095918560 12:47505738-47505760 GTCTGCCTTCTTTGGTTTCTCGG - Intergenic
1096513368 12:52143978-52144000 GTGTGGGTTCTGTGGAGCCTGGG + Intergenic
1096543758 12:52323072-52323094 GAGTCCTTTTTTTGGATCCATGG - Intergenic
1096966004 12:55628284-55628306 GTGGACTTTCTCTGAATCCTTGG + Intergenic
1097994832 12:65877006-65877028 GGGTGCTTTCTTTGCAGCCCTGG + Intronic
1101148671 12:101865338-101865360 GTCTGTTTTGTTTGGCTCCTGGG - Intergenic
1105330269 13:19409566-19409588 GTATGTTTTGTTTGGAGCCTTGG - Intergenic
1106338561 13:28806844-28806866 GTGTGCTTCCTCTGAAACCTTGG + Intergenic
1107376810 13:39812450-39812472 GTTTGCTTTCTGTGCCTCCTAGG + Intergenic
1108613783 13:52110570-52110592 GTGTTCTCTCTATAGATCCTCGG - Exonic
1108923022 13:55700113-55700135 GTGTACTTTCTTTAGATGCAGGG - Intergenic
1109395435 13:61752341-61752363 GTGTGCTCTCTGTGAATCCATGG + Intergenic
1110452767 13:75655817-75655839 TTGTTCTTTCTTTGGCTGCTGGG + Intronic
1111894830 13:94128499-94128521 GTGTCCTCACTTTGGATCCTAGG + Intronic
1113423697 13:110189881-110189903 GTTTCCTATCTTTGTATCCTTGG + Intronic
1114220169 14:20689315-20689337 GTGAGCCTTCTTTTGATCTTGGG - Intronic
1116713789 14:48402502-48402524 GTGTCCTTCCTTTTGTTCCTTGG - Intergenic
1116936137 14:50742369-50742391 GTGAGGTTTCTTTGTATCCCAGG - Intronic
1117286136 14:54287464-54287486 GTGTGCTTTCCCTGGATGCCTGG - Intergenic
1117983023 14:61360589-61360611 GTGTGTTTTCTTTGGATGAAAGG + Intronic
1119449768 14:74699245-74699267 GTGGGTTTTCTCTGGATACTTGG + Intronic
1120172998 14:81264940-81264962 CTGTGCTTTCTTTTGAGTCTAGG - Intronic
1120250704 14:82059360-82059382 GTGTTCTGTCGTTGGATCATAGG + Intergenic
1121326596 14:93023825-93023847 GTGAGCTTTCCTAGGATGCTGGG - Intronic
1122044000 14:99010577-99010599 GTGTGCTTTCTTTGGTGCTGGGG - Intergenic
1122209023 14:100162973-100162995 GTGTGCTGTCTCTGGGTCATGGG - Intergenic
1123137582 14:106043909-106043931 GAGTGCATTCTGGGGATCCTGGG - Intergenic
1202889878 14_KI270722v1_random:146161-146183 GTGTGTCTTCTTTGTGTCCTTGG + Intergenic
1126296645 15:47145306-47145328 GTGTTCTTTCTTTGTTTCCTTGG - Intergenic
1130538153 15:84801768-84801790 TGGTGCTTTCTTTGAGTCCTTGG + Intronic
1131057262 15:89382919-89382941 GTGTGCTTTTCTTAGATACTTGG + Intergenic
1131073960 15:89483377-89483399 GTGTGGTTTCTTTTCATTCTTGG - Intronic
1132154996 15:99489433-99489455 GTGTGCCTTCTGGGGATTCTGGG + Intergenic
1137063233 16:35811110-35811132 ATGTGTTTTTTTTGGATACTAGG - Intergenic
1137467643 16:48725295-48725317 GTGTTCTTTTCTTTGATCCTTGG + Intergenic
1137792103 16:51183926-51183948 AATTGCTTTCTTTGGATCCAGGG - Intergenic
1137807568 16:51321732-51321754 GGGATCTTTCTTGGGATCCTTGG + Intergenic
1137981044 16:53069918-53069940 GTGTGGTTTTTTTTGATCATAGG + Intronic
1140018155 16:71208907-71208929 CTGGGCTTTCTTTGGTTCGTAGG - Intronic
1141148184 16:81546555-81546577 CTGTGCTTTCTTCGGTTCCTGGG - Intronic
1143102798 17:4513580-4513602 GTGAACTTTCTCTGGGTCCTGGG + Intronic
1145993487 17:29092836-29092858 GTGTGCTCTCTGTGGATACCTGG + Exonic
1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG + Intronic
1153766422 18:8379000-8379022 GTTTTCTTTCTTTTGCTCCTTGG - Intronic
1157051932 18:44176318-44176340 GTGTCTCTTCTTTGCATCCTAGG + Intergenic
1157378071 18:47184288-47184310 GTGTGCTATCTGTGGGTCCAAGG - Intergenic
1157490107 18:48117111-48117133 GTGTGGTTTCTTTGGTTGTTGGG - Intronic
1157682120 18:49615361-49615383 CTGTGCTTTCTATGTCTCCTCGG - Intergenic
1159147282 18:64470134-64470156 GTGTGCTTCCTGAGGATCATTGG - Intergenic
1159348866 18:67244014-67244036 GTCTGCTTTCTTTTTACCCTAGG + Intergenic
1159972020 18:74666511-74666533 CTCTGCTTTGTTTTGATCCTTGG + Intronic
1163134347 19:15298837-15298859 GTTTTCTTTCTTTGGGTCTTAGG - Intronic
1164935579 19:32207937-32207959 GTGTGCTGCCATTGGATCCTGGG - Intergenic
1167052907 19:47090480-47090502 GTGCGCTTGCTCTGCATCCTTGG - Intronic
1167707598 19:51090765-51090787 GTGTCCTATCTTTGGAAGCTGGG + Intergenic
1167773311 19:51537436-51537458 GTGTGATTTCTTTGGCTAGTTGG + Intergenic
1168127593 19:54294649-54294671 GTGTGCTGTCTGTGCAGCCTGGG + Intergenic
1168186062 19:54700262-54700284 GTGTGCTCTCTGTGCAGCCTGGG - Intronic
1202665288 1_KI270708v1_random:112983-113005 GTGTGTCTTCTTTGTGTCCTTGG + Intergenic
926316265 2:11712391-11712413 CTGTGCTCTCTCTGGACCCTGGG + Intronic
927947311 2:27143717-27143739 GTCTGCCTTCTTTGGCTTCTCGG + Intergenic
928431685 2:31224237-31224259 GTGTTCTTTCCTGGGAGCCTGGG - Intronic
928663960 2:33531811-33531833 GTGTGGCTTATTTGGATTCTTGG + Intronic
928689364 2:33783127-33783149 TTGTGTTTTCTCTGGAACCTTGG + Intergenic
929758413 2:44786841-44786863 CTGGGCTTCCTTTGGATCCGAGG + Intergenic
931418144 2:62100646-62100668 ATTTCCTTTCTGTGGATCCTAGG - Intronic
931795058 2:65700720-65700742 GGGGGCTTTCCCTGGATCCTAGG + Intergenic
932325312 2:70855645-70855667 GTGAACTTTAATTGGATCCTGGG - Intergenic
936563705 2:113565474-113565496 TTGTTCTTTCTTTAGCTCCTTGG - Intergenic
939248503 2:139656413-139656435 ATGTGCTTTTTTTATATCCTAGG + Intergenic
942839838 2:180347207-180347229 GTGTGCTTTCTTTATCTCATGGG + Intergenic
943541883 2:189225884-189225906 ATGTGCTTTCTCTGACTCCTGGG + Intergenic
944492952 2:200276869-200276891 GTATGTTTTCTTTAGATCTTCGG - Intergenic
945204410 2:207316650-207316672 GTGTGCTTTCTCTGCACTCTTGG + Intergenic
947482537 2:230513770-230513792 TTGTGCTTGCTTTCGATCCATGG - Intronic
1174458465 20:50666158-50666180 GTGTCCTTTCTCTGTATTCTAGG - Intronic
1174937596 20:54888514-54888536 TTGTCCTTTCTTTGGATCTTAGG - Intergenic
1175681691 20:60994010-60994032 TTTTGCTTTCTTTCCATCCTTGG - Intergenic
1180332002 22:11489903-11489925 GTGTGTCTTCTTTGTGTCCTTGG + Intergenic
1180564621 22:16652261-16652283 GTATGTTTTGTTTGGAGCCTTGG + Intergenic
1184418615 22:44366441-44366463 GTTTGCTGTCTTTCCATCCTGGG - Intergenic
1184498182 22:44855728-44855750 GTGGGGTAACTTTGGATCCTGGG - Intronic
951581683 3:24171440-24171462 TTATGTTTTCTTAGGATCCTAGG + Intronic
951689972 3:25385244-25385266 TTGTCCTTTCTGTGGATCTTTGG - Intronic
956189700 3:66596894-66596916 GAGGGCTTTCTTTGGCTGCTGGG + Intergenic
957090634 3:75726596-75726618 GTGTGTCTTCTTTGTGTCCTTGG - Intronic
958800144 3:98745441-98745463 GTGTTCTTGCTTTGGGACCTAGG + Intronic
962587264 3:136854655-136854677 GAGAGCTTTCTTTGGAACCATGG + Exonic
964194884 3:154051881-154051903 CTGAGCTTTCTTTCAATCCTAGG - Intergenic
964988461 3:162774144-162774166 GAGTGGTTGCTTTGGATCCTGGG + Intergenic
968877061 4:3276627-3276649 TTGTGCTTTCTTTTGATTATGGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
971065639 4:23029293-23029315 ATATGCTTTCTTTGCATTCTCGG - Intergenic
971517326 4:27503476-27503498 GTGTGCTTTCTTTCATTCATCGG + Intergenic
971669893 4:29543027-29543049 GTCTGCGTTCTTTGGGGCCTGGG - Intergenic
972277183 4:37568266-37568288 GGCTGATTTCTTTGGCTCCTGGG + Intronic
972392092 4:38623387-38623409 GTGTGCTTTCTCTTGCCCCTGGG - Intergenic
973119271 4:46499186-46499208 TTGTGTTTTCTTTCCATCCTCGG - Intergenic
974158114 4:58101157-58101179 GTGGGCTTTCTTTGGTTGGTAGG + Intergenic
979448192 4:120839571-120839593 GTGTGCATTCTTTGGTTCACAGG + Intronic
979774913 4:124578158-124578180 GTGTGGTTTCATTGCATTCTAGG + Intergenic
980619991 4:135288652-135288674 GAGCGCTTTCTTTGTATCTTTGG + Intergenic
981817420 4:148847102-148847124 GTGTGTTTTGTTTGAATCCATGG - Intergenic
984648137 4:182241430-182241452 CTCTGCTTCCTCTGGATCCTTGG + Intronic
989216674 5:38911427-38911449 CTGGGCTTTCTCTGGTTCCTAGG - Intronic
991488218 5:67159751-67159773 GTGTCCTTTCTCTCAATCCTGGG - Intronic
993889223 5:93452964-93452986 TTGTGTTTTCTTTGGATTATGGG - Intergenic
995035512 5:107529824-107529846 CTGTGCTTTCTAGGGAGCCTAGG + Intronic
996418349 5:123234194-123234216 GAAGGCTTTCTTTGTATCCTGGG + Intergenic
996494574 5:124138978-124139000 ATGTACTTAGTTTGGATCCTAGG - Intergenic
999334467 5:150703738-150703760 GAGTGGTTGGTTTGGATCCTGGG - Intergenic
999608317 5:153341026-153341048 GTGTGCTTTTTTTGGAGCAAGGG + Intergenic
1002671985 5:180875067-180875089 TTCTGCTTTCCTTGGTTCCTGGG - Intergenic
1006304781 6:33212383-33212405 GTGGGGTCACTTTGGATCCTTGG - Exonic
1006686759 6:35841412-35841434 TTGTGCTTTCCTTGAATCTTTGG - Intronic
1006966430 6:37990363-37990385 GTTTGCTTTCTTTGAACCCAGGG + Intronic
1013136432 6:107287181-107287203 GTGGGCTTTATTTGGCTCTTGGG - Intronic
1013467210 6:110428284-110428306 ATGTGCTTCCTTTGGATCTAAGG - Intronic
1017252142 6:152292054-152292076 GTGTGCTCCCTGTGGCTCCTAGG - Intronic
1022548925 7:31218269-31218291 GTGAGCTTTCTGTGCATACTTGG - Intergenic
1022808283 7:33844766-33844788 CTGTGCTTTCTGTGGGTCATGGG + Intergenic
1026404789 7:70053944-70053966 ATTTGCTTTCTTTGGAGGCTGGG - Intronic
1026556283 7:71411459-71411481 GTGTGCTTCCATGGGAGCCTGGG + Intronic
1031238177 7:119203949-119203971 TTGTGCATTATTTGGTTCCTCGG - Intergenic
1035523498 8:293588-293610 GCGTCCTTTCTTTGCAGCCTGGG - Intergenic
1035586692 8:780858-780880 GGGGGATTCCTTTGGATCCTTGG - Intergenic
1038786303 8:30619886-30619908 GTCTCCTATCTCTGGATCCTTGG - Intronic
1040094616 8:43431811-43431833 GTTTTCTCTCTTTGGTTCCTGGG - Intergenic
1040853166 8:51923096-51923118 GTTTGCTTTCTATTGATCCCAGG - Intergenic
1042109414 8:65364580-65364602 GTCATTTTTCTTTGGATCCTGGG - Intergenic
1047742289 8:127816207-127816229 GTGTTCATAGTTTGGATCCTAGG - Intergenic
1047880520 8:129187438-129187460 GTGTGTTTTCTTTACATACTGGG - Intergenic
1048759563 8:137778696-137778718 TTCTGCTTTCTTGGGCTCCTGGG - Intergenic
1048852214 8:138656098-138656120 GTGTTCTTTCTGTGGCTCCCAGG - Intronic
1051389764 9:16551658-16551680 GTGTAGCCTCTTTGGATCCTGGG + Intronic
1052311248 9:27071807-27071829 GTGTGCTGCCTTTGGAACATGGG + Intergenic
1053750046 9:41243948-41243970 GTGTGCGTTTTTGGCATCCTGGG + Intergenic
1054697987 9:68380530-68380552 TTGTTCTTTCTTTAGCTCCTTGG - Intronic
1057498447 9:95578313-95578335 GAGGGCTTTCTTTGTCTCCTGGG + Intergenic
1203486981 Un_GL000224v1:65391-65413 GTGTGTCTTCTTTGTGTCCTTGG + Intergenic
1203499602 Un_KI270741v1:7291-7313 GTGTGTCTTCTTTGTGTCCTTGG + Intergenic
1186100153 X:6147211-6147233 GTGCTTTTTCTCTGGATCCTTGG - Intronic
1188535165 X:31189029-31189051 TTGTGCTTTCTATAAATCCTTGG + Intronic
1190153041 X:47964592-47964614 GTGTAGTTTCTTTTTATCCTTGG - Intronic
1190427692 X:50347985-50348007 GTGAGCTTTCTTTGGAACAAAGG - Intronic
1191147294 X:57180663-57180685 CTGTGCATTCTTCTGATCCTGGG - Intergenic
1192232681 X:69276893-69276915 GTTAGATTTCTTTGGCTCCTTGG + Intergenic
1192872230 X:75195281-75195303 ATGTGCTTGCAATGGATCCTTGG - Intergenic
1193693629 X:84680094-84680116 TAGTGATTACTTTGGATCCTGGG + Intergenic
1194095575 X:89634855-89634877 GTGTGTTTCATTTGGATCATTGG - Intergenic
1195174429 X:102301574-102301596 TTGTGTTTTCTTTTAATCCTTGG - Intergenic
1195184436 X:102385519-102385541 TTGTGTTTTCTTTTAATCCTTGG + Intronic
1195663422 X:107405206-107405228 GTAGGGTTTCTTTGGATCTTGGG - Intergenic
1196464138 X:115956358-115956380 GTTTGGTTTATGTGGATCCTGGG + Intergenic
1198948218 X:142039580-142039602 GTGGGAGTTATTTGGATCCTGGG - Intergenic
1199387718 X:147242139-147242161 AGCTGCTTTCTTTGGAGCCTAGG - Intergenic
1200448574 Y:3296220-3296242 GTGTGTTTCATTTGGATCATTGG - Intergenic
1200817401 Y:7547970-7547992 GTGTGCTTCCTCTGGGTCCCGGG + Intergenic
1200836769 Y:7740007-7740029 GTCTTCTTTCTTGTGATCCTAGG - Intergenic
1202601037 Y:26593241-26593263 GTATGTTTTGTTTGGAGCCTTGG + Intergenic