ID: 1150160701

View in Genome Browser
Species Human (GRCh38)
Location 17:62895518-62895540
Sequence CCACCCCACTGGGGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150160701_1150160709 12 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160709 17:62895553-62895575 GTGGTATGAGGATATGAGAAAGG No data
1150160701_1150160707 0 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160707 17:62895541-62895563 ACACCATAAACAGTGGTATGAGG No data
1150160701_1150160710 17 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160710 17:62895558-62895580 ATGAGGATATGAGAAAGGACTGG No data
1150160701_1150160706 -7 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160706 17:62895534-62895556 GGGGTGGACACCATAAACAGTGG No data
1150160701_1150160712 19 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160712 17:62895560-62895582 GAGGATATGAGAAAGGACTGGGG No data
1150160701_1150160713 29 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160713 17:62895570-62895592 GAAAGGACTGGGGAAGCTACAGG No data
1150160701_1150160711 18 Left 1150160701 17:62895518-62895540 CCATTTTCACCCCAGTGGGGTGG No data
Right 1150160711 17:62895559-62895581 TGAGGATATGAGAAAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150160701 Original CRISPR CCACCCCACTGGGGTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr