ID: 1150144372

View in Genome Browser
Species Human (GRCh38)
Location 17:62755375-62755397
Sequence TCTCCTTTCCAGGACACGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150144372_1150144379 3 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144379 17:62755401-62755423 GGCTCCTCTCCAACTCAGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 151
1150144372_1150144383 9 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144383 17:62755407-62755429 TCTCCAACTCAGGGTGGGGCTGG 0: 1
1: 0
2: 0
3: 26
4: 238
1150144372_1150144384 10 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144384 17:62755408-62755430 CTCCAACTCAGGGTGGGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 281
1150144372_1150144378 0 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144378 17:62755398-62755420 GGCGGCTCCTCTCCAACTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 123
1150144372_1150144387 28 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144387 17:62755426-62755448 CTGGGAGAGGTCTTGACAGCAGG 0: 1
1: 0
2: 0
3: 21
4: 194
1150144372_1150144386 15 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144386 17:62755413-62755435 ACTCAGGGTGGGGCTGGGAGAGG 0: 1
1: 1
2: 5
3: 128
4: 928
1150144372_1150144381 5 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144381 17:62755403-62755425 CTCCTCTCCAACTCAGGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 199
1150144372_1150144377 -1 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144377 17:62755397-62755419 AGGCGGCTCCTCTCCAACTCAGG 0: 1
1: 0
2: 1
3: 5
4: 123
1150144372_1150144380 4 Left 1150144372 17:62755375-62755397 CCCTTCGTGTCCTGGAAAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1150144380 17:62755402-62755424 GCTCCTCTCCAACTCAGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150144372 Original CRISPR TCTCCTTTCCAGGACACGAA GGG (reversed) Intronic
900865942 1:5268803-5268825 TGTTATTGCCAGGACACGAATGG + Intergenic
901831557 1:11895351-11895373 TCTCCTGTGTAGGCCACGAAGGG + Intergenic
904594665 1:31635761-31635783 TCTCCTTTCCTGCACATCAAGGG + Intronic
911330532 1:96521064-96521086 TCTCCTTTCTAGCACATGACAGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
914802387 1:150971157-150971179 TCTCCTTCCCAGGAGAACAAGGG - Intronic
918019553 1:180673163-180673185 TCTCCTTTCCAAGGCACAAATGG - Intronic
919129119 1:193432178-193432200 GGTCCCTTCCAGGACACGTAGGG + Intergenic
919498297 1:198305200-198305222 CCTCAATTCCAGGACAGGAAAGG + Intronic
919533282 1:198752340-198752362 TCTCAGTTCAAAGACACGAAGGG - Exonic
924758230 1:246961553-246961575 TCTCCTTCCCAAGACACTCAGGG + Intronic
1063930879 10:11027438-11027460 TCTCCTCTCCAACACAGGAAAGG - Intronic
1067474920 10:46558540-46558562 CCTCCTTGCCAGGGCATGAATGG - Intergenic
1070606512 10:77902112-77902134 TCTCCCTTCCAGGACAGGCTTGG + Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1073597675 10:104817209-104817231 TTTCCTTTCCAGGAAATTAAGGG + Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074534713 10:114320533-114320555 TCTCCTTGGCAGGACAGGCAGGG + Intronic
1075772699 10:124953360-124953382 TGTCCTTTCCAAGACACAAATGG + Intronic
1077076182 11:703220-703242 TCCCCATTCCTGGACAGGAAGGG + Exonic
1078159499 11:8828499-8828521 ACTGCTTTCAAGGACACCAAAGG + Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079064937 11:17281485-17281507 TTTCCTTTTCAAGACAAGAAGGG + Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085295258 11:75427920-75427942 TCTCCTCTCCAGGACACTCCAGG + Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091337477 11:134783227-134783249 TCTCCCTTCCAGGGCAGGACTGG + Intergenic
1091786358 12:3245431-3245453 CCTCCTTTGCAGCACACAAAAGG - Intronic
1096845972 12:54406839-54406861 TCTCCTTTCTAGGAAAAGGATGG - Intronic
1102427407 12:112855044-112855066 TCTATTTTCCATGACAGGAAAGG + Intronic
1104102104 12:125622472-125622494 AGTCCTTTCCAGCACAGGAAAGG - Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1106476571 13:30103701-30103723 TCTCCTTTCATGGAAACAAAAGG + Intergenic
1108282734 13:48875868-48875890 TCTCTTTTACAGGACACTCAGGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1114897284 14:27007299-27007321 TCTGCATTCCAGGTCACTAAAGG - Intergenic
1115126131 14:29996536-29996558 TGTCATTTCCAGTACACCAATGG - Intronic
1115528060 14:34301022-34301044 TGTCGTTTCCAGTACACAAAAGG + Intronic
1117546308 14:56797226-56797248 TCTCCTTTTCGTGCCACGAAAGG - Intergenic
1119053929 14:71399283-71399305 TCTCATTTACAGGAAACGGATGG - Intronic
1120866962 14:89303357-89303379 TCTCCTTTCCATGAAACACAGGG + Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1129411846 15:75354673-75354695 GGCCCCTTCCAGGACACGAAGGG + Exonic
1129786642 15:78314256-78314278 TCTCCACTCCAGGACCCGACAGG - Intergenic
1131812024 15:96182583-96182605 TGTCTATTCCAGGACACGAGAGG + Intergenic
1137896679 16:52220081-52220103 TCTCCCTTCCAGGTCACTCAAGG - Intergenic
1139730192 16:68937227-68937249 TCCCTTTTCCAGGACATAAATGG - Intronic
1140675110 16:77320344-77320366 TCTCCTTCCCAGACCACAAAAGG + Intronic
1141419860 16:83906975-83906997 TCTCCTTTTCAGGAAATGAATGG + Exonic
1141600595 16:85123926-85123948 TCTCCTCTCCAGGACAGGCGCGG - Intergenic
1143323229 17:6081205-6081227 TCTGCTCTGCAGGACAGGAAGGG + Intronic
1144664490 17:17092672-17092694 TGTCCTTTCCAGAGCAGGAAAGG + Intronic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1151666813 17:75549852-75549874 ACTCCTTTCCAGGTCCCGGAAGG - Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1155918717 18:31581276-31581298 TGTCTCTTCCAGGACACCAAAGG + Intergenic
1159015336 18:63097875-63097897 TCTCCTTTCCAGGAAAGCCAAGG + Intergenic
1159268033 18:66110265-66110287 TCTCCTTTCTAAGAGAAGAAAGG - Intergenic
1159567894 18:70075611-70075633 TCTCCTCTCGAGGAAACAAATGG + Intronic
1159910471 18:74140683-74140705 TTTCCTTACCAGGACACTAAAGG - Intronic
1159940768 18:74406114-74406136 TCTCTTTTCCAGGAAAGGAATGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160836586 19:1127411-1127433 TCTCCTATTCAGGACACAAGAGG + Intronic
1161408385 19:4102881-4102903 TCCTCTTCCCAGCACACGAAGGG + Intronic
1161655245 19:5510421-5510443 TCTCCGTTGCAGGACACGACAGG + Intergenic
1164877236 19:31700078-31700100 TCTCCCTCCCAGGACACCCAGGG - Intergenic
1166178785 19:41092685-41092707 TCTGCTAACCAGGACATGAACGG - Intronic
925111296 2:1340371-1340393 TATCCTTTCCAGGATAGAAAGGG + Intronic
925191139 2:1884775-1884797 TCTCCCCTCCAGGACAAGACAGG + Intronic
926225350 2:10963188-10963210 TTTTCTTTCCAGAACAGGAATGG + Intergenic
931212994 2:60215118-60215140 TTTCATTTCCAGGCCCCGAAAGG - Intergenic
932662015 2:73663194-73663216 TCCCCTTCCCAGGACATGACTGG + Intergenic
934781621 2:96972784-96972806 TCTCATTTCAAGGACATGATGGG + Intronic
937402453 2:121596440-121596462 TCTCCTCTCAAGGACACAAGCGG + Intronic
939055381 2:137359216-137359238 GCTCCTTTCCAGGACCCTGAAGG - Intronic
943568416 2:189543670-189543692 TCTACTTTCCAGGACAGAATTGG + Intergenic
945935861 2:215902101-215902123 TTTCCCCTCCAGGAGACGAAAGG - Intergenic
946269786 2:218581458-218581480 TTTCCTTTCCAGGCCAGGCATGG - Intronic
946952727 2:224894948-224894970 GCTCCTTTCCAGGGCACACAGGG + Intronic
947801709 2:232932801-232932823 TCTCTTTTAAAGGACACTAAGGG + Intronic
947819561 2:233060529-233060551 GCTGCTTTCCAGGACAGGCAAGG + Exonic
948540440 2:238687752-238687774 TCACCTTTCCAGGAAAAAAAAGG - Intergenic
1173613019 20:44384728-44384750 TCTCCTTTCCGGCACATGATGGG - Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1177114400 21:17067793-17067815 TCTTCTTTTCAGGACACCGATGG - Intergenic
1178275816 21:31236028-31236050 TCCCCTTTCCAGGAGACAGAGGG - Intronic
1182917241 22:34045821-34045843 TCTAGCTTCCAGGACACAAAGGG + Intergenic
950863280 3:16169258-16169280 TCTCCCTTACATGACAAGAAAGG - Intergenic
953791477 3:45951102-45951124 TCTTCTTTGCAGGAGACGACTGG + Intronic
955111600 3:55956574-55956596 TATCCTTTCCAGGAAGAGAAAGG + Intronic
962041656 3:131713676-131713698 ACTCCAATCCAGGACACTAAAGG + Intronic
962679788 3:137786217-137786239 GCTCTTTTCAAGGACAGGAAAGG + Intergenic
963009808 3:140758662-140758684 ACTTCTTTCCAGGACACGTGAGG - Intergenic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964051962 3:152405105-152405127 TCTCCTTTGCAGAACTCAAAAGG + Intronic
967611851 3:191515632-191515654 TGTATTTTCCAGGACACCAAAGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969551122 4:7867896-7867918 TCTCTCTGCCAGGATACGAACGG - Intronic
970643175 4:18090168-18090190 TCTCCTGGGCAGGACAGGAAAGG - Intergenic
972643581 4:40947115-40947137 TCTCCTTTTCAGGGGACGAAGGG + Intronic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
973066627 4:45802830-45802852 TGTCCCTTCCAGGACATGAGGGG + Intergenic
975158158 4:71094784-71094806 TCATTTTTCCAGGACAAGAAAGG + Intergenic
975802957 4:78081522-78081544 TCTCCTTTCCAGGTAAACAATGG - Intronic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
978200207 4:106016844-106016866 TTTCCTTTCCAGAACACCAAAGG + Intergenic
980740422 4:136942873-136942895 TTTTCTTTTCAGGACACGATTGG + Intergenic
985703926 5:1389868-1389890 TCCCCTTCCCAGGACACCAGTGG + Intergenic
986700059 5:10397963-10397985 TCTCCTTTCCAGAAGAGGTAAGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
995079221 5:108028171-108028193 ACTCTTTTTCAGGACAAGAATGG - Intronic
996393419 5:122988063-122988085 CCCCCTTTCCAGGACACGGTTGG + Intronic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
1001435090 5:171693824-171693846 TCTCTTTTCCAGGCTAGGAATGG - Intergenic
1001595320 5:172895112-172895134 TCTTCTTTGCAGGAAACTAAGGG + Intronic
1002210386 5:177595507-177595529 TCTCCCTTCCAGAACAGGTATGG - Exonic
1003076583 6:2988426-2988448 AGTCCTTTCCAGGACACTGAAGG + Intronic
1006168452 6:32079567-32079589 GCTCCTTTCTCAGACACGAAGGG - Intronic
1006363047 6:33598109-33598131 CCTCCTTTCATGGGCACGAAGGG + Intergenic
1008323557 6:50148446-50148468 TCTCCCTCCCAGGACAGCAATGG + Intergenic
1009564239 6:65291597-65291619 TGTTCTTTCCATGACATGAATGG + Intronic
1011783155 6:90813231-90813253 TCTCCTTTCCAGTAGACTAACGG + Intergenic
1013097728 6:106961201-106961223 TCTCCTTTCCAAGGCACAGAGGG - Intergenic
1018140301 6:160826956-160826978 TGTTCTTTCCACGACATGAAAGG + Intergenic
1018747410 6:166773148-166773170 TTTCCGATCCAGGACACGAGAGG + Intronic
1019766694 7:2856610-2856632 TCTCCTCTCCAGGGCACAAGAGG - Intergenic
1020006481 7:4786141-4786163 CCTGCTCTCCAGGACACCAAGGG - Intronic
1023103991 7:36746200-36746222 AGTCCTTTCCAGGACACCAAAGG + Intergenic
1023137012 7:37062888-37062910 GCTACTTTCCAGGAAAAGAAAGG + Intronic
1023515787 7:41000032-41000054 TTTCCTTTCCAGAACAAGATGGG + Intergenic
1027485875 7:78761232-78761254 TCTCTTTCCCAGGACATGCAAGG + Intronic
1028152043 7:87384972-87384994 TCTCCTTTTCAGCAAAGGAAAGG - Intronic
1029144295 7:98434747-98434769 TCTCCTTTCCGGGTGATGAAGGG - Intergenic
1032852418 7:135806242-135806264 TCTCCATGCCAGGCCACGCAGGG - Intergenic
1032920858 7:136545063-136545085 TCTCTTTTCCAGGTCAGGGAAGG + Intergenic
1034068264 7:148157426-148157448 TCTCCTTTCCAAAGCAAGAAGGG + Intronic
1036103756 8:5817343-5817365 TCTCCTTGCCAGGGCCAGAAGGG + Intergenic
1036638526 8:10567605-10567627 TCTCCCTGCCAGGAAAAGAAAGG + Intergenic
1041887005 8:62821754-62821776 TCTCTTTTGGAGGACACGACAGG + Intronic
1050616327 9:7405132-7405154 TCTAATTCCCAGGACACTAATGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1056840273 9:89993079-89993101 TCTCCTTCCCTGGAAACGAGTGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187792601 X:22967406-22967428 CATCCTTTCCAGGACACTAGGGG + Intergenic
1188831776 X:34906922-34906944 TCTCCTTTCCTGGACAACACTGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195962701 X:110402424-110402446 TCTCCTCTCCCTGACAGGAAAGG - Intronic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic