ID: 1150158917

View in Genome Browser
Species Human (GRCh38)
Location 17:62877652-62877674
Sequence GCCACAAGCCCCAAAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150158916_1150158917 -7 Left 1150158916 17:62877636-62877658 CCATGGTCTAAAAATGGCCACAA No data
Right 1150158917 17:62877652-62877674 GCCACAAGCCCCAAAATAACAGG No data
1150158913_1150158917 18 Left 1150158913 17:62877611-62877633 CCATCTGTGTGTTACTGAAAAGC No data
Right 1150158917 17:62877652-62877674 GCCACAAGCCCCAAAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150158917 Original CRISPR GCCACAAGCCCCAAAATAAC AGG Intergenic