ID: 1150160465

View in Genome Browser
Species Human (GRCh38)
Location 17:62893850-62893872
Sequence TGCCATTGCCAGAGTGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150160465_1150160470 3 Left 1150160465 17:62893850-62893872 CCCAGTCCACTCTGGCAATGGCA No data
Right 1150160470 17:62893876-62893898 CACCTTGGTATAGTCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150160465 Original CRISPR TGCCATTGCCAGAGTGGACT GGG (reversed) Intergenic
No off target data available for this crispr