ID: 1150157566

View in Genome Browser
Species Human (GRCh38)
Location 17:62866895-62866917
Sequence CTCAGAGTTACACCATCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150157566_1150157568 -3 Left 1150157566 17:62866895-62866917 CCCTCAGATGGTGTAACTCTGAG No data
Right 1150157568 17:62866915-62866937 GAGCTGTGTCTTTTATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150157566 Original CRISPR CTCAGAGTTACACCATCTGA GGG (reversed) Intergenic
No off target data available for this crispr