ID: 1150168330

View in Genome Browser
Species Human (GRCh38)
Location 17:62966132-62966154
Sequence CGGAGGGAGCGCGCGTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150168330_1150168347 16 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168347 17:62966171-62966193 CACCCCAGCCCGGAGGGGGCGGG No data
1150168330_1150168356 27 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168356 17:62966182-62966204 GGAGGGGGCGGGGCTGCGGGCGG No data
1150168330_1150168341 11 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168341 17:62966166-62966188 CTCCCCACCCCAGCCCGGAGGGG No data
1150168330_1150168354 24 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168354 17:62966179-62966201 CCCGGAGGGGGCGGGGCTGCGGG No data
1150168330_1150168352 23 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168352 17:62966178-62966200 GCCCGGAGGGGGCGGGGCTGCGG No data
1150168330_1150168338 9 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168338 17:62966164-62966186 CCCTCCCCACCCCAGCCCGGAGG No data
1150168330_1150168348 17 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168348 17:62966172-62966194 ACCCCAGCCCGGAGGGGGCGGGG No data
1150168330_1150168335 6 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168335 17:62966161-62966183 CGCCCCTCCCCACCCCAGCCCGG No data
1150168330_1150168346 15 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168346 17:62966170-62966192 CCACCCCAGCCCGGAGGGGGCGG No data
1150168330_1150168340 10 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168340 17:62966165-62966187 CCTCCCCACCCCAGCCCGGAGGG No data
1150168330_1150168342 12 Left 1150168330 17:62966132-62966154 CCCACGCACGCGCGCTCCCTCCG No data
Right 1150168342 17:62966167-62966189 TCCCCACCCCAGCCCGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150168330 Original CRISPR CGGAGGGAGCGCGCGTGCGT GGG (reversed) Intergenic
No off target data available for this crispr