ID: 1150145936

View in Genome Browser
Species Human (GRCh38)
Location 17:62769505-62769527
Sequence GCACAAGAATTGAACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150145936_1150145941 26 Left 1150145936 17:62769505-62769527 CCCTGCAGGTTCAATTCTTGTGC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1150145941 17:62769554-62769576 TAGGTGCACGCCAACATGCCTGG 0: 2
1: 62
2: 1412
3: 11065
4: 38268
1150145936_1150145938 -2 Left 1150145936 17:62769505-62769527 CCCTGCAGGTTCAATTCTTGTGC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1150145938 17:62769526-62769548 GCCTCAATCTTCTGAGTAGCAGG 0: 7
1: 374
2: 9696
3: 108395
4: 212020
1150145936_1150145940 7 Left 1150145936 17:62769505-62769527 CCCTGCAGGTTCAATTCTTGTGC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1150145940 17:62769535-62769557 TTCTGAGTAGCAGGTACTATAGG 0: 1
1: 11
2: 421
3: 8012
4: 69442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150145936 Original CRISPR GCACAAGAATTGAACCTGCA GGG (reversed) Intronic
904346749 1:29877458-29877480 GCACAAAAATGCAACATGCATGG + Intergenic
907306566 1:53516437-53516459 GCAAAATAAATGAAACTGCACGG + Intronic
907352903 1:53848132-53848154 GCACCAGAAAAGAAACTGCACGG - Intergenic
908199908 1:61783835-61783857 GCACAAGACTTGAACCTGGGAGG - Intronic
909962349 1:81861791-81861813 GCAGGAGAATTGAACCTGGGAGG + Intronic
911092468 1:94028815-94028837 GCACAAGAATTGAACCTGGGAGG + Intronic
912186049 1:107277019-107277041 TCACAAGGATTAAACCTGCATGG - Intronic
921376640 1:214481208-214481230 GCACAAGAATAAAAACTGCCGGG + Intronic
922179980 1:223225848-223225870 CCACAAGAGTAGAGCCTGCAGGG - Intronic
1067685814 10:48465544-48465566 GTCCAGGAATTGACCCTGCAAGG - Intronic
1068959108 10:62848785-62848807 GCACGAGAGTTGAGACTGCAAGG - Intronic
1070781032 10:79137682-79137704 CCACAAGATTTGCACCTGGAAGG + Intronic
1073894965 10:108144764-108144786 GGGCAAGAATTGAAACTGGAAGG - Intergenic
1073918011 10:108428463-108428485 GATCAAGAATGGATCCTGCAAGG - Intergenic
1075110074 10:119572263-119572285 GCAGGAGAATTGAACCTGGGAGG - Exonic
1076565457 10:131395558-131395580 GCACAGGGATTGAACCTCCCTGG - Intergenic
1076582897 10:131525423-131525445 GCACAAAAAGTGAACATACATGG + Intergenic
1079034346 11:17009219-17009241 GCAAAATCATTGAACCTTCATGG + Intronic
1080573641 11:33578942-33578964 TCACAAGAATAGAACCAGGAAGG - Intronic
1085539331 11:77252574-77252596 GCACAAGAAATGAAAAAGCAAGG - Intronic
1089866084 11:121633051-121633073 ACACAAAAATTGTACCTGAAAGG - Exonic
1091313722 11:134595976-134595998 GCACATGAACTGAATCTGTATGG + Intergenic
1092753879 12:11744735-11744757 TTACAAGCTTTGAACCTGCATGG - Intronic
1092854886 12:12664081-12664103 ACACAAGAATTGAACCTGGGAGG - Intronic
1093881221 12:24406310-24406332 TCAGAAGAATTGAAGCTGCGTGG + Intergenic
1097902067 12:64883109-64883131 GCAACAGAATTTAACCTGGAAGG + Intergenic
1098227552 12:68340329-68340351 GAAGAAGAAGTGAAGCTGCAAGG + Intergenic
1098257502 12:68632225-68632247 GCCCAAGAATTGAACCTGGGAGG - Intronic
1100906493 12:99306031-99306053 GCACAAGAATTTGAACTCCAGGG + Intronic
1102189655 12:110977551-110977573 GAACAAGAAATAAACCTGTATGG - Intergenic
1104506726 12:129339175-129339197 GCATGAGAATTGAACCTGGGAGG + Intronic
1106794877 13:33194994-33195016 GCACAAGAAGTGAAGTAGCATGG - Intronic
1107014718 13:35698810-35698832 GCACAAGAACAGAAGTTGCATGG - Intergenic
1113202795 13:107885768-107885790 GCATAAGAAATGAACGAGCATGG + Intergenic
1116906529 14:50408909-50408931 GCAGGAGAATTGAACCTGGGAGG + Intronic
1118545424 14:66881982-66882004 GCACAAAAAATGAACATTCAGGG - Intronic
1119187900 14:72656927-72656949 GCACATGAAATGATCCTGAAGGG - Intronic
1119211293 14:72834086-72834108 GCACGAGAATTGAACCTGGGAGG + Intronic
1120039118 14:79732054-79732076 GCACAAAAATAGAAGTTGCATGG - Intronic
1120867773 14:89310249-89310271 TCACTGGACTTGAACCTGCAGGG + Intronic
1202883791 14_KI270722v1_random:85114-85136 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1127140733 15:55973461-55973483 GCCCAAGAGTTGAGGCTGCAAGG + Intronic
1127396508 15:58547727-58547749 GCACAAGAATTGGATTTGGAAGG - Intronic
1127494594 15:59497931-59497953 GCCCAAGAGTTCAAACTGCAGGG - Intronic
1127706004 15:61547862-61547884 GAACATGGATAGAACCTGCAGGG + Intergenic
1129732650 15:77940826-77940848 CCACAAGGATTGGACTTGCAGGG + Intergenic
1131544578 15:93305360-93305382 GCAGAAGGCTGGAACCTGCAGGG + Intergenic
1132235006 15:100213198-100213220 GAACATGAATTGAACATCCATGG + Intronic
1132541743 16:512984-513006 GCACAAGCATTAAAGCAGCATGG + Intronic
1133407811 16:5539509-5539531 GCAGGAGAATTGAACCTGGGAGG + Intergenic
1133447144 16:5871413-5871435 GCACATTAATTGGCCCTGCATGG + Intergenic
1136604384 16:31323334-31323356 GCAGGAGAATTGAACCTGGGAGG + Intronic
1138127086 16:54447925-54447947 GCACCAGCATTGATCCTGCCGGG - Intergenic
1143268113 17:5655726-5655748 TCATAAAAATTGAACTTGCATGG - Intergenic
1143503371 17:7351477-7351499 GCCCAAGAAGTGAACCAGAAGGG - Exonic
1150145936 17:62769505-62769527 GCACAAGAATTGAACCTGCAGGG - Intronic
1151348704 17:73518986-73519008 GCAGAAGAGTGGTACCTGCATGG - Intronic
1153527658 18:6013129-6013151 GCATCAGAATTGGACCTACAGGG - Intronic
1156257795 18:35414333-35414355 GCAGAAGGATTGAACCTGGGAGG + Intergenic
1157236379 18:45968464-45968486 GCAGGAGAATTGAACCTGGGAGG + Intergenic
1158264638 18:55648781-55648803 GTATAAGAATTGCACCTGCTAGG + Intronic
1162387952 19:10371544-10371566 GCAGGAGAATTGAACCTGGGAGG + Intronic
1165920299 19:39293308-39293330 GCCCGAGAATTGACCCTCCAAGG + Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1166729091 19:45048239-45048261 GCATAAGAATAGTACCTGCTGGG + Intronic
1167631293 19:50627831-50627853 GCACAAGAATTAGGCCAGCATGG + Intronic
1168604496 19:57747526-57747548 GAACAAGAATTCAACCTCCCAGG - Intronic
1202632937 1_KI270706v1_random:16593-16615 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1202652937 1_KI270707v1_random:23457-23479 GTACAAGAAAGGCACCTGCAAGG + Intergenic
1202659216 1_KI270708v1_random:52288-52310 GTACAAGAAAGGCACCTGCAAGG - Intergenic
927304843 2:21559136-21559158 ACACAAGTATTGATCCTACATGG - Intergenic
931093469 2:58913187-58913209 GCACGGGCATTCAACCTGCACGG + Intergenic
931847216 2:66216917-66216939 GCACAAGAAACAAACCTCCAAGG - Intergenic
934156175 2:89203168-89203190 GCAGAAGGGTTGACCCTGCATGG + Intergenic
934211142 2:89979595-89979617 GCAGAAGGGTTGACCCTGCATGG - Intergenic
938114397 2:128593616-128593638 ACTCAAGAATTGAACATGCCAGG + Intergenic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1171082683 20:22203935-22203957 GCCCAATGATTGAACTTGCAAGG - Intergenic
1174775815 20:53342122-53342144 TCACAACAAATGAACCAGCACGG + Intronic
1176599214 21:8776194-8776216 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1176645160 21:9342473-9342495 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1179099563 21:38344888-38344910 TCACAAGAATTGGAACTGGAGGG + Intergenic
1180326678 22:11435813-11435835 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1180367794 22:11956761-11956783 GTACAAGAAAGGCACCTGCAAGG + Intergenic
1180378300 22:12114573-12114595 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1180419214 22:12798706-12798728 GTACAAGAAAGGCACCTGCAAGG + Intergenic
1183256281 22:36764532-36764554 GCACAAAAATGTAACTTGCATGG - Intronic
949966612 3:9362146-9362168 AAAAAAGAGTTGAACCTGCATGG - Intronic
949996004 3:9618019-9618041 GCACAAAAATTGAAAGTGCCTGG + Intergenic
958477995 3:94609502-94609524 GCAAAAGGATTGCACCTGGAAGG + Intergenic
960392425 3:117094356-117094378 GCAGAAGAATTGAAGCACCAGGG - Intronic
961077913 3:123998777-123998799 GCACAAGAATTGTATCTCCTGGG + Intergenic
961679455 3:128589363-128589385 GCACAATCAATGAACCTGCCTGG + Intergenic
962518287 3:136173970-136173992 GAAGAAGAATTGACCATGCAAGG - Intronic
963781237 3:149488723-149488745 GCACTAGACTTTAACCTCCAAGG + Intronic
964097217 3:152946374-152946396 GCAGGAGAATTGAACCTGGGAGG - Intergenic
964186871 3:153956357-153956379 GCTCAAGAATATAAACTGCACGG - Intergenic
965034414 3:163419258-163419280 GCACAAGAATTGAACATGGGGGG - Intergenic
1202741732 3_GL000221v1_random:62595-62617 GTACAAGAAAGGCACCTGCAAGG + Intergenic
969547736 4:7842827-7842849 GCACAAGATTTTAACTTGCCAGG - Intronic
969832798 4:9811398-9811420 GAGCAGGAATAGAACCTGCAAGG - Intronic
970347875 4:15171083-15171105 GCAGGAGAATTGAACCAGCGAGG - Intergenic
972529605 4:39949733-39949755 GCACAATCACTGAACTTGCAGGG + Intronic
973362576 4:49178567-49178589 GTACAAGAAAGGCACCTGCAAGG - Intergenic
973398526 4:49618286-49618308 GTACAAGAAAGGCACCTGCAAGG + Intergenic
976308952 4:83590981-83591003 GCAGGATAATTGAAGCTGCATGG + Intronic
976949374 4:90810553-90810575 GCAGGAGAATTGAACCTGGGAGG + Intronic
978037567 4:104014606-104014628 GAACTAGAAATGAACCTGCAAGG + Intergenic
979314732 4:119248521-119248543 ACACAAGAATTAAACATGTAGGG - Intronic
982128316 4:152203657-152203679 GCACAGGAATTGATCTTGGAAGG - Intergenic
982398711 4:154941924-154941946 GCACAAAAATTTATGCTGCACGG + Intergenic
983627937 4:169821813-169821835 GCAGAAGAAATGAAAGTGCAAGG + Intergenic
1202759921 4_GL000008v2_random:100039-100061 GTACAAGAAAGGCACCTGCAAGG - Intergenic
986425626 5:7628493-7628515 GCTCAAGAACTGAACCATCATGG + Intronic
990661097 5:58016323-58016345 GCACAAGAATAGAACCAAGAAGG + Intergenic
992318688 5:75587824-75587846 GCACAAGAATTGAACCCAGGAGG + Intronic
992952345 5:81872754-81872776 GCAAAAGAATTGAGCCTTAATGG + Intergenic
994994267 5:107039494-107039516 CCACAAGAATTTAATCTCCACGG + Intergenic
997220916 5:132162838-132162860 GCACTTGAAATGAACATGCAGGG + Intergenic
1001530676 5:172459346-172459368 GGACATTAATTGAACCTCCAGGG + Intergenic
1003703650 6:8498742-8498764 GGACAAGAATTTATCCTGAATGG - Intergenic
1005075274 6:21900964-21900986 GCACAAGAATGGATCATGCAGGG + Intergenic
1005921274 6:30404056-30404078 GCACTATAATAGAACCTGGACGG + Intergenic
1009775720 6:68203911-68203933 GAAAAAAAATTGCACCTGCAGGG - Intergenic
1012044340 6:94250523-94250545 GCATAAGCATTTAACATGCAGGG - Intergenic
1012751925 6:103175111-103175133 GCACAAAGGTTGAACCTGAAGGG - Intergenic
1024231691 7:47368223-47368245 TCACAAGAGTTGAAACTGCAAGG + Intronic
1024867900 7:53925013-53925035 GCTTAAGAATTGAACCTGGTGGG - Intergenic
1025189982 7:56888876-56888898 GCAAGAGAATTGAACCTGGGAGG + Intergenic
1025681957 7:63688045-63688067 GCAAGAGAATTGAACCTGGGAGG - Intergenic
1031883344 7:127220951-127220973 GGACCAGAATTATACCTGCATGG - Intronic
1031995751 7:128229730-128229752 GCACAAGCATTCAACCAGAATGG - Intergenic
1034450619 7:151135323-151135345 GCACAGGAATGGCACCAGCAGGG - Intronic
1036117451 8:5973203-5973225 GCTTAATAAATGAACCTGCAAGG - Intergenic
1037934318 8:22904376-22904398 GCACCAGCATTAACCCTGCAGGG + Intronic
1044630809 8:94276909-94276931 GAACAAGACTGGAAGCTGCAAGG + Intergenic
1046734983 8:117767361-117767383 GAACAGGAATGGGACCTGCATGG + Intergenic
1055788679 9:79898578-79898600 GCACACACATTGAACCTGAAAGG + Intergenic
1058999412 9:110332885-110332907 GGACAAGAAAGGAACATGCAAGG + Intronic
1060074832 9:120581661-120581683 GCACTAGACTGGAAGCTGCATGG + Intergenic
1061613896 9:131766653-131766675 GCACAGCAATTGGCCCTGCAGGG + Intergenic
1203691702 Un_GL000214v1:48255-48277 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1203710362 Un_KI270742v1:92519-92541 GTACAAGAAAGGCACCTGCAAGG + Intergenic
1203540694 Un_KI270743v1:84933-84955 GTACAAGAAAGGCACCTGCAAGG - Intergenic
1203644593 Un_KI270751v1:55936-55958 GTACAAGAAAGGCACCTGCAAGG + Intergenic
1186737770 X:12483995-12484017 GCAAAAGAATGGAATTTGCAGGG + Intronic
1190573909 X:51813801-51813823 GCATAAACATTGAGCCTGCAAGG + Intronic
1194717818 X:97307302-97307324 ACACAAGGATTAAACCTGAAAGG - Intronic
1196026896 X:111050787-111050809 GCACAAGCATTGAAACTGGCTGG - Intronic
1201375918 Y:13318911-13318933 GCAGAAAAATTGAACCTGGGAGG + Intronic